The impact of inflammation and cytokine expression of PM2.5 in AML

  • Authors:
    • Tingting Chen
    • Juan Zhang
    • Hui Zeng
    • Yue Zhang
    • Yong Zhang
    • Xiaohuan Zhou
    • Dong Zhao
    • Yingmei Feng
    • Hebing Zhou
  • View Affiliations

  • Published online on: June 13, 2018     https://doi.org/10.3892/ol.2018.8965
  • Pages: 2732-2740
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Environmental and health issues have become a major focus of research worldwide in recent years. Particulate matter with diameter ≤2.5 µm (PM2.5) is a common air pollutant that has been demonstrated to be associated with various diseases, including acute myeloid leukemia (AML). In the present study, the effects of PM2.5 on the proliferation and inflammation were assessed using three human acute myeloid cell lines (U937, HL‑60 and KG‑1a) in vitro. Additionally, the levels of several cytokines [interleukin (IL)‑2, IL‑10, IL‑17A and tumor necrosis factor (TNF)α] in AML cells and Sprague Dawley rats were evaluated to investigate the effects of PM2.5 on cytokine expression in AML. The results revealed that PM2.5 was capable of enhancing inflammatory responses in AML cells, and increasing IL‑2, IL‑10, IL‑17A and TNFα mRNA expression in AML cells to different degrees. Furthermore, PM2.5 increased IL‑2 and IL‑10 contents in rats following 12 weeks of exposure. These results suggested that PM2.5 may serve a role in promoting the occurrence and progression of leukemia by affecting cytokine expression, and that there may be various mechanisms active in different AML subtypes.

Introduction

Air pollution, also known as smog, has become much more severe in China in recent years. Smog is the result of interactions between specific climatic conditions and human activities. The economic and social activities of high-density populations result in the emission of large amounts of fine particulate matter; one such common pollutant is known as particulate matter with diameter ≤2.5 µm (PM2.5) due to the aerodynamic diameter is ≤2.5 µm. When the discharge of PM2.5 exceeds the circulation and carrying capacity of the atmosphere, these fine particles accumulate in the air, leading to smog. Numerous studies have demonstrated that air pollution damages the respiratory system, cardiovascular system, and organs, including the heart and lungs (18) Additionally, PM2.5 increases the incidence of infectious diseases and decreases male fertility (913).

Leukemia, a malignant clonal disease originating from hematopoietic stem cells, is a major public health threat, and the sixth and eighth leading cause of cancer-associated mortality in men and women in China, respectively. Notably, leukemia is the leading cause of cancer-associated mortality in children and patients <35 years old. In recent years, several studies have demonstrated the association between PM2.5 and the risk of leukemia. Studies by Brosselin and Steffen have revealed that living near gas stations or garages may increase the risk of developing acute lymphoblastic leukemia and acute myeloid leukemia (AML) (14,15). Another study performed in Denmark indicated that there is an association between traffic-associated air pollution and the risk of developing AML (16).

Despite extensive studies, the mechanisms mediating the effects of PM2.5 on the occurrence and development of leukemia remain unclear. However, changes in the bone marrow microenvironment are considered to be involved in the progress of leukemia (17,18). A study performed in Taiyuan, China demonstrated that PM2.5 affects cell proliferation, but does not cause cell injury in exposed leukemia cells and that low doses of PM2.5 accelerates leukemia development through a reactive oxygen species-mediated pathway (19).

In the present study, the effects of various concentrations of PM2.5 on cell proliferation were investigated in three AML cell lines (U937, HL-60 and KG-1a). The expression levels of several cytokines, including interleukin-2 (IL-2), IL-10, IL-17A and tumor necrosis factor (TNF) α, after PM2.5 exposure in AML cell lines and rats were also evaluated, with the aim of elucidating the mechanisms through which PM2.5 affects the occurrence and development of leukemia.

Materials and methods

Reagents and cell lines

PM2.5 particles purchased from the National Institute of Standards and Technology (Gaithersburg, MD, USA) were diluted in sterilized PBS solution to 5 mg/ml and preserved at −20°C in aliquots. The samples were then diluted to a working concentration in RPMI-1640 (cat. no. SH30809.01; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) prior to use.

Three human AML cell lines (U937, HL-60 and KG-1a) were purchased from the National Infrastructure of Cell Line Resource (Beijing, China). U937 and HL-60 cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (cat. no. 10099141; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), whereas KG-1a cells were cultured in RPMI-1640 supplemented with 20% fetal bovine serum. All cell lines were cultured at 37°C in a 5% CO2 humidified atmosphere without antibiotics.

Treatment of U937, HL-60 and KG-1a cell lines

U937, HL-60 and KG-1a cells were treated with PM2.5 solution at concentrations of 0–20 mg/ml for 24, 48 and 72 h after reaching a steady-state of exponential growth in normal medium.

Measurement of cell proliferation

Cell proliferation rates were measured using a Cell Counting Kit-8 (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) according to the manufacturer's protocol. The relative cell proliferation ratio (%) following treatment was compared with controls (cultured cells without PM2.5 treatment or blank controls with RPMI-1640 with 10% FBS), and calculated as follows: [(Acontrol-Ablank of control)-(Asample-Ablank of sample)]/(Acontrol-Ablank of control) ×100%.

Measurement of cytokine mRNA expression levels in AML cell lines

The mRNA expression levels of IL-2, IL-10, IL-17A, and TNFα were detected by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) in AML cells following treatment with 0.1 mg/ml PM2.5 solution for 0, 24, 48 and 72 h. The housekeeper gene actin β was used as a control. The RNA of cells was extracted using Trizol reagent (cat. no. 15596018; Invitrogen; Thermo Fisher Scientific, Inc.). cDNA templates from AML cell lines were prepared using a TIANScript RT kit (Tiangen Biotech, Co., Ltd., Beijing, China) according to the manufacture's protocol.

RT-qPCR cycling was performed in 96-well plates on a LightCycler 480 Real-Time PCR system (Roche Applied Science, Penzberg, Germany). The reaction was performed in a 20-µl total volume containing 10 µl SYBR Select Master mix (cat. no. 4472908; Thermo Fisher Scientific, Inc.), 1 µl of each primer (10 µM), and 2 µl template cDNA. The primer sequences used for PCR are presented in Table I. The amplification protocol consisted of an initial denaturation step at 95°C for 5 min, followed by two-step PCR for 40 cycles at 95°C for 30 sec and 60°C for 30 sec. The mRNA expression levels of each target were determined based on the cycle threshold (Cq) value for the reference and each target and calculated as 2−ΔCq (20). Three independent experiments were performed.

Table I.

Primer sequences and lengths of detected genes.

Table I.

Primer sequences and lengths of detected genes.

Primer nameSequence (5′-3′)Product length (bp)
IL-2F: TACAAGAACCCGAAACTGACTCG29
R: ACATGAAGGTAGTCTCACTGCC28
IL-10F: TCAAGGCGCATGTGAACTCC26
R: GATGTCAAACTCACTCATGGCT28
IL-17AF: AGATTACTACAACCGATCCACCT29
R: GGGGACAGAGTTCATGTGGTA27
TNFαF: CCTCTCTCTAATCAGCCCTCTG28
R: GAGGACCTGGGAGTAGATGAG27
ACTBF: CATGTACGTTGCTATCCAGGC27
R: CTCCTTAATGTCACGCACGAT27

[i] IL, interleukin; TNF, tumor necrosis factor; ACTB, actin β; F, forward; R, reverse.

Measurement of protein expression levels in rats

All 26 Sprague Dawley (SD) rats were 6-week-old males (173–190 g), purchased from Charles River Laboratories (Beijing, China), and housed at a temperature of 25°C, 1.013×105 pa atmosphere, 12/12 h dark/light cycle and ad libitum access to food and water. The present study was approved by Ethics Committee of Beijing Luhe Hospital Affiliated to Capital Medical University (Beijing, China). Exposed chambers and clean chambers were constructed to raise rats. Air in the exposed chambers was the same as the true air outside, whereas air in the clean chambers was filtered to remove PM2.5 particles. Fourteen rats were kept in exposed chambers (n=8) or clean chambers (n=6) for 6 weeks (between August 9, 2016 and September 19, 2016), and 12 rats were kept in exposed chambers (n=8) or clean chambers (n=4) for 12 weeks (between August 9, 2016 and October 10, 2016). The PM2.5 concentration in the atmosphere during the study is presented in Table II.

Table II.

PM2.5 concentration of the atmosphere during the study.

Table II.

PM2.5 concentration of the atmosphere during the study.

A, PM2.5 concentration between August 09 2016 and September 19 2016

DatePM2.5 (µg/m3) within chambersPM2.5 (µg/m3) in Beijing outsideDatePM2.5 (µg/m3)Beijing
Aug-09-20163044Aug-30-20162528
Aug-10-20164182Aug-31-20161516
Aug-11-20163685Sep-01-201667
Aug-12-20162359Sep-02-2016811
Aug-13-20161021Sep-03-20161318
Aug-14-2016918Sep-04-20165680
Aug-15-20161520Sep-05-20162527
Aug-16-20161822Sep-06-20162217
Aug-17-20163559Sep-07-20162841
Aug-18-20163874Sep-08-20161720
Aug-19-20161117Sep-09-20161917
Aug-20-20163152Sep-10-20161815
Aug-21-20164051Sep-11-20162832
Aug-22-20163751Sep-12-20163331
Aug-23-20163569Sep-13-20166286
Aug-24-20164179Sep-14-201666101
Aug-25-20161019Sep-15-20167269
Aug-26-201699Sep-16-201682133
Aug-27-20161214Sep-17-20162841
Aug-28-2016910Sep-18-20161722
Aug-29-20161417Sep-19-20161210
Average value4461Average value4461

B, PM2.5 concentration between September 19 2016 and October 31 2016

DatePM2.5 (µg/m3) within chambersPM2.5 (µg/m3) in Beijing outsideDatePM2.5 (µg/m3)Beijing

Sep-20-20163218Oct-11-201675116
Sep-21-20165663Oct-12-20167777
Sep-22-20167399Oct-13-2016148150
Sep-23-201677121Oct-14-2016133241
Sep-24-201685111Oct-15-201696190
Sep-25-201680162Oct-16-201683119
Sep-26-20164458Oct-17-20165259
Sep-27-20161024Oct-18-201680117
Sep-28-20162013Oct-19-2016130225
Sep-29-20165651Oct-20-20164294
Sep-30-20167697Oct-21-20164942
Oct-01-2016106165Oct-22-20162314
Oct-02-201696183Oct-23-20164326
Oct-03-201662120Oct-24-20167960
Oct-04-20163733Oct-25-20168796
Oct-05-20166655Oct-26-20162443
Oct-06-20164872Oct-27-20163630
Oct-07-20163539Oct-28-20161710
Oct-08-20162611Oct-29-20163823
Oct-09-20165231Oct-30-20163443
Oct-10-20168887Oct-31-2016108
Average value4461Average value4461

[i] PM2.5, particulate matter with diameter ≤2.5 µm.

The peripheral blood of rats was collected from hearts after feeding for 6 or 12 weeks. Blood samples were centrifuged at 1,000 × g for 20 min at room temperature to obtain serum. Milliplex Map Rat Cytokine/Chemokine Magnetic Bead Panel-Immunology Multiplex assays (cat. no. RECYTMAG-65K; EMD Millipore, Billerica, MA, USA) were used to detect the expression of cytokines in serum according to the manufacturer's protocol.

Statistical analysis

Statistical analysis was performed using Microsoft Excel 2010 (Microsoft Corporation, Redmond, WA, USA) and Graphpad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA). All data were derived from at least three independent experiments and are presented as means ± standard deviations. The results were evaluated using two-tailed unpaired Student's t-test and one-way analysis of variance (ANOVA) with Dunnett's multiple comparison post-hoc test. P<0.05 was considered to indicate a statistically significant difference. In RT-qPCR analysis, statistical significance was assumed if the 2−Δct (target mean value-reference mean value) value was >150% or <75%.

Results

Low concentrations of PM2.5 promote proliferation, whereas high concentrations of PM2.5 inhibit proliferation in AML cells

First, the effects of PM2.5 on the proliferation of AML cell lines (U937, HL-60, and KG-1a) were evaluated. The results demonstrated that 24 h of treatment with PM2.5 did not induce or inhibit the proliferation of U937 cells at any concentration. However, after 48 or 72 h of treatment, PM2.5 first promoted and then significantly inhibited the proliferation of U937 cells as the concentration of PM2.5 increased. These effects were more evident at 72 h compared with at 48 h. A similar situation was observed in HL-60 and KG-1a cells. However, the stimulatory and inhibitory effects of PM2.5 on KG-1a cells were less evident compared with those on U937 and HL-60 cells (Fig. 1).

PM2.5 significantly alters the expression of cytokines in AML cells

Next, the expression levels of IL-2, IL-10, IL-17A and TNFα were analyzed in U937, HL-60 and KG-1a cells following treatment with PM2.5. The results revealed that the mRNA expression levels of IL-2 in U937 cells, IL-17A in HL-60 cells, and IL-2 and IL-17A in KG-1a cells were below the limit of detection (data not shown). In contrast, the expression of IL-10, IL-17A and TNFα in U937 cells; IL-10 and TNFα in HL-60 cells; and IL-10 in KG-1a cells significantly increased in a time- and concentration-dependent manner (Figs. 2 and 3). Notably, IL-2 expression in HL-60 cells and TNFα expression in KG-1a also increased after treatment with 0.1 µg/ml PM2.5 for 24 h or ≥0.01 µg/ml for 72 h; however, these effects did not persist over time (Fig. 2) and did not increase as the concentration was increased (Fig. 3).

PM2.5 significantly increases serum IL-2 and IL-6 in SD rats following treatment for 12 weeks

Four cytokines, IL-2, IL-10, IL-17A and TNFα, were detected in SD rat serum using enzyme-linked immunosorbent assays following treatment with PM2.5 for 6 or 12 weeks. The results demonstrated that exposure to PM2.5 for 6 weeks did not significantly alter serum levels of IL-2, IL-10, IL-17A and TNFα in SD rats (Table III). However, when the exposure time was increased to 12 weeks, serum IL-2 and IL-10 levels in rats were significantly higher compared with those of untreated rats (Table IV).

Table III.

Content of rat serum cell factors after raising in exposed and clean chambers for 6 weeks.

Table III.

Content of rat serum cell factors after raising in exposed and clean chambers for 6 weeks.

Content (pg/ml) in each rat

Cell factorsChamber12345678P-value
IL-2Exposed chamber35.3816.1833.359.625.4213.619.68.710.33
Clean chamber17.9523.541.616.1817.9531.33
IL-10Exposed chamber25.5389.42222.956.5223.323.3155.4641.050.79
Clean chamber28.9772.71115.159.45129.6967.25
IL-17AExposed chamber3.495.235.238.3119.9910.633.496.20.42
Clean chamber5.2313.135.238.3111.8617.15
TNFαExposed chamber1.352.452.173.023.022.171.351.90.25
Clean chamber2.732.451.91.93.023.62

[i] IL, interleukin; TNF, tumor necrosis factor.

Table IV.

Content of rat serum cell factors following raising in exposed and clean chambers for 12 weeks.

Table IV.

Content of rat serum cell factors following raising in exposed and clean chambers for 12 weeks.

Content (pg/ml) in each rat

Cell factorsChamber12345678P-value
IL-2Exposed chamber9.68.716.7814.4512.789.66.785.920.01
Clean chamber21.6116.1814.4511.16
IL-10Exposed chamber14.9582.459.1722.210.3117.9628.9739.810.04
Clean chamber351.6192.0266.1114.95
IL-17AExposed chamber4.335.232.75.238.315.232.74.330.08
Clean chamber5.2311.866.26.2
TNFαExposed chamber1.91.681.681.512.171.91.681.90.68
Clean chamber1.91.681.682.17

[i] IL, interleukin; TNF, tumor necrosis factor.

Discussion

Several epidemiological studies have demonstrated positive associations between PM2.5 exposure and increased leukemia risk (1416,2123). However, the mechanism explaining this association has not yet been elucidated. The present study aimed to explain the effects of PM2.5 on the occurrence and development of leukemia through its influence on cytokines in vitro and in vivo.

In the current study, low doses of PM2.5 promoted the proliferation of AML cells (U937, HL-60, and KG-1a), whereas high doses of PM2.5 resulted in cytotoxicity, thereby inhibiting cell proliferation. Furthermore, PM2.5 exposure resulted in significantly increased levels of IL-2, IL-10, IL-17A and TNFα in AML cells. Thus, these results suggested that PM2.5 was capable of inducing an inflammatory response in human AML cells.

CD4+ T cells, also known as helper T cells, are divided into three classes: Th1, Th2, and Th17, according to their different cytokine secretion patterns. The differentiation of Th1 and Th2 cells is influenced by local environmental cytokines, and these two groups complement or antagonize each other to regulate immune functions.

IL-2 is a Th1 cytokine that is indispensable in immune system regulation. IL-2 is secreted by activated T or natural killer (NK) cells by autocrine or paracrine secretion, and serves an important role in the activation and maintenance of the immune response and in the promotion of lymphocyte development. Numerous studies have confirmed that IL-2 induces NK cells and enhances their antitumor activity (24,25). The application of IL-2 as an antitumor drug in the clinical treatment of patients with AML began in the 1980s (26). In the present study, it was revealed that IL-2 levels increased in a time- and concentration-dependent manner in HL-60 cells treated with PM2.5, but was not detected in U937 or KG-1a cells. In rats, IL-2 expression was significantly enhanced after 12 weeks of exposure to PM2.5. These results suggested that PM2.5 may affect different subtypes of AML cells in different ways; thus, there may be multiple complex cytokine networks in vivo.

IL-10 is a Th2 cytokine that has multiple pleiotropic effects on immunoregulation and inflammation, and is capable of inhibiting the synthesis of pro-inflammatory cytokines, including interferon-γ, IL-2, IL-3, TNFα and granulocyte-macrophage colony-stimulating factor, produced by macrophages and Th1 T cells (2729). Despite the inhibitory effects of IL-10 on Th1 cytokines, certain Th1 cells are also able to produce IL-10, and a negative feedback pathway is formed when IL-10 regulates Th1 cell activation (27). Previous studies have demonstrated that IL-10 directly inhibits the proliferation and migration of effector T cells, and blocks the production of associated cytokines, serving an important role in inducing tumor immune escape. When the IL-10 content is increased, the killing effect of T cells on tumor cells is markedly inhibited (3032). Blocking IL-10 expression in animal models improves the killing ability of the immune system on tumor cells (33,34). In addition, IL-10 has been shown to inhibit T cells, forming an immunosuppressive environment and inducing tumor immune escape by inhibiting antigen-presenting cells activation (35). In the present study, the mRNA expression levels of IL-10 were significantly increased in a time- and concentration-dependent manner following treatment of AML cell lines with PM2.5 solution. Similar results were also obtained in an in vivo experiment; that is, serum IL-10 contents were significantly increased in rats exposed to PM2.5 compared with those of unexposed rats after 12 weeks. These results demonstrate the potentially carcinogenetic effects of PM2.5 in AML.

IL-17A is a pro-inflammatory cytokine produced by activated Th17 cells, which function to amplify inflammation, and activate neutrophils to engulf and digest extracellular bacteria and molds by releasing pro-inflammatory cytokines (36). IL-17 and Th17 cells mediate carcinogenesis in rat tumor models and patients with cancer. The mechanisms through which IL-17 and Th17 cells mediate carcinogenesis involve angiogenesis and the induction of cytokines in the tumor microenvironment, which promotes tumor growth (3740). Several studies have demonstrated that IL-17 induces IL-6 production, and IL-6 activates the signal transducer and activator of transcription 3 pathway, which then upregulates the expression of prosurvival and angiogenic genes to modulate tumor angiogenesis (4145). The tumor promoting effects of IL-17 and Th1 exist in various types of common tumors (40,4648). Wu et al (49) demonstrated that Th17 cells were significantly increased in the peripheral blood of patients with AML compared with that in normal healthy individuals. In addition, IL-17 content increased as the number of Th17 cells increased, resulting in promotion of bone marrow cell proliferation and inhibition of immune function. Additionally, the slow growth of TNFα in the tumor microenvironment enhanced the recruitment of IL-17-dependent bone marrow cells and promoted tumor development. In the present study, the mRNA expression of IL-17A was significantly increased in U937 AML cells a time- and concentration-dependent manner following treatment with PM2.5 solution; however, the IL-17A content in HL-60 and KG-1a cells was below the detection range. Thus, these findings indicated that different mechanisms mediated the effects of PM2.5 on AML cells. The in vivo experiment revealed no significant increases in exposed rats compared with unexposed rats after 6 or 12 weeks, indicating that the mechanisms through which PM2.5 affected AML differed in vitro and in vivo. However, further studies with increased numbers of animals are required to confirm these findings.

TNFα, which is also a Th1 cytokine, is produced ectopically by malignant and immune cells in the tumor-associated microenvironment, creating a tumor-supportive inflammatory niche that modulates the development and progression of malignant disease (50). TNFα is produced by various types of leukemia cells (5155). In several clinical studies, a positive association between the expression levels of TNFα and adverse clinical parameters in leukemia was observed (5357) In AML, high levels of TNFα expression are associated with greater fatigue and poorer quality of life (58). Previous studies have revealed that TNFα activates nuclear factor κB and c-Jun N-terminal kinase/activator protein-1 to exert anti-apoptotic and proproliferative effects in leukemia cells, thereby facilitating leukemia cell survival and progression (3234, 5961). In the current study, TNFα levels were significantly increased in U937 and HL-60 cells in a time- and concentration-dependent manner following PM2.5 treatment. In KG-1a cells, TNFα levels were also increased, although the time- and concentration-dependent effects were not as evident. This in vitro experiment reflects the potential ability of PM2.5 to promote the occurrence and development of leukemia by regulating intracellular TNFα. In vivo, significant changes in TNFα expression were not observed after 6 or 12 weeks of treatment with PM2.5, further supporting that there may be different mechanisms mediating the effects of PM2.5 on AML in vitro and in vivo. However, again, further studies with greater numbers of animals are required.

Acknowledgements

The authors would like to thank Dr Xiaokun Geng and Mr Longfei Guan (China-America Institute of Neuroscience, Beijing Luhe Hospital, Capital Medical University, Beijing, China) for their valuable technical assistance with the animal experiments.

Funding

The present study was supported by the Air Pollution Subject of Science Committee of Tongzhou District (grant no. CK2016KJ035).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

TC performed the cell and animal experiments of the present study and analyzed the obtained data. JZ and HuZ interpreted the data. YuZ, YoZ and XZ helped TC to perform the animal experiments. DZ and YF helped with the animal experiments and participated in writing the manuscript. HeZ was a major contributor to the idea of the study and participated in writing the manuscript.

Ethics approval and consent to participate

The present study was approved by Ethics Committee of Beijing Luhe Hospital Affiliated to Capital Medical University (Beijing, China).

Consent for publication

Not applicable.

Competing interests

The authors declare they have no competing interests.

References

1 

Henriquez G and Urrea C: Association between air pollution and emergency consultations for respiratory diseases. Rev Med Chil. 145:1371–1377. 2017.(In Spanish). PubMed/NCBI

2 

Rabiei K, Hosseini SM, Sadeghi E, Jafari-Koshki T, Rahimi M, Shishehforoush M, Lahijanzadeh A, Sadeghian B, Moazam E, Mohebi MB, et al: Air pollution and cardiovascular and respiratory disease: Rationale and methodology of CAPACITY study. ARYA Atheroscler. 13:264–273. 2017.PubMed/NCBI

3 

Trnjar K, Pintarić S, Mornar Jelavić M, Nesek V, Ostojić J, Pleština S, Šikić A and Pintarić H: Correlation between occurrence and deterioration of respiratory diseases and air pollution within the legally permissible limits. Acta Clin Croat. 56:210–217. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Faridi S, Shamsipour M, Krzyzanowski M, Künzli N, Amini H, Azimi F, Malkawi M, Momeniha F, Gholampour A, Hassanvand MS and Naddafi K: Long-term trends and health impact of PM2.5 and O3 in Tehran, Iran, 2006–2015. Environ Int. 114:37–49. 2018. View Article : Google Scholar : PubMed/NCBI

5 

Kolpakova AF, Sharipov RN and Kolpakov FA: Air pollution by particulate matter as the risk factor for the cardiovascular diseases. Gig Sanit. 96:133–137. 2017.PubMed/NCBI

6 

Stachyra K, Kiepura A and Olszanecki R: Air pollution and atherosclerosis-a brief review of mechanistic links between atherogenesis and biological actions of inorganic part of particulate matter. Folia Med Cracov. 57:37–46. 2017.PubMed/NCBI

7 

Hüls A, Vierkötter A, Sugiri D, Abramson MJ, Ranft U, Krämer U and Schikowski T: The role of air pollution and lung function in cognitive impairment. Eur Respir J. 51:17019632018. View Article : Google Scholar : PubMed/NCBI

8 

Kim H, Kim J, Kim S, Kang SH, Kim HJ, Kim H, Heo J, Yi SM, Kim K, Youn TJ and Chae IH: Cardiovascular effects of long-term exposure to air pollution: A population-based study with 900 845 person-years of follow-up. J Am Heart Assoc. 6:e0071702017. View Article : Google Scholar : PubMed/NCBI

9 

Brunekreef B and Holgate ST: Air pollution and health. Lancet. 360:1233–1242. 2002. View Article : Google Scholar : PubMed/NCBI

10 

Li R, Kou X, Geng H, Xie J, Tian J, Cai Z and Dong C: Mitochondrial damage: An important mechanism of ambient PM2.5 exposure-induced acute heart injury in rats. J Hazard Mater. 287:392–401. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Wang C, Tu Y, Yu Z and Lu R: PM2.5 and cardiovascular diseases in the elderly: An overview. Int J Environ Res Public Health. 12:8187–8197. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Dabass A, Talbott EO, Venkat A, Rager J, Marsh GM, Sharma RK and Holguin F: Association of exposure to particulate matter (PM2.5) air pollution and biomarkers of cardiovascular disease risk in adult NHANES participants (2001–2008). Int J Hyg Environ Health. 219:301–310. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Yang A, Janssen NA, Brunekreef B, Cassee FR, Hoek G and Gehring U: Children's respiratory health and oxidative potential of PM2.5: The PIAMA birth cohort study. Occup Environ Med. 73:154–160. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Brosselin P, Rudant J, Orsi L, Leverger G, Baruchel A, Bertrand Y, Nelken B, Robert A, Michel G, Margueritte G, et al: Acute childhood leukaemia and residence next to petrol stations and automotive repair garages: The ESCALE study (SFCE). Occup Environ Med. 66:598–606. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Steffen C, Auclerc MF, Auvrignon A, Baruchel A, Kebaili K, Lambilliotte A, Leverger G, Sommelet D, Vilmer E, Hémon D and Clavel J: Acute childhood leukaemia and environmental exposure to potential sources of benzene and other hydrocarbons; a case-control study. Occup Environ Med. 61:773–778. 2004. View Article : Google Scholar : PubMed/NCBI

16 

Raaschou-Nielsen O, Ketzel M, Poulsen Harbo A and Sørensen M: Traffic-related air pollution and risk for leukaemia of an adult population. Int J Cancer. 138:1111–1117. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Chiarini F, Lonetti A, Evangelisti C, Buontempo F, Orsini E, Evangelisti C, Cappellini A, Neri LM, McCubrey JA and Martelli AM: Advances in understanding the acute lymphoblastic leukemia bone marrow microenvironment: From biology to therapeutic targeting. Biochim Biophys Acta. 1863:449–463. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Kumar B, Garcia M, Murakami JL and Chen CC: Exosome-mediated microenvironment dysregulation in leukemia. Biochim Biophys Acta. 1863:464–470. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Jin XT, Chen ML, Li RJ, An Q, Song L, Zhao Y, Xiao H, Cheng L and Li ZY: Progression and inflammation of human myeloid leukemia induced by ambient PM2.5 exposure. Arch Toxicol. 90:1929–1938. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Castro-Jimenez MÁ and Orozco-Vargas LC: Parental exposure to carcinogens and risk for childhood acute lymphoblastic leukemia, Colombia, 2000–2005. Prev Chronic Dis. 8:A1062011.PubMed/NCBI

22 

McHale CM, Zhang L and Smith MT: Current understanding of the mechanism of benzene-induced leukemia in humans: Implications for risk assessment. Carcinogenesis. 33:240–252. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Filippini T, Heck JE, Malagoli C, Del Giovane C and Vinceti M: A review and meta-analysis of outdoor air pollution and risk of childhood leukemia. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev. 33:36–66. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Sharma A, Rajappa M, Satyam A and Sharma M: Cytokines (TH1 and TH2) in patients with advanced cervical cancer undergoing neoadjuvant chemoradiation: Correlation with treatment response. Int J Gynecol Cancer. 19:1269–1275. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Becker Y: Molecular immunological approaches to biotherapy of human cancers-a review, hypothesis and implications. Anticancer Res. 26:1113–1134. 2006.PubMed/NCBI

26 

Min G: Interleukin-2 and its application in the treatment of patients with acute myelogenous leukemia. J Leukemia Lymphoma. 17:152–155. 2008.(In Chinese).

27 

Shouval DS, Ouahed J, Biswas A, Goettel JA, Horwitz BH, Klein C, Muise AM and Snapper SB: Interleukin 10 receptor signaling: Master regulator of intestinal mucosal homeostasis in mice and humans. Adv Immunol. 122:177–210. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Qing Yang ZL: Interleukin family cytokines and stem cell mobilization. Chin J Comp Med. 21:62–65. 2011.(In Chinese).

29 

Lobo-Silva D, Carriche GM, Castro AG, Roque S and Saraiva M: Balancing the immune response in the brain: IL-10 and its regulation. J Neuroinflammation. 13:2972016. View Article : Google Scholar : PubMed/NCBI

30 

de Waal Malefyt R, Haanen J, Spits H, Roncarolo MG, te Velde A, Figdor C, Johnson K, Kastelein R, Yssel H and de Vries JE: Interleukin-10 (IL-10) and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class II major histocompatibility complex expression. J Exp Med. 174:915–924. 1991. View Article : Google Scholar : PubMed/NCBI

31 

Mumm JB, Emmerich J, Zhang X, Chan I, Wu L, Mauze S, Blaisdell S, Basham B, Dai J, Grein J, et al: IL-10 elicits IFNγ-dependent tumor immune surveillance. Cancer Cell. 20:781–796. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Wang Y, Ma Y, Fang Y, Wu S, Liu L, Fu D and Shen X: Regulatory T cell: A protection for tumour cells. J Cell Mol Med. 16:425–436. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Tanikawa T, Wilke CM, Kryczek I, Chen GY, Kao J, Núñez G and Zou W: Interleukin-10 ablation promotes tumor development, growth, and metastasis. Cancer Res. 72:420–429. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Mocellin S, Marincola F, Rossi CR, Nitti D and Lise M: The multifaceted relationship between IL-10 and adaptive immunity: Putting together the pieces of a puzzle. Cytokine Growth Factor Rev. 15:61–76. 2004. View Article : Google Scholar : PubMed/NCBI

35 

Mittal SK and Roche PA: Suppression of antigen presentation by IL-10. Curr Opin Immunol. 34:22–27. 2015. View Article : Google Scholar : PubMed/NCBI

36 

Han L, Yang J, Wang X, Li D, Lv L and Li B: Th17 cells in autoimmune diseases. Front Med. 9:10–19. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Housseau F, Wu S, Wick EC, Fan H, Wu X, Llosa NJ, Smith KN, Tam A, Ganguly S, Wanyiri JW, et al: Redundant innate and adaptive sources of IL17 production drive colon tumorigenesis. Cancer Res. 76:2115–2124. 2016. View Article : Google Scholar : PubMed/NCBI

38 

Patil RS, Shah SU, Shrikhande SV, Goel M, Dikshit RP and Chiplunkar SV: IL17 producing γδ T cells induce angiogenesis and are associated with poor survival in gallbladder cancer patients. Int J Cancer. 139:869–881. 2016. View Article : Google Scholar : PubMed/NCBI

39 

Benevides L, da Fonseca DM, Donate PB, Tiezzi DG, De Carvalho DD, de Andrade JM, Martins GA and Silva JS: IL17 promotes mammary tumor progression by changing the behavior of tumor cells and eliciting tumorigenic neutrophils recruitment. Cancer Res. 75:3788–3799. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Numasaki M, Fukushi J, Ono M, Narula SK, Zavodny PJ, Kudo T, Robbins PD, Tahara H and Lotze MT: Interleukin-17 promotes angiogenesis and tumor growth. Blood. 101:2620–2627. 2003. View Article : Google Scholar : PubMed/NCBI

41 

Lee EJ, Park HJ, Lee IJ, Kim WW, Ha SJ, Suh YG and Seong J: Inhibition of IL-17A suppresses enhanced-tumor growth in low dose pre-irradiated tumor beds. PLoS One. 9:e1064232014. View Article : Google Scholar : PubMed/NCBI

42 

Ju X, Ijaz T, Sun H, Ray S, Lejeune W, Lee C, Recinos A III, Guo DC, Milewicz DM, Tilton RG and Brasier AR: Interleukin-6-signal transducer and activator of transcription-3 signaling mediates aortic dissections induced by angiotensin II via the T-helper lymphocyte 17-interleukin 17 axis in C57BL/6 mice. Arterioscler Thromb Vasc Biol. 33:1612–1621. 2013. View Article : Google Scholar : PubMed/NCBI

43 

Kumar P: Natarajan K and Shanmugam N: High glucose driven expression of pro-inflammatory cytokine and chemokine genes in lymphocytes: Molecular mechanisms of IL-17 family gene expression. Cell Signal. 26:528–539. 2014. View Article : Google Scholar : PubMed/NCBI

44 

Chen XW and Zhou SF: Inflammation, cytokines, the IL-17/IL-6/STAT3/NF-κB axis, and tumorigenesis. Drug Des Devel Ther. 9:2941–2946. 2015.PubMed/NCBI

45 

Hu Z, Luo D, Wang D, Ma L, Zhao Y and Li L: IL-17 activates the IL-6/STAT3 signal pathway in the proliferation of hepatitis B virus-related hepatocellular carcinoma. Cell Physiol Biochem. 43:2379–2390. 2017. View Article : Google Scholar : PubMed/NCBI

46 

Zhang JP, Yan J, Xu J, Pang XH, Chen MS, Li L, Wu C, Li SP and Zheng L: Increased intratumoral IL-17-producing cells correlate with poor survival in hepatocellular carcinoma patients. J Hepatol. 50:980–989. 2009. View Article : Google Scholar : PubMed/NCBI

47 

Du JW, Xu KY, Fang LY and Qi XL: Interleukin-17, produced by lymphocytes, promotes tumor growth and angiogenesis in a mouse model of breast cancer. Mol Med Rep. 6:1099–1102. 2012. View Article : Google Scholar : PubMed/NCBI

48 

Mucida D, Park Y, Kim G, Turovskaya O, Scott I, Kronenberg M and Cheroutre H: Reciprocal TH17 and regulatory T cell differentiation mediated by retinoic acid. Science. 317:256–260. 2007. View Article : Google Scholar : PubMed/NCBI

49 

Wu C, Wang S, Wang F, Chen Q, Peng S, Zhang Y, Qian J, Jin J and Xu H: Increased frequencies of T helper type 17 cells in the peripheral blood of patients with acute myeloid leukaemia. Clin Exp Immunol. 158:199–204. 2009. View Article : Google Scholar : PubMed/NCBI

50 

Waters JP, Pober JS and Bradley JR: Tumour necrosis factor and cancer. J Pathol. 230:241–248. 2013. View Article : Google Scholar : PubMed/NCBI

51 

Gallipoli P, Pellicano F, Morrison H, Laidlaw K, Allan EK, Bhatia R, Copland M, Jørgensen HG and Holyoake TL: Autocrine TNF-α production supports CML stem and progenitor cell survival and enhances their proliferation. Blood. 122:3335–3339. 2013. View Article : Google Scholar : PubMed/NCBI

52 

Sanchez-Correa B, Bergua JM, Campos C, Gayoso I, Arcos MJ, Bañas H, Morgado S, Casado JG, Solana R and Tarazona R: Cytokine profiles in acute myeloid leukemia patients at diagnosis: Survival is inversely correlated with IL-6 and directly correlated with IL-10 levels. Cytokine. 61:885–891. 2013. View Article : Google Scholar : PubMed/NCBI

53 

Potapnev MP, Petyovka NV, Belevtsev MV, Savitskiy VP and Migal NV: Plasma level of tumor necrosis factor-alpha (TNF-alpha) correlates with leukocytosis and biological features of leukemic cells, but not treatment response of children with acute lymphoblastic leukemia. Leuk Lymphoma. 44:1077–1079. 2003. View Article : Google Scholar : PubMed/NCBI

54 

Foa R, Massaia M, Cardona S, Tos AG, Bianchi A, Attisano C, Guarini A, di Celle PF and Fierro MT: Production of tumor necrosis factor-alpha by B-cell chronic lymphocytic leukemia cells: A possible regulatory role of TNF in the progression of the disease. Blood. 76:393–400. 1990.PubMed/NCBI

55 

Lech-Maranda E, Grzybowska-Izydorczyk O, Wyka K, Mlynarski W, Borowiec M, Antosik K, Cebula-Obrzut B, Makuch-Lasica H, Nowak G, Klimkiewicz-Wojciechowska G, et al: Serum tumor necrosis factor-alpha and interleukin-10 levels as markers to predict outcome of patients with chronic lymphocytic leukemia in different risk groups defined by the IGHV mutation status. Arch Immunol Ther Exp (Warsz). 60:477–486. 2012. View Article : Google Scholar : PubMed/NCBI

56 

Ferrajoli A, Keating MJ, Manshouri T, Giles FJ, Dey A, Estrov Z, Koller CA, Kurzrock R, Thomas DA, Faderl S, et al: The clinical significance of tumor necrosis factor-alpha plasma level in patients having chronic lymphocytic leukemia. Blood. 100:1215–1219. 2002.PubMed/NCBI

57 

Kupsa T, Vasatova M, Karesova I, Zak P and Horacek JM: Baseline serum levels of multiple cytokines and adhesion molecules in patients with acute myeloid leukemia: Results of a pivotal trial. Exp Oncol. 36:252–257. 2014.PubMed/NCBI

58 

Fung FY, Li M, Breunis H, Timilshina N, Minden MD and Alibhai SM: Correlation between cytokine levels and changes in fatigue and quality of life in patients with acute myeloid leukemia. Leuk Res. 37:274–279. 2013. View Article : Google Scholar : PubMed/NCBI

59 

Hess P, Pihan G, Sawyers CL, Flavell RA and Davis RJ: Survival signaling mediated by c-Jun NH(2)-terminal kinase in transformed B lymphoblasts. Nat Genet. 32:201–205. 2002. View Article : Google Scholar : PubMed/NCBI

60 

Tsai HJ, Kobayashi S, Izawa K, Ishida T, Watanabe T, Umezawa K, Lin SF and Tojo A: Bioimaging analysis of nuclear factor-κB activity in Philadelphia chromosome-positive acute lymphoblastic leukemia cells reveals its synergistic upregulation by tumor necrosis factor-α-stimulated changes to the microenvironment. Cancer Sci. 102:2014–2021. 2011. View Article : Google Scholar : PubMed/NCBI

61 

Volk A, Li J, Xin J, You D, Zhang J, Liu X, Xiao Y, Breslin P, Li Z, Wei W, et al: Co-inhibition of NF-κB and JNK is synergistic in TNF-expressing human AML. J Exp Med. 211:1093–1108. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

August-2018
Volume 16 Issue 2

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Chen T, Zhang J, Zeng H, Zhang Y, Zhang Y, Zhou X, Zhao D, Feng Y and Zhou H: The impact of inflammation and cytokine expression of PM2.5 in AML. Oncol Lett 16: 2732-2740, 2018
APA
Chen, T., Zhang, J., Zeng, H., Zhang, Y., Zhang, Y., Zhou, X. ... Zhou, H. (2018). The impact of inflammation and cytokine expression of PM2.5 in AML. Oncology Letters, 16, 2732-2740. https://doi.org/10.3892/ol.2018.8965
MLA
Chen, T., Zhang, J., Zeng, H., Zhang, Y., Zhang, Y., Zhou, X., Zhao, D., Feng, Y., Zhou, H."The impact of inflammation and cytokine expression of PM2.5 in AML". Oncology Letters 16.2 (2018): 2732-2740.
Chicago
Chen, T., Zhang, J., Zeng, H., Zhang, Y., Zhang, Y., Zhou, X., Zhao, D., Feng, Y., Zhou, H."The impact of inflammation and cytokine expression of PM2.5 in AML". Oncology Letters 16, no. 2 (2018): 2732-2740. https://doi.org/10.3892/ol.2018.8965