Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
August-2018 Volume 16 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2018 Volume 16 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Histone deacetylase inhibitors induce the expression of tumor suppressor genes Per1 and Per2 in human gastric cancer cells

  • Authors:
    • Fabiola Hernández‑Rosas
    • Andrés Hernández‑Oliveras
    • Lucía Flores‑Peredo
    • Gabriela Rodríguez
    • Ángel Zarain‑Herzberg
    • Mario Caba
    • Juan Santiago‑García
  • View Affiliations / Copyright

    Affiliations: Programa de Doctorado en Ciencias Biomédicas, Universidad Veracruzana, Xalapa, Veracruz 91190, México, Instituto de Investigaciones Biológicas, Universidad Veracruzana, Xalapa, Veracruz 91190, México, Departamento de Bioquímica, Facultad de Medicina, Universidad Nacional Autónoma de México, Mexico City 04510, México, Centro de Investigaciones Biomédicas, Universidad Veracruzana, Xalapa, Veracruz 91190, México
  • Pages: 1981-1990
    |
    Published online on: May 31, 2018
       https://doi.org/10.3892/ol.2018.8851
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Period circadian regulator (Per)1 and Per2 genes are involved in the molecular mechanism of the circadian clock, and exhibit tumor suppressor properties. Several studies have reported a decreased expression of Per1, Per2 and Per3 genes in different types of cancer and cancer cell lines. Promoter methylation downregulates Per1, Per2 or Per3 expression in myeloid leukemia, breast, lung, and other cancer cells; whereas histone deacetylase inhibitors (HDACi) upregulate Per1 or Per3 expression in certain cancer cell lines. However, the transcriptional regulation of Per1 and Per2 in cancer cells by chromatin modifications is not fully understood. The present study aimed to determine whether HDACi regulate Per1 and Per2 expression in gastric cancer cell lines, and to investigate changes in chromatin modifications in response to HDACi. Treatment of KATO III and NCI‑N87 human gastric cancer cells with sodium butyrate (NaB) or Trichostatin A (TSA) induced Per1 and Per2 mRNA expression in a dose‑dependent manner. Chromatin immunoprecipitaion assays revealed that NaB and TSA decreased lysine 9 trimethylation on histone H3 (H3K9me3) at the Per1 promoter. TSA, but not NaB increased H3K9 acetylation at the Per2 promoter. It was also observed that binding of Sp1 and Sp3 to the Per1 promoter decreased following NaB treatment, whereas Sp1 binding increased at the Per2 promoter of NaB‑ and TSA‑treated cells. In addition, Per1 promoter is not methylated in KATO III cells, while Per2 promoter was methylated, although NaB, TSA, and 5‑Azacytidine do not change the methylated CpGs analyzed. In conclusion, HDACi induce Per1 and Per2 expression, in part, through mechanisms involving chromatin remodeling at the proximal promoter of these genes; however, other indirect mechanisms triggered by these HDACi cannot be ruled out. These findings reveal a previously unappreciated regulatory pathway between silencing of Per1 gene by H3K9me3 and upregulation of Per2 by HDACi in cancer cells.

Introduction

Circadian rhythms are biological rhythms with a periodicity close to 24 h. In mammals, these rhythms are generated by a master biological clock, located in the hypothalamus and by clocks localized in peripheral cells (1). At the molecular level, circadian clocks are operated by transcriptional/translational feedback loops involving a set of genes called ‘clock genes’ (2,3). Clock genes operate like oscillators, modulating rhythmic transcription of a large number of genes in all cells by a mechanism that relies on coordinated chromatin remodeling events (4,5). Situations that alter the normal expression pattern of the clock genes have important repercussions at the systemic, cellular and molecular levels (6).

The maintenance of the molecular mechanism of the circadian clockwork has a profound influence on human health, and its alteration has frequently been associated with multiple diseases, including cancer (7–12). Several in vivo and in vitro studies suggest that, in addition to their main role within the molecular mechanism of the circadian clock, Period circadian regulator (Per)1 and Per2 genes can also function as tumor suppressors due to their involvement in cell proliferation, apoptosis, cell cycle control, and DNA damage response (13–22). Targeted ablation of Per2 leads to the development of malignant lymphomas (13), whereas its ectopic expression in cancer cell lines results in growth inhibition, cell cycle arrest, apoptosis, and loss of clonogenic ability (15,18).

Accumulating evidence suggests that deregulation or significantly decreased expression of Per1 and Per2 genes in humans is associated with increased risk of breast, prostate, ovarian, endometrial, pancreatic, colorectal, gastric, liver, skin, lung, and head and neck cancers, leukemia, lymphomas, and glioma (23–41). Decreased expression of Per1 or Per2 genes has been associated with promoter hypermethylation in breast, endometrial, and non-small lung cancer cells (23,27,35). On the other hand, treatment of non-small cell lung cancer cells and other cancer cell lines with SAHA, an HDACi, induce the expression of Per1 gene (35), whereas TSA induced the expression of Per3 in myeloid leukemia cells (41); however, the role of HDACi on Per2 expression has not been tested, neither their role on Per1 and Per2 expression in gastric cancer cells. Studies in rodents have shown that histone H3 acetylation is of great relevance to maintain the activation and rhythmic expression of clock genes in liver cells (42).

Despite this evidence, the transcriptional regulation of Per1 and Per2 genes by epigenetic modifications is not fully understood, and the role of HDACi on Per1 and Per2 expression in gastric cancer cells has not been explored. Therefore, the aim of this study was to investigate whether HDACi regulate the expression of Per1 and Per2 genes in two human gastric cancer cell lines, and to determine histone-specific modifications in response to the HDACi treatment.

Materials and methods

Cell culture and treatments with HDACi

KATO III and NCI-N87 human gastric carcinoma cells were acquired from ATCC (Manassas, VA, USA). KATO III cells were grown in Iscove's modified Dulbecco's medium (IMDM) supplemented with 20% fetal bovine serum, 0.5% penicillin-streptomycin, and 70 mg/l kanamycin. NCI-N87 cells were grown in RPMI-1640 supplemented with 10% fetal bovine serum, 0.5% penicillin-streptomycin and 70 mg/l kanamycin. Both cell lines were grown at 37°C in a humidified 5% CO2/95% air atmosphere. Exponentially growing cells were trypsinized and seeded in 6-well plates; when cells reached 70–80% confluence by microscopic examination (day 2 or 3 post-plating), the medium was changed, and sodium butyrate (NaB) (1, 2 or 3 mM) or trichostatin A (TSA) (50, 100 or 150 nM) were added. Cells were treated during 48 or 96 h with these reagents, replacing the medium with inhibitors every 24 h.

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

KATO III and NCI-N87 cells treated during 48 or 96 h as described above, were washed twice with 1× PBS, then 1 ml of Trizol reagent was added to isolate total cellular RNA, according to the manufacturer's recommendations (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). RNA concentration was determined with a NanoDrop 1000 (Thermo Fisher Scientific, Inc.), and the RNA integrity by agarose gel electrophoresis.

Total RNA (1 µg) was reverse-transcribed using 200 U of M-MLV reverse transcriptase and 50 pmoles of random hexamers in a final volume of 20 µl, according to the instructions provided by the manufacturer (Invitrogen; Thermo Fisher Scientific, Inc.).

RT-qPCR reactions were performed in triplicate, containing 6 µl of 2× SYBR Green qPCR reaction mix (Invitrogen; Thermo Fisher Scientific, Inc.), 1 µl of cDNA from each sample, and 5 pmol of each primer (forward and reverse) for Per1 or Per2 (Table I), in a final volume of 12 µl. RT-qPCR reactions were run as follow: 2 min at 50°C, 8.5 min at 95°C, 40 cycles of 95°C for 15 sec, 60°C for 1 min, followed by a dissociation analysis, in a 7500 thermal cycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). Reactions with primers for GAPDH and ACTB were used as internal control (Table I). The efficiencies of RT-qPCR reactions were determined with the LinReg program (43), and the relative mRNA expression levels were calculated according to the method described by Pfaffl (44). The expression of Per1 and Per2 genes in control cells, without treatment, was considered as one.

Table I.

Primers for reverse transcription-quantitative polymerase chain reaction and promoter analysis of Per1 and Per2 genes.

Table I.

Primers for reverse transcription-quantitative polymerase chain reaction and promoter analysis of Per1 and Per2 genes.

GeneGenbank accession no.Forward (5′-3′)Reverse (5′-3′)Position
PER1NM_002616.2 GGACATGACCTCTGTGCTGA CATCAGGGTGACCAGGATCT3,688–3,887
PER2NM_022817.2 ACAGCTTTGGCTTCTGGTGT TATTGGCCATCATGGTCTGA4,574–4,774
GAPDHNM_002046.5 GTCAGTGGTGGACCTGACCT TGAGGAGGGGAGATTCAGTG908-1,307
ACTBNM_001101.3 TCCCTGGAGAAGAGCTACGA AGCACTGTGTTGGCGTACAG787–980
PER1p– TGTCTCTCCCCTCCTCTCAAa AGATACGCTGCGCCTCTTTAa−437 to −241
PER2p– AGGAACCGACGAGGTGAAC CCGCTGTCACATAGTGGAAA−410 to −217

{ label (or @symbol) needed for fn[@id='tfn1-ol-0-0-8851'] } Primers were designed with Primer3 software

a correspond to those reported by Gery et al (35). Per, Period circadian regulator; ACTB, β-actin; PER1/2p, Per1 and 2 gene promoter.

Chromatin immunoprecipitation (ChIP) assays

Chromatin immunoprecipitation (ChIP) assays were performed as previously described (45). After cross-linking, cell lysates were sonicated on ice, soluble chromatin (equivalent to 50 µg of DNA) was pre-cleared with protein A/G plus-agarose beads (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and then incubated overnight at 4°C on a Nutator platform with 2 µg of antibodies to H3 modifications (Abcam, Cambridge, MA, USA), or with antibodies to Sp1 and Sp1 (Santa Cruz Biotechnology, Inc.). The immunoprecipitates were recovered by incubation with protein A/G agarose beads and washed sequentially for 5 min with low-salt buffer, high-salt buffer, LiCl wash buffer; and twice with TE buffer. Immunoprecipitated DNA was eluted, then incubated for 30 min at 37°C with RNase A, followed by overnight incubation at 55°C with proteinase K. DNA was reverse cross-linked and extracted with phenol, phenol-chloroform, and chloroform-isoamyl alcohol, then precipitated with ethanol and resuspended in 20 µl of H2O. Input samples (equivalent to 5 µg of DNA) were resuspended in 20 µl of H2O after reversal cross-linking and ethanol precipitation. PCR was conducted with 1 µl of immunoprecipitates or input samples, 10 µl of 2× PCR reaction mix (Promega Corporation, Madison, WI, USA), 5 pmoles of each primer for the Per1 or Per2 promoter (Table I), 1 µl of DMSO, and water up to 20 µl; with the following program: 3 min at 95°C, 30 cycles of 30 sec at 95°C, 30 sec at 60°C, 1 min at 72°C, and a final extension of 7 min at 72°C. PCR products were separated on 2% agarose gels and visualized by ethidium bromide staining with a XR 170–8170 photo documentation station (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Methylation specific PCR (MS-PCR)

KATO III cells were treated with 3 mM NaB or 100 nM TSA for 48 or 96 h with 5 µM of 5-Aza-2′-deoxycitydine (Aza). Cells were then lysed and treated with sodium bisulfite, followed by the DNA purification with the kit EZ-DNA Methylation-Direct (Zymo Research Corp., Irvine, CA, USA), following the directions from the manufacturer. Bisulfite-modified DNA was used to perform methylation-specific PCR (MS-PCR) using specific primers to distinguish methylated and unmethylated forms of Per1 and Per2 promoters, as reported (41). PCR reactions were conducted with 1 µl of modified DNA, 10 µl of 2× PCR mix (Promega Corporation), 5 pmoles of sense and antisense primers in a final volume of 20 µl. Cycling parameters were as described above, except that the annealing temperature was 56–62°C, according to the Tm of each primer set (41). PCR products were separated on 2% agarose gels, visualized and documented as described above.

In silico analysis

In silico analysis to search for potential Sp1 and Sp3 binding sites at the Per1 and Per2 promoters was done using the JASPAR database (46).

Statistical analysis

RT-qPCR data were analyzed by the Kruskal-Wallis test, except those obtained with Aza treatment that were analyzed with a U-Mann Whitney test, as they did not fit a normal distribution, whereas data from ChIP assays were analyzed with one-way analysis of variance followed by a Tukey post-hoc test, using the Statistica 7 software (StatSoft, Inc., Tulsa, OK, USA). A P-value <0.05 was considered significant. Plots were done with Sigmaplot 10.0 software (Systat Software, San Jose, CA USA).

Results

Treatment of KATO III cells with NaB or TSA induce Per1 and Per2 mRNA expression

KATO III cells treated with 2 or 3 mM NaB during 48 h showed a significant increase in Per1 mRNA expression, compared to control cells (1.77±0.11, and 2.11±0.16 fold higher, respectively; P<0.01; Fig. 1A), and with 1, 2 and 3 mM NaB during 96 h (2.89±0.60; 3.79±0.73, and 4.84±0.40 fold higher, respectively; P<0.01; Fig. 1B). Similarly, a significant induction in Per2 mRNA expression was found in KATO III cells treated with 2 or 3 mM NaB for 48 h compared to control cells (2.90±0.32 and 3.64±0.49 fold higher, respectively; P<0.01; Fig. 1C), as well as with 1, 2 or 3 mM NaB for 96 h (2.84±0.74; 4.36±1.25 and 8.85±1.03 fold higher, respectively; P<0.01; Fig. 1D). Significant differences were also found between cells treated with 1 and 3 mM NaB for 48- and 96-h (P<0.01).

Figure 1.

NaB induces the mRNA expression of Per1 and Per2 in human KATO III gastric cancer cells. KATO III cells were treated with the indicated concentrations of NaB for (A and C) 48 or 96 h (B and D), then Per1 and Per2 mRNA expression was determined by reverse transcription-quantitative polymerase chain reaction. Data are reported as mean ± standard deviation of three independent experiments, each performed in triplicate. **P<0.01, as indicated. NaB, sodium butyrate; Per, period circadian regulator.

Experiments performed with 50, 100 or 150 nM TSA, a potent and specific class I and IIa HDACi, show increased Per1 mRNA expression at 48 h (1.90±0.35; 3.03±0.65 and 4.12±0.54 fold higher than control untreated cells, respectively; P<0.01; Fig. 2A), as well as with 50 or 100 nM TSA for 96 h (2.5±0.38 and 4.87±0.58 fold higher than control untreated cells, respectively; P<0.01; Fig. 2B). Similarly, significant increases in Per2 mRNA expression were found in KATO III cells treated with 50, 100 or 150 nM TSA for 48 h compared to control untreated cells (2.1±0.32±0.49 and 3±2.3±0.25, respectively; P<0.01; Fig. 2C), as well as with 50 or 100 nM TSA for 96 h compared to control untreated cells (2.7±0.28; 3.4±0.33, respectively; Fig. 2D).

Figure 2.

TSA induces the mRNA expression of Per1 and Per2 in human KATO III gastric cancer cells. KATO III cells were treated with the indicated concentrations of TSA for (A and C) 48 or (B and D) 96 h, then Per1 and Per2 mRNA expression was determined by reverse transcription-quantitative polymerase chain reaction. Data are reported as mean ± standard deviation of three independent experiments, each performed in triplicate. **P<0.01, as indicated. Per, period circadian regulator; TSA, Trichostatin A.

Treatment of NCI-N87 cells with NaB or TSA induce the expression of Per1 and Per2 mRNA

With the intention to show that the effect observed in KATO III cells was not cell line-specific, Per1 and Per2 mRNA expression was also analyzed in NCI-N87 cells treated with NaB or TSA during 48 or 96 h. The results show a significant increase in Per1 mRNA expression in cells treated with 3 mM NaB for 48 h (4.46±0.35 fold higher than control untreated cells; P<0.01; Fig. 3A). Extending the exposure time to 96 h with 2 and 3 mM NaB induced Per1 expression (4.83±0.22 and 5.54±0.18 fold higher than control untreated cells, respectively; P<0.01; Fig. 3B). Significant differences were also found in Per2 mRNA expression with 3 mM NaB at 48 h (2.26±0.17 fold higher than control untreated cells; P<0.01; Fig. 3C), and with 2 and 3 mM at 96 h (4.00±0.38 and 4.89±0.36 fold higher than control untreated cells, respectively; P<0.01; Fig. 3D).

Figure 3.

NaB induces the mRNA expression of Per1 and Per2 in human NCI-N87 gastric cancer cells. NCI-N87 cells were treated with the indicated concentrations of NaB for (A and C) 48 or (B and D) 96 h, then Per1 and Per2 mRNA expression was determined by reverse transcription-quantitative polymerase chain reaction. Data are reported as mean ± standard deviation of three independent experiments, each performed in triplicate. **P<0.01, as indicated. NaB, sodium butyrate; Per, period circadian regulator.

On the other hand, treatment of NCI-N87 cells with 50, 100 or 150 nM TSA for 48 h increases Per1 mRNA expression (1.71±0.27; 2.26±0.62, and 3.45±0.41 fold higher than control untreated cells, respectively; P<0.01; Fig. 4A); whereas treatment for 96 h show significant increases at 50 and 100 nM TSA (5.98±0.27 and 6.19±0.47 fold higher than control untreated cells, respectively; P<0.01; Fig. 4B). Similar to the results found for Per1, treatment of NCI-N87 cells with 150 nM TSA during 48 h induced Per2 mRNA expression (1.89±0.41 fold higher than control untreated cells, respectively; P<0.01; Fig. 4C). This effect was more evident after 96 h of treatment with 50 or 100 nM of TSA (2.61±0.19 and 3.4±0.38 fold higher than control untreated cells, respectively; P<0.01; Fig. 4D).

Figure 4.

TSA induces the mRNA expression of Per1 and Per2 in human NCI-N87 gastric cancer cells. NCI-N87 cells were treated with the indicated concentrations of TSA for (A and C) 48 or (B and D) 96 h, then Per1 and Per2 mRNA expression was determined by reverse transcription-quantitative polymerase chain reaction. Data are reported as mean ± standard deviation of three independent experiments, each performed in triplicate. **P<0.01, as indicated. Per, period circadian regulator; TSA, Trichostatin A.

Effect of NaB and TSA on histone modifications and Sp1 and Sp3 binding to the Per1 and Per2 promoters

We conducted ChIP assays with KATO III cells to explore changes in histone modifications, in order to understand the mechanism for the upregulation of Per1 and Per2 mRNA by NaB and TSA. We found that treatment with NaB and TSA decreases H3K9me3 (P<0.05) at the Per1 promoter, whereas H3K9Ac and H3K4me1 show no significant changes (Fig. 5A and B). In contrast, Per2 promoter shows an increase of H3K9Ac in response to TSA (P<0.05), while H3K9m3 and H3K4me1 did not change compared to untreated cells (Fig. 5C and D). Treatment with NaB does not modify the analyzed chromatin marks at the Per2 promoter (Fig. 5C and D).

Figure 5.

Chromatin immunoprecipitation assays of Per1 and Per2 promoters of KATO III cells treated with NaB or TSA. Chromatin from KATO III gastric cancer cells treated with 3 mM NaB or 100 nM TSA for 48 h was immunoprecipitated with the indicated antibodies for H3 modifications. Representative agarose gels (2%) showing polymerase chain reaction products amplified with primers to the (A) proximal promoters of Per1 with (B) quantification, or with primers to the (C) proximal promoter of Per2 with (D) quantification. Gels from three independent ChIP experiments were analyzed with the program ImageJ software version 1.36, and densitometric data for chromatin marks at the Per1 and Per2 promoters are reported in (B) and (D) as mean ± standard deviation, respectively. *P<0.05 vs. C. Per, period circadian regulator; C, untreated control; TSA, Trichostatin A; NaB, sodium butyrate; IgG, immunoglobulin G.

It is known that NaB not only inhibits HDACs, it also acts on non-histone targets, such as transcription factors, in particular, those of the Sp family. Sp1 and Sp3 have been implicated in the mechanism of action of NaB on several promoters (47–51). We then conducted an in silico analysis to search for potential Sp1 and Sp3 binding sites at the Per1 and Per2 promoters. We found four Sp1 and two Sp3 putative binding sites at the −437 to −241 region of the Per1 promoter (Fig. 6A), as well as two Sp1 and one Sp3 putative binding sites at the −410 to −217 region of the Per2 promoter (Fig. 6B). Then we tested for changes of Sp1 and Sp3 binding to these promoters in response to NaB and TSA treatment. ChIP analysis shows that binding of Sp1 and Sp3 decrease at the Per1 promoter in NaB treated cells, whereas TSA has no effect. NaB and TSA treatment increases Sp1 binding to the Per2 promoter, without affecting Sp3 binding (Fig. 6C).

Figure 6.

Binding of Sp1 and Sp3 transcription factors to the Per1 and Per2 promoters of NaB and TSA treated KATO III cells. (A and B) In silico analysis, using the JASPAR database (70), of (A) Per1 and (B) Per2 promoters showing putative Sp1 and Sp3 binding sites. (C) Chromatin from KATO III cells treated with NaB and TSA, as described in Fig. 5, was immunoprecipitated with Sp1 or Sp3 antibodies then was subjected to polymerase chain reaction with primers for Per1 or Per2 promoters, and fragments were separated on 2% agarose gels. Per, period circadian regulator; TSA, Trichostatin A; NaB, sodium butyrate.

Effect of NaB, TSA, and Aza on the CpG methylation of Per1 and Per2 promoters

To further understand the transcriptional activation of Per1 and Per2 by NaB and TSA we conducted MS-PCR to explore changes on CpG methylation at the promoters of these genes, as HDACi treatment may decrease DNA methylation (52,53). We found that Per1 promoter was not methylated at the CpGs detected by the primers, whereas Per2 promoter was methylated (Fig. 7A). Treatment of KATO III cells with NaB, TSA and even Aza does not change the methylation status of the CpGs analyzed by the primers at the Per2 promoter (Fig. 7B). Interestingly, KATO III cells treated with Aza show a modest but significant increase in Per2 mRNA (1.65±0.22 fold above untreated cells; P<0.001; Fig. 7C).

Figure 7.

Methylation specific PCR to analyze the methylation status of Per1 and Per2 promoters. KATO III cells were treated with 3 mM NaB, 100 nM TSA for 48 h or 5 mM Aza for 96 h. Then DNA was subjected to bisulfite modification and PCR was conducted with specific primers to distinguish methylated (Lane M) and unmethylated (Lane U) forms of CpGs at the Per1 and Per2 promoters. PCR products were separated on 2% agarose gels. (A) MS-PCR of untreated control KATO III cells. (B) MS-PCR of NaB, TSA or Aza treated KATO III cells. (C) Reverse transcription-quantitative PCR showing upregulation of Per2 mRNA in Aza treated KATO III cells. ***P<0.001, as indicated. PCR, polymerase chain reaction; Per, period circadian regulator; NaB, sodium butyrate; TSA, Trichostatin A; MS-PCR, Methylation specific-PCR; Aza, 5-Aza-2′-deoxycitydine.

Discussion

The circadian system may have an important role in the global epigenetic events occurring during carcinogenesis. Accumulating evidence indicates that a variety of chromatin remodelers contribute to various aspects of the circadian epigenome (4,54). This evidence is further supported by gene expression and DNA methylation studies at the promoter region of clock genes silenced in cancer cells (23,27,35,41).

In this study, we found that treatment of KATO III and NCI-N87 human gastric cancer cells with two HDACi (NaB or TSA) induce Per1 and Per2 mRNA expression, in a dose-dependent manner. Our results are consistent with those described by other authors, who used similar treatments to induce the expression of Per1 and Per3 genes in cancer cells. It has been shown that TSA and 5-Aza-2′-deoxycytidine increased Per3 mRNA expression in myeloid leukemia K562 cells (41). Also, HDAC inhibition by SAHA increased Per1 gene expression in lung cancer NSCLC cells and other cancer cell lines (35). However, the levels of induction obtained in our study were higher than those obtained for Per3 in TSA treated K562 cells (41), but were lower than those obtained with SAHA in H520, H522, Ishikawa, MDA-231, and HCT116 cells, which were more than 10-fold higher than untreated cells (35). This approach has also been used to induce the expression of epigenetically silenced tumor suppressor genes in cancer cell lines (55–57).

We also found higher effects of NaB and TSA in cells treated for 96 h than those treated for 48 h, and larger changes of Per1 and Per2 expression were found in KATO III than in NCI-N87 cells. It is well established that gene expression levels in response to HDACi is highly dependent on the cell type (35,45,58). This could explain the differences observed between KATO III and NCI-N87 cells.

Inhibition of HDAC activity may play a key role in the expression of Per1 and Per2 genes in gastric cancer cells by promoting and open chromatin conformation. We found that treatment with NaB and TSA decreases H3K9me3, a heterochromatin mark, at the Per1 promoter, whereas TSA increases H3K9Ac, a mark of euchromatin, at the Per2 promoter, suggesting that these changes may contribute to their transcriptional activation. It is well established that H3K9 methylation correlates with transcriptional repression of multiple genes (59,60).

Enhanced acetylation of H3 and H4 at the Per1 promoter correlate with its transcriptional activation phase in mouse tissues (4,42,61), whereas di- and tri-methylation of H3K27 at the promoters of Per1 and Per2 correlate with transcriptional repression (62). A previous study has also shown that SAHA induced Per1 expression by increasing H3 acetylation at the Per1 promoter of NSLC cells (35). We did not find an increase of H3K9Ac at the Per1 promoter in NaB or TSA treated KATO III cells, but we found a decrease of H3K9 trimethylation. We cannot rule out the possibility that other residues in H3, such as K27, or in H4 could increase their acetylation in response to NaB or TSA.

Our data also demonstrate that NaB induced higher mRNA levels than TSA in both cell lines. NaB not only inhibits HDACs, it also acts on non-histone targets, such as Sp1 and Sp3 transcriptional factors, who have been implicated in the mechanism of action of NaB on several promoters (47–51). Our in silico analysis predicted Sp1 and Sp3 binding sites at the Per1 and Per2 promoters, thus we tested for changes in binding of these factors by ChIP assays. We found decreased Sp1 and Sp3 binding to the Per1 promoter in response to NaB, but not to TSA, whereas Sp1 binding increased at the Per2 promoter in response to NaB and TSA. This suggests that, Sp1 and Sp3 could negatively regulate Per1 expression, while Sp1 recruitment could contribute to the upregulation of Per2 in KATO III cells. Most studies have shown that NaB induce transcriptional activation by enhancing Sp1 and Sp3 binding to gene promoters (47–50); however, others have shown the opposite effect (51). NaB down-regulates neuropilin 1 (NRP1) expression and was associated with decreased binding of Sp1 to the NRP1 promoter (51). On the other hand, Sp1 down-regulates STC1 gene expression in HT-29 cells treated with TSA, by forming a complex with the retinoblastoma protein (63). Sp1 and Sp3 also interact with c-Myc to repress p21 promoter (64). Additionally, Sp1 was able to activate and to repress the thymidine kinase promoter in mouse 3T3 fibroblasts. This ambivalence of Sp1 as a transcriptional modulator lies on the interaction with other proteins, when it interacts with HDAC1 acts as a transcriptional suppressor, whereas when interacts with E2F1-3 promotes transcriptional activation (65). However, further experiments are needed to fully understand the possible role of Sp1 and Sp3 on Per1 transcriptional regulation, mediated by NaB or TSA.

Some studies have shown that HDACi treatment may reverse CpG methylation at gene promoters, leading to transcriptional activation (52,53), thus we tested this possibility. Our results show that Per2 promoter was methylated, whereas Per1 promoter was not methylated. The methylation of the CpGs recognized by the primers at the Per2 promoter did not change in response to NaB or TSA, neither in cells treated with 5-Aza. However, treatment with Aza induced a modest Per2 mRNA expression. It will be necessary to conduct DNA sequencing with bisulfite modified DNA, in order to determine if other CpGs are methylated at the promoter of these genes, and whether NaB, TSA or Aza may modify the pattern.

We cannot rule out the possibility that other mechanisms could indirectly mediate Per1 and Per2 upregulation in response to HDACi. Possibly by inducing transcription factors that bind to regulatory elements, which in turn could activate Per1 or Per2 promoters. Promoter analysis and promoter reporter constructs have shown important transcription factor binding sites that activate Per1 or Per2 expression, like E-boxes, CRE-elements, CAAT-boxes, C/EBP, and others (15,66–68). Acetylation of BMAL1, mediated by the intrinsic HAT activity of CLOCK could be involved in the induction of expression of Per1 and Per2 genes (69,70), by recruiting co-activating proteins such as P300 to the promoters of Per1 and Per2 genes, as previously described (42). However, further experiments are needed to fully understand the transcriptional regulation of these genes in gastric cancer cells.

In conclusion, the results presented in this work demonstrate that inhibition of HDACs with NaB or TSA induce the expression of Per1 and Per2 genes in KATO III and NCI-N87 gastric cancer cells, through changes in chromatin modifications at Per1 and Per2 proximal promoters, as well as changes of Sp3 and/or Sp1 binding to the Per1 and Per2 promoters. Changes in epigenetic modifications of Per1 and Per2 could disrupt other clock genes, as well as a web of genes and cellular pathways under circadian control. Further experiments will be necessary to address these issues. The understanding of changes in the epigenome of cancer cells could contribute to the development of new cancer therapies, and HDACi offer an excellent alternative.

Acknowledgements

Not applicable.

Funding

The present study was supported by grants from Programa de Mejoramiento del Profesorado, Secretaría de Educación Pública de México (grant no. PTC-270), Consejo Nacional de Ciencia y Tecnología, México (grant no. 2015-01-1518), Dirección General de Asuntos del Personal Académico de la Universidad Nacional Autónoma de México (grant no. IN217216), and FH-R was supported by a scholarship (no. 223273) from Consejo Nacional de Ciencia y Tecnología, México.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contribution

FHR performed, analyzed and discussed the majority of the experiments, prepared the figures, and wrote the first draft of the manuscript. AHO performed the ChIP assays, MS-PCR and in silico analysis, discussed and interpreted the data, and prepared the figures. LFP performed ChIP assays and critically revised the manuscript. GR conducted part of the cell culture work and critically revised the manuscript. MC discussed and interpreted the data, and critically revised the manuscript. AZH contributed to the study design, acquired funding, discussed and interpreted the data, and critically revised and edited the manuscript. JSG conceived and designed the study, discussed and interpreted the data, acquired funding, and wrote and edited the manuscript. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Lowrey PL and Takahashi JS: Genetics of circadian rhythms in mammalian model organisms. Adv Genet. 74:175–230. 2011.PubMed/NCBI

2 

Partch CL, Green CB and Takahashi JS: Molecular architecture of the mammalian circadian clock. Trends Cell Biol. 24:90–99. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Buhr ED and Takahashi JS: Molecular components of the mammalian circadian clock. Kramer A and Merrow M: circadian clocks, handbook of experimental pharmacology. 217:3–27. 2013. View Article : Google Scholar

4 

Koike N, Yoo SH, Huang HC, Kumar V, Lee C, Kim TK and Takahashi JS: Transcriptional architecture and chromatin landscape of the core circadian clock in mammals. Science. 338:349–354. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Katada S and Sassone-Corsi P: The histone methyltransferase MLL1 permits the oscillation of circadian gene expression. Nat Struct Mol Biol. 17:1414–1421. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Kettner NM, Katchy CA and Fu L: Circadian gene variants in cancer. Ann Med. 46:208–220. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Bechtold DA, Gibbs JE and Loudon AS: Circadian dysfunction in disease. Trends Pharmacol Sci. 31:191–198. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Kiessling S, Beaulieu-Laroche L, Blum ID, Landgraf D, Welsh DK, Storch KF, Labrecque N and Cermakian N: Enhancing circadian clock function in cancer cells inhibits tumor growth. BMC Biol. 15:132017. View Article : Google Scholar : PubMed/NCBI

9 

Cash E, Sephton SE, Chagpar AB, Spiegel D, Rebholz WN, Zimmaro LA, Tillie JM and Dhabhar FS: Circadian disruption and biomarkers of tumor progression in breast cancer patients awaiting surgery. Brain Behav Immun. 48:102–114. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Greene MW: Circadian rhythms and tumor growth. Cancer Lett. 318:115–123. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Yasuniwa Y, Izumi H, Wang KY, Shimajiri S, Sasaguri Y, Kawai K, Kasai H, Shimada T, Miyake K, Kashiwagi E, et al: Circadian disruption accelerates tumor growth and angio/stromagenesis through a Wnt signaling pathway. PLoS One. 5:e153302010. View Article : Google Scholar : PubMed/NCBI

12 

van Dycke KC, Rodenburg W, van Oostrom CT, VanKerkhof LW, Pennings JL, Roenneberg T, van Steeg H and Vanderhorst GT: Chronically alternating light cycles increase breast cancer risk in mice. Curr Biol. 25:1932–1937. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Fu L, Pelicano H, Liu J, Huang P and Lee C: The circadian gene Period2 plays an important role in tumor suppression and DNA damage response in vivo. Cell. 111:41–50. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Papagiannakopoulos T, Bauer MR, Davidson SM, Heimann M, Subbaraj L, Bhutkar A, Bartlebaugh J, Vander Heiden MG and Jacks T: Circadian rhythm disruption promotes lung tumorigenesis. Cell Metab. 24:324–331. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Gery S, Gombart AF, Yi WS, Koeffler C, Hofmann WK and Koeffler HP: Transcription profiling of C/EBP targets identifies Per2 as a gene implicated in myeloid leukemia. Blood. 106:2827–2836. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Gery S, Komatsu N, Baldjyan L, Yu A, Koo D and Koeffler HP: The circadian gene per1 plays an important role in cell growth and DNA damage control in human cancer cells. Mol Cell. 22:375–382. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Hua H, Wang Y, Wan C, Liu Y, Zhu B, Yang C, Wang X, Wang Z, Cornelissen-Guillaume G and Halberg F: Circadian gene mPer2 overexpression induces cancer cell apoptosis. Cancer Sci. 97:589–596. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Xiang S, Coffelt SB, Mao L, Yuan L, Cheng Q and Hill SM: Period-2: A tumor suppressor gene in breast cancer. J Circadian Rhythms. 6:42008. View Article : Google Scholar : PubMed/NCBI

19 

Yang X, Wood PA, Oh EY, Du-Quiton J, Ansell CM and Hrushesky WJ: Down regulation of circadian clock gene Period 2 accelerates breast cancer growth by altering its daily growth rhythm. Breast Cancer Res Treat. 117:423–431. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Miyazaki K, Wakabayashi M, Hara Y and Ishida N: Tumor growth suppression in vivo by overexpression of the circadian component, PER2. Genes Cells. 15:351–358. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Oda A, Katayose Y, Yabuuchi S, Yamamoto K, Mizuma M, Shirasou S, Onogawa T, Ohtsuka H, Yoshida H, Yoshida H, et al: Clock gene mouse period2 overexpression inhibits growth of human pancreatic cancer cells and has synergistic effect with cisplatin. Anticancer Res. 29:1201–1210. 2009.PubMed/NCBI

22 

Winter SL, Bosnoyan-Collins L, Pinnaduwage D and Andrulis IL: Expression of the circadian clock genes Pert and Per2 in sporadic and familial breast tumors. Neoplasia. 9:797–800. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Chen ST, Choo KB, Hou MF, Yeh KT, Kuo SJ and Chang JG: Deregulated expression of the PER1, PER2 and PER3 genes in breast cancers. Carcinogenesis. 26:1241–1246. 2005. View Article : Google Scholar : PubMed/NCBI

24 

Dai H, Zhang L, Cao M, Song F, Zheng H, Zhu X, Wei Q, Zhang W and Chen K: The role of polymorphisms in circadian pathway genes in breast tumorigenesis. Breast Cancer Res Treat. 127:531–540. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Cao Q, Gery S, Dashti A, Yin D, Zhou Y, Gu J and Koeffler HP: A role for the clock gene per1 in prostate cancer. Cancer Res. 69:7619–7625. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Tokunaga H, Takebayashi Y, Utsunomiya H, Akahira J, Higashimoto M, Mashiko M, Ito K, Niikura H, Takenoshita S and Yaegashi N: Clinicopathological significance of circadian rhythm-related gene expression levels in patients with epithelial ovarian cancer. Acta Obstet Gynecol Scand. 87:1060–1070. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Yeh KT, Yang MY, Liu TC, Chen JC, Chan WL, Lin SF and Chang JG: Abnormal expression of period 1 (PER1) in endometrial carcinoma. J Pathol. 206:111–120. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Relles D, Sendecki J, Chipitsyna G, Hyslop T, Yeo CJ and Arafat HA: Circadian gene expression and clinicopathologic correlates in pancreatic cancer. J Gastrointest Surg. 17:443–450. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Mazzoccoli G, Panza A, Valvano MR, Palumbo O, Carella M, Pazienza V, Biscaglia G, Tavano F, Di Sebastiano P, Andriulli A and Piepoli A: Clock gene expression levels and relationship with clinical and pathological features in colorectal cancer patients. Chronobiol Int. 28:841–851. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Mostafaie N, Kallay E, Sauerzapf E, Bonner E, Kriwanek S, Cross HS, Huber KR and Krugluger W: Correlated downregulation of estrogen receptor beta and the circadian clock gene Per1 in human colorectal cancer. Mol Carcinog. 48:642–647. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Hu ML, Yeh KT, Lin PM, Hsu CM, Hsia HH, Liu YC, Lin HY, Lin SF and Yang MY: Deregulated expression of circadian clock genes in gastric cancer. BMC Gastroenterol. 14:672014. View Article : Google Scholar : PubMed/NCBI

32 

Zhao H, Zen ZL, Yang Y, Jin Y, Qiu MZ, Hu XY, Han J, Liu KY, Liao JW, Xu RH and Zou QF: Prognostic relevance of Period1 (Per1) and Period2 (Per2) expression in human gastric cancer. Int J Clin Exp Pathol. 7:619–630. 2014.PubMed/NCBI

33 

Lin YM, Chang JH, Yeh KT, Yang MY, Liu TC, Lin SF, Su W and Chang JG: Disturbance of circadian gene expression in hepatocellular carcinoma. Mol Carcinog. 47:925–933. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Lengyel Z, Lovig C, Kommedal S, Keszthelyi R, Szekeres G, Battyáni Z, Csernus V and Nagy AD: Altered expression patterns of clock gene mRNAs and clock proteins in human skin tumors. Tumor Biol. 34:811–819. 2013. View Article : Google Scholar

35 

Gery S, Komatsu N, Kawamata N, Miller CW, Desmond J, Virk RK, Marchevsky A, Mckenna R, Taguchi H and Koeffler HP: Epigenetic silencing of the candidate tumor suppressor gene Per1 in non-small cell lung cancer. Clin Cancer Res. 13:1399–1404. 2007. View Article : Google Scholar : PubMed/NCBI

36 

Yang MY, Yang WC, Lin PM, Hsu JF, Hsiao HH, Liu YC, Tsai HJ, Chang CS and Lin SF: Altered expression of circadian clock genes in human chronic myeloid leukemia. J Biol Rhythms. 26:136–148. 2011. View Article : Google Scholar : PubMed/NCBI

37 

Hsu CM, Lin SF, Lu CT, Lin PM and Yang MY: Altered expression of circadian clock genes in head and neck squamous cell carcinoma. Tumor Biol. 33:149–155. 2012. View Article : Google Scholar

38 

Thoennissen NH, Thoennissen GB, Abbassi S, Nabavi-Nouis S, Sauer T, Doan NB, Gery S, Müller-Tidow C, Said JW and Koeffler HP: Transcription factor CCAAT/enhancer-binding protein alpha and critical circadian clock downstream target gene PER2 are highly deregulated in diffuse large B-cell lymphoma. Leuk Lymphoma. 53:1577–1585. 2012. View Article : Google Scholar : PubMed/NCBI

39 

Xia H, Niu Z, Ma H, Cao SZ, Hao SC, Liu ZT and Wang F: Deregulated expression of the Per1 and Per2 in human gliomas. Can J Neurol Sci. 37:365–370. 2010. View Article : Google Scholar : PubMed/NCBI

40 

Zhanfeng N, Yanhui L, Zhou F, Shaocai H, Guangxing L and Hechun X: Circadian genes Per1 and Per2 increase radiosensitivity of glioma in vivo. Oncotarget. 6:9951–9958. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Yang MY, Chang JG, Lin PM, Tang KP, Chen YH, Lin HY, Liu TC, Hsiao HH, Liu YC and Lin SF: Downregulation of circadian clock genes in chronic myeloid leukemia: alternative methylation pattern of hPER3. Cancer Sci. 97:1298–1307. 2006. View Article : Google Scholar : PubMed/NCBI

42 

Etchegaray JP, Lee C, Wade PA and Reppert SM: Rhythmic histone acetylation underlies transcription in the mammalian circadian clock. Nature. 421:177–182. 2003. View Article : Google Scholar : PubMed/NCBI

43 

Ramakers C, Ruijter JM, Deprez RH and Moorman AF: Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett. 339:62–66. 2003. View Article : Google Scholar : PubMed/NCBI

44 

Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e452001. View Article : Google Scholar : PubMed/NCBI

45 

Contreras-Leal E, Hernandez-Oliveras A, Flores-Peredo L, Zarain-Herzberg A and Santiago-Garcia J: Histone deacetylase inhibitors promote the expression of ATP2A3 gene in breast cancer cell lines. Mol Carcinog. 55:1477–1485. 2016. View Article : Google Scholar : PubMed/NCBI

46 

Khan A, Fornes O, Stigliani A, Gheorghe M, Castro-Mondragon JA, van der Lee R, Bessy A, Chèneby J, Kulkarni SR, Tan G, et al: JASPAR 2018: Update of the open-access database of transcription factor binding profiles and its web framework. Nucleic Acids Res. 46:D260–D266. 2018. View Article : Google Scholar : PubMed/NCBI

47 

Amin MR, Dudeja PK, Ramaswamy K and Malakooti J: Involvement of Sp1 and Sp3 in differential regulation of human NHE3 promoter activity by sodium butyrate and IFN-gamma/TNF-alpha. AJP Gastrointest Liver Physiol. 293:G374–G382. 2007. View Article : Google Scholar

48 

Kiela PR, Kuscuoglu N, Midura AJ, Midura-Kiela MT, Larmonier CB, Lipko M and Ghishan FK: Molecular mechanism of rat NHE3 gene promoter regulation by sodium butyrate. Am J Physiol Cell Physiol. 293:C64–C74. 2007. View Article : Google Scholar : PubMed/NCBI

49 

Flores-Peredo L, Rodriguez G and Zarain-Herzberg A: Induction of cell differentiation activates transcription of the sarco/endoplasmic reticulum calcium-ATPase 3 gene (ATP2A3) in gastric and colon cancer cells. Mol Carcinog. 56:735–750. 2017. View Article : Google Scholar : PubMed/NCBI

50 

Chirakkal H, Leech SH, Brookes KE, Prais AL, Waby JS and Corfe BM: Upregulation of BAK by butyrate in the colon is associated with increased Sp3 binding. Oncogene. 25:7192–7200. 2006. View Article : Google Scholar : PubMed/NCBI

51 

Yu DC, Waby JS, Chirakkal H, Staton CA and Corfe BM: Butyrate suppresses expression of neuropilin I in colorectal cell lines through inhibition of Sp1 transactivation. Mol Cancer. 9:2762010. View Article : Google Scholar : PubMed/NCBI

52 

Sarkar S, Abujamra AL, Loew JE, Forman LW, Perrine SP and Faller DV.: Histone deacetylase inhibitors reverse CpG methylation by regulating DNMT1 through ERK signaling. Anticancer Res. 3:2723–2732. 2011.

53 

Shin H, Kim JH, Lee YS and Lee YC: Change in gene expression profiles of secreted frizzled-related proteins (SFRPs) by sodium butyrate in gastric cancers: Induction of promoter demethylation and histone modification causing inhibition of Wnt signaling. Int J Oncol. 40:1533–1542. 2012.PubMed/NCBI

54 

Masri S and Sassone-Corsi P: Plasticity and specificity of the circadian epigenome. Nat Neurosci. 13:1324–1329. 2010. View Article : Google Scholar : PubMed/NCBI

55 

Meng CF, Zhu XJ, Peng G and Dai DQ: Promoter histone H3 lysine 9 di-methylation is associated with DNA methylation and aberrant expression of p16 in gastric cancer cells. Oncol Rep. 22:1221–1227. 2009.PubMed/NCBI

56 

Chen MY, Liao WS, Lu Z, Bornmann WG, Hennessey V, Washington MN, Rosner GL, Yu Y, Ahmed AA and Bast RC Jr: Decitabine and suberoylanilide hydroxamic acid (saha) inhibit growth of ovarian cancer cell lines and xenografts while inducing expression of imprinted tumor suppressor genes, apoptosis, G2/M arrest and autophagy. Cancer. 117:4424–4438. 2011. View Article : Google Scholar : PubMed/NCBI

57 

Vibhakar R, Foltz G, Yoon JG, Field L, Lee H, Ryu GY, Pierson J, Davidson B and Madan A: Dickkopf-1 is an epigenetically silenced candidate tumor suppressor gene in medulloblastoma. Neuro Oncol. 9:135–144. 2007. View Article : Google Scholar : PubMed/NCBI

58 

Chang J, Varghese DS, Gillam MC, Peyton M, Modi B, Schiltz RL, Girard L and Martinez ED: Differential response of cancer cells to HDAC inhibitors trichostatin A and depsipeptide. Br J Cancer. 106:116–125. 2012. View Article : Google Scholar : PubMed/NCBI

59 

Hublitz P, Albert M and Peters AH: Mechanisms of transcriptional repression by histone lysine methylation. Int J Dev Biol. 53:335–354. 2009. View Article : Google Scholar : PubMed/NCBI

60 

Varier RA and MarcTimmers HT: Histone lysine methylation and demethylation pathways in cancer. Biochim Biophys Acta. 1815:75–89. 2011.PubMed/NCBI

61 

Curtis AM, Seo SB, Westgate EJ, Rudic RD, Smyth EM, Chakravarti D, Fitzgerald GA and McNamara P: Histone acetyltransferase-dependent chromatin remodeling and the vascular clock. J Biol Chem. 279:7091–7097. 2004. View Article : Google Scholar : PubMed/NCBI

62 

Etchegaray JP, Yang X, DeBruyne JP, Peters AH, Weaver DR, Jenuwein T and Reppert SM: The polycomb group protein EZH2 is required for mammalian circadian clock function. J Biol Chem. 281:21209–21215. 2006. View Article : Google Scholar : PubMed/NCBI

63 

Law AY, Yeung BH, Ching LY and Wong CK: Sp1 is a transcriptional repressor to stanniocalcin-1 expression in TSA-treated human colon cancer cells, HT29. J Cell Biochem. 112:2089–2096. 2011. View Article : Google Scholar : PubMed/NCBI

64 

Gartel AL, Ye X, Goufman E, Shianov P, Hay N, Najmabandi F and Tyner AL: Myc repress the p21(WAF1/CIP1) promoter and interacts with Sp1/Sp3. Proc Natl Acad Sci USA. 98:4510–4515. 2001. View Article : Google Scholar : PubMed/NCBI

65 

Doetzlhofer A, Rotheneder H, Lagger G, Koranda M, Kurtev V, Brosch G, Wintersberger E and Seiser C: Histone deacetylase 1 can repress transcription by binding to Sp1. Mol Cell Biol. 19:5504–5511. 1999. View Article : Google Scholar : PubMed/NCBI

66 

Hida A, Koike N, Hirose M, Hattori M, Sakaki Y and Tei H: The human and mouse Period1 genes: five well-conserved E-boxes additively contribute to the enhancement of mPer1 transcription. Genomics. 65:224–233. 2000. View Article : Google Scholar : PubMed/NCBI

67 

Taruscio D, Zoraqi GK, Falchi M, Iosi F, Paradisi S, DiFiore B, Lavia P and Falbo V: The human Per1 gene: Genomic organization and promoter analysis of the first human orthologue of the Drosophila period gene. Gene. 253:161–170. 2000. View Article : Google Scholar : PubMed/NCBI

68 

Koyanagi S, Hamdan AM, Horiguchi M, Kusunose N, Okamoto A, Matsunaga N and Ohdo S: cAMP-response element (CRE)-mediated transcription by activating transcription factor-4 (ATF4) is essential for circadian expression of the Period2 gene. J Biol Chem. 286:32416–32423. 2011. View Article : Google Scholar : PubMed/NCBI

69 

Doi M, Hirayama J and Sassone-Corsi P: Circadian regulator CLOCK is a histone acetyltransferase. Cell. 125:497–508. 2006. View Article : Google Scholar : PubMed/NCBI

70 

Grimaldi B, Nakahata Y, Sahar S, Kaluzova M, Gauthier D, Pham K, Patel N, Hirayama J and Sassone-Corsi P: Chromatin remodeling and circadian control: Master regulator CLOCK is an enzyme. Cold Spring Harb Symp Quant Biol. 72:105–112. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hernández‑Rosas F, Hernández‑Oliveras A, Flores‑Peredo L, Rodríguez G, Zarain‑Herzberg Á, Caba M and Santiago‑García J: Histone deacetylase inhibitors induce the expression of tumor suppressor genes Per1 and Per2 in human gastric cancer cells. Oncol Lett 16: 1981-1990, 2018.
APA
Hernández‑Rosas, F., Hernández‑Oliveras, A., Flores‑Peredo, L., Rodríguez, G., Zarain‑Herzberg, Á., Caba, M., & Santiago‑García, J. (2018). Histone deacetylase inhibitors induce the expression of tumor suppressor genes Per1 and Per2 in human gastric cancer cells. Oncology Letters, 16, 1981-1990. https://doi.org/10.3892/ol.2018.8851
MLA
Hernández‑Rosas, F., Hernández‑Oliveras, A., Flores‑Peredo, L., Rodríguez, G., Zarain‑Herzberg, Á., Caba, M., Santiago‑García, J."Histone deacetylase inhibitors induce the expression of tumor suppressor genes Per1 and Per2 in human gastric cancer cells". Oncology Letters 16.2 (2018): 1981-1990.
Chicago
Hernández‑Rosas, F., Hernández‑Oliveras, A., Flores‑Peredo, L., Rodríguez, G., Zarain‑Herzberg, Á., Caba, M., Santiago‑García, J."Histone deacetylase inhibitors induce the expression of tumor suppressor genes Per1 and Per2 in human gastric cancer cells". Oncology Letters 16, no. 2 (2018): 1981-1990. https://doi.org/10.3892/ol.2018.8851
Copy and paste a formatted citation
x
Spandidos Publications style
Hernández‑Rosas F, Hernández‑Oliveras A, Flores‑Peredo L, Rodríguez G, Zarain‑Herzberg Á, Caba M and Santiago‑García J: Histone deacetylase inhibitors induce the expression of tumor suppressor genes Per1 and Per2 in human gastric cancer cells. Oncol Lett 16: 1981-1990, 2018.
APA
Hernández‑Rosas, F., Hernández‑Oliveras, A., Flores‑Peredo, L., Rodríguez, G., Zarain‑Herzberg, Á., Caba, M., & Santiago‑García, J. (2018). Histone deacetylase inhibitors induce the expression of tumor suppressor genes Per1 and Per2 in human gastric cancer cells. Oncology Letters, 16, 1981-1990. https://doi.org/10.3892/ol.2018.8851
MLA
Hernández‑Rosas, F., Hernández‑Oliveras, A., Flores‑Peredo, L., Rodríguez, G., Zarain‑Herzberg, Á., Caba, M., Santiago‑García, J."Histone deacetylase inhibitors induce the expression of tumor suppressor genes Per1 and Per2 in human gastric cancer cells". Oncology Letters 16.2 (2018): 1981-1990.
Chicago
Hernández‑Rosas, F., Hernández‑Oliveras, A., Flores‑Peredo, L., Rodríguez, G., Zarain‑Herzberg, Á., Caba, M., Santiago‑García, J."Histone deacetylase inhibitors induce the expression of tumor suppressor genes Per1 and Per2 in human gastric cancer cells". Oncology Letters 16, no. 2 (2018): 1981-1990. https://doi.org/10.3892/ol.2018.8851
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team