Long non‑coding RNA MIAT competitively binds miR‑150‑5p to regulate ZEB1 expression in osteosarcoma

  • Authors:
    • Hao Jin
    • Xin Jin
    • Weiguang Chai
    • Zhiqiang Yin
    • Yang Li
    • Feng Dong
    • Wenbo Wang
  • View Affiliations

  • Published online on: November 7, 2018     https://doi.org/10.3892/ol.2018.9671
  • Pages: 1229-1236
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Long non‑coding RNAs (LncRNAs), are significant in a number of biological stages and illnesses. The myocardial infarction associated transcript (MIAT) serves a function in numerous types of illness and physiological and pathological processes, including paranoid schizophrenia, diabetic retinopathy, myocardial infarction and neuroendocrine prostate cancer. However, the function of the lncRNA MIAT in the development of osteosarcoma is unknown. It has been identified that during the development of osteosarcoma, MIAT is upregulated in tumor tissues compared to adjacent non‑tumor tissues. The spreading and proliferation of osteosarcoma cells was reduced by MIAT knockdown. These findings indicate that MIAT functions by competing with critical RNAs to target miR‑150‑5p and activate zinc finger E‑box binding homeobox 1 to modulate the function of osteosarcoma cells. Together, the present findings may contribute to the understanding of the pathogenesis of osteosarcoma.

Introduction

Osteosarcoma primarily impacts children, juveniles and adults from an early age (1). Although the worldwide incidence rate of this rare disease is only 3–4 cases per million, osteosarcoma is the most common form of bone cancer (2). Various chemotherapeutic and radiation treatments have been developed over the past two decades; however, the survival rate is still low. Almost 50% of patients succumb to pulmonary metastasis in the terminal stages of the disease (3). Elucidating the underlying molecular mechanisms of osteosarcoma metastasis is therefore a desirable research outcome.

The epithelial-mesenchymal transition (EMT) is involved in the process of invasion and metastasis in many cancers, including osteosarcoma (4,5). Zinc finger E-box binding homeobox 1 (ZEB1), is a key protein that functions to regulate the phenotype of EMT during cancer progression (6). ZEB1 may promote prostatic cancer, and overexpression of ZEB1 leads to the promotion of lung cancer cell metastasis (7,8). Additionally, the overexpression of ZEB1 has been demonstrated to be associated with the development, carcinogenesis, invasion and metastasis of osteosarcoma (9).

Long non-coding RNAs (lncRNAs) are RNA molecules that have over 200 nucleotides and possess the potential for protein-coding (10). LncRNAs are involved in regulating cellular functions and the progression of various types of cancer (11). Several studies have demonstrated that lncRNAs serve a critical function in numerous cellular processes by competing with RNAs to regulate microRNAs (1214). The myocardial infarction associated transcript (MIAT) may be expressed in postmitotic retinal precursor cells and mitotic progenitors (15). With regards to human malignancies, MIAT upregulation has been observed in conditions including neuroendocrine prostatic and gastric cancer (16,17). However, the role of MIAT in the regulation of osteosarcoma remains unresolved.

Materials and methods

Tissue samples

Patients with osteosarcoma provided six tissue samples and were operated on at The First Affiliated Hospital of Harbin Medical University, China. Samples were snap frozen at −80°C until RNA extraction. Written informed consent was obtained from all patients. The study was approved by the Research Ethics Committee at Harbin Medical University (Harbin, China).

Cell culture and transfection

The Chinese Cell Bank of the Chinese Academy of Sciences (Shanghai, China) provided the osteoblast cell lines hFOB (OB3) and osteosarcoma cell lines Saos-2 and MG-63. Dulbecco's modified Eagle's medium (DMEM; HyClone; GE Healthcare, Chicago, IL, USA) was used as cell medium at 37°C, with 10% heat-inactivated fetal bovine serum (FBS; Biological Industries, Kibbutz Beit Haemek, Israel) and with 95% air and 5% CO2. siRNAs targeting MIAT (forward, 5′-GGACGTTCACAACCACACTG-3′ and reverse, 5′-TCCCACTTTGGCATTCTAGG-3′) were designed by Guangzhou RiboBio Co., Ltd. (Guangzhou, China). Knockdown and overexpression of miR-150-5p were obtained from Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The sequences were as follows: Human miR-150-5p, 5′-UCUCCCAACCCUUGUACCAGUG-3′ and 29-O-methyl modified miR-150 inhibitor, 5′-CACUGGUACAAGGGUUGGGAGA-3′. Cell transfections were performed using X-tremeGENE siRNA Transfection Reagent (Roche Diagnostics, Indianapolis, IN, USA) according to the manufacturer's protocol. siNC (50 µl DMEM was mixed with 20 pmol siNC; GCACCTTGAGTGAATGTCAGGGACTCCCTGATGATGTGA; Guangzhou RiboBio Co., Ltd.) was defined as the negative control.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

TRIzol® reagent (Life Technologies; Thermo Fisher Scientific, Inc.) was used to extract RNA according to the manufacturers protocol. Invitrogen (Thermo Fisher Scientific, Inc.) provided the PCR primers. A NanoDrop Spectrophotometer (NanoDrop Technologies, Wilmington, DE) was used to measure the concentration of extracted RNA. A TaqMan® miRNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) synthesized cDNA via RT in 5 ng of total RNA to find miR-150-5p levels. The 2−ΔΔCq method was used to determine the expression levels of miR-150-5p (18). MIAT expression was divided into high and low groups using RT-qPCR, using the median value as the cut-off to differentiate between the high and low groups. Bioinformatics analysis was used (MicroRNA, Starbase version 2.0) to determine the potential complementarity between MIAT and miRNAs.

In the synthesis kit of cDNA, RNA synthesized the cDNAs via specific gene primers. (Invitrogen; Thermo Fisher Scientific, Inc.) to determine ZEB1 mRNA expression. qPCR was performed using a SYBR Green Real-Time PCR Master Mix kit (Toyobo Life Science, Osaka, Japan) according to the manufacturer's protocol, and the ABI 7500 Sequence Detection System (Life Technologies; Thermo Fisher Scientific, Inc.). In a total reaction volume of 20 µl, amplification was performed with 1 µl reverse primer, 1 µl forward primer, 10 µl SYBR Master Mix, 6 µl diethyl pyrocarbonate and 2 µl cDNA. The conditions for the reaction were as follows: 72°C for 45 sec, 60°C for 15 sec and 40 cycles of 95°C for 15 sec. The internal control was GAPDH. Expression levels of ZEB1 were determined in relation to GAPDH by the 2−ΔΔCq method (18). Table I presents the primer sequences.

Table I.

Primers used for RT-PCR.

Table I.

Primers used for RT-PCR.

NameSequence (5′-3′)Length (bp)
GAPDH forward AAGAAGGTGGTGAAGCAGGC20
GAPDH reverse TCCACCACCCTGTTGCTGTA20
miR-150-5p forward GTCTCCCAACCCTTGTAC18
miR-150-5p reverse TATCCAGTGCGTGTCGTG18
ZEB1 forward FGCCAATAAGCAAACGATTCTG22
ZEB1 reverse TTTGGCTGGATCACTTTCAAG21
U6 forward CTCGCTTCGGCAGCACATATACT23
U6 reverse ACGCTTCACGAATTTGCGTGTC22

[i] ZEB1, zinc finger E-box binding homeobox 1; RT-PCR, reverse transcription-polymerase chain reaction.

Western blot analysis

Cells were washed using PBS three times at room temperature and lysed using radioimmunoprecipitation assay buffer with 1% protease inhibitor (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). The protein concentration was measured by Nanodrop. Proteins (50 µg) were separated by SDS-PAGE (10% gel). Protein transfer was then conducted onto nitrocellulose membranes. Blocking was performed using 0.1% Tween 20 and 5% nonfat milk (BD Biosciences, Franklin Lakes, NJ, USA) in TBS for 2 h at room temperature. Samples were incubated with the proper primary antibodies (cat. no. ab203829; 1:1,000; rabbit; Abcam, Cambridge, MA, USA) at 4°C overnight with gentle agitation followed by staining with the fluorochrome-labeled secondary antibody (cat. no. A10235; 1:8,000; rabbit anti-mouse; Alexa Fluor 800; LI-COR Biosciences, Lincoln, NE, USA) at room temperature for 1 h. The Odyssey fluorescent scanning system (LI-COR Biosciences) detected immunoreactivity and Image Studio software 4.0 (LI-COR Biosciences) was used to examine captured images. The loading control was β-actin.

Cell proliferation assay

The cell counting kit-8 kits (CCK-8) were used according to the manufacturer's instructions. MG63 and Saos-2 cells were seeded in 96-well plates at 1×104 cells/well for 24 h. CCK-8 solution (10 µl) was added to each well, and the cells were incubated at 37°C for 2 h. Absorbance at 450 nm was measured using a microplate reader. The assay was conducted in triplicate.

Wound healing assays

Osteosarcoma cells (MG63 and Saos-2 cells) were seeded in six-well plates and allowed to reach 80–90% confluence. A wound line was drawn across the surface of the plates using a 200-µl sterile plastic tip. PBS was used to wash the plates. Images were captured 24 h post wound infliction. Each test was conducted in triplicate.

Transwell assays

Transwell filters (8 µm pore size; BD Biosciences) were placed on a 24-well plate containing DMEM/F12 (Hyclone: GE Healthcare). The medium in the upper membrane was serum free, and in the lower chamber contained 10% FBS (Biological Industries, Beit-Haemek, Israel).

MG63 and Saos-2 cells were suspended in DMEM/F12 at a cell density of 2.5×105 cells/ml for 24 h. After 24 h, cells present on the top of the membrane were cleared using a cotton swab. Cells present on the bottom portion of the membrane were fixed using 4% paraformaldehyde in PBS for 10 min and stained using crystal violet at room temperature for 15 min. Cell invasion was quantified as the average number of cells from 3 inserts present on the bottom portion of the membrane.

Statistical analysis

All data are expressed as the mean ± standard error of the mean. SPSS software (version 13.0; SPSS, Inc., Chicago, IL, USA) was used to analyze all data. Statistical comparison of two groups was performed using a Student's t-test. One-way analysis of variance was also used to compare ≥2 groups. P<0.05 was considered to indicate a statistically significant difference.

Results

MIAT levels are elevated in osteosarcoma

The expression levels of the lncRNA MIAT 6 were investigated in groups of osteosarcoma tissues using RT-qPCR. MIAT levels were decreased in adjacent non-tumor tissues compared with osteosarcoma tissues (Fig. 1A). The lncRNA MIAT expression levels were also investigated in MG63, Saos-2 and OB3 cells and it was identified that MIAT expression was lower in the OB3 cell line than in Saos-2 and MG63 cells (Fig. 1B). These results demonstrate that MIAT levels are potentially associated with osteosarcoma.

MIAT knockdown inhibits the proliferation and invasion of osteosarcoma cells

The function of MIAT in the proliferation and invasion of osteosarcoma cells was examined. Transfection of MG63 and Saos-2 cells with MIAT siRNAs was demonstrated to lower MIAT expression in comparison to control cells (Fig. 2A). CCK8 results indicated that knockdown of MIAT reduced MG63 and Saos-2 cell proliferation compared to cells transfected with siRNAs (Fig. 2B). MIAT knockdown also limited the proliferation and invasion of MG63 and Saos-2 cells (Fig. 2C and D) compared to cells transfected with siRNAs. Taken together, these data reveal that MIAT may promote proliferation and invasion of osteosarcoma cells in vitro.

MIAT promotes ZEB1 expression in osteosarcoma

ZEB1 is important for the proliferation and invasion of osteosarcoma cells (19). Thus, it was investigated whether MIAT affects ZEB1 expression in osteosarcoma cells. First, the association between MIAT and the ZEB1 expression levels was evaluated in 6 samples of tumor-adjacent tissue and osteosarcoma samples by western blotting and RT-qPCR.

It was identified that ZEB1 expression was notably increased in the high MIAT osteosarcoma tissue group compared with that in the low MIAT group (Fig. 3A and B). It was additionally noted that ZEB1 expression levels were decreased in OB3 cells compared with MG63 and Saos-2 cells (Fig. 3C and D). Furthermore, ZEB1 expression levels were evaluated in Saos-2 and MG63 cells transfected with MIAT siRNAs or siNC (negative control) and it was identified that MIAT knockdown by siRNAs resulted in lower ZEB1 expression compared to cells transfected with control siRNAs (Fig. 3E and F).

miR-150-5p is a downstream target of MIAT

To identify the potential downstream miRNA targets of MIAT and its interactions in osteosarcoma, bioinformatics analysis was used (MicroRNA, Starbase version 2.0) to determine the potential complementarity between MIAT and miRNAs. Bioinformatics predictions revealed that the MIAT sequence has four putative miRNA binding sites, including sites for miR-29a-3p, miR-29b-3p, miR-29c-3p, and miR-150-5p-5p. Yan et al (20) previously reported that miR-150-5p-5p focuses on MIAT in endothelial cells, and another study revealed that miR-150-5p suppresses ZEB1 in epithelial ovarian cancer (21). It may be observed that miR-150-5p levels were higher in adjacent non-tumor tissues than in osteosarcoma tissues (Fig. 4A) and lower in MG63 and Saos-2 cells than OB3 cells (Fig. 4B).

To determine whether miR-150-5p targets MIAT, miR-150-5p expression in Saos-2 and MG63 cells transfected with MIAT-siRNA or siNC was examined. The results revealed that miR-150-5p expression was visibly elevated in MG63 and Saos-2 cells transfected with MIAT-siRNA compared to control siRNA (Fig. 5A and B). Rescue experiments were subsequently performed by transfecting miR-150-5p in Saos-2 and MG63 cells. Overexpressing miR-150-5p led to an increase in ZEB1 (Fig. 4C and D). Additionally, inhibiting MIAT limited ZEB1 levels by inhibiting miR-150-5p (Fig. 5A and B). Together, the results demonstrate the importance of MIAT in regulating ZEB1, by controlling miR-150-5p.

miR-150-5p reverses the effects of MIAT in osteosarcoma cells

These results demonstrated that miR-150-5p is a downstream target of MIAT. However, the function of miR-150-5p in the MIAT-mediated influence on osteosarcoma cells remains unclear. To determine whether MIAT may promote proliferation and invasion of osteosarcoma cells via the MIAT-miR-150-5p-ZEB1 axis, further experiments were carried out. RT-qPCR and western blotting revealed that reduced ZEB1 expression by inhibition of MIAT could be largely reversed by AMO-miR-150-5p (Fig. 5). Together, these results suggest that miR-150-5p was able to change the function of MIAT in osteosarcoma cells and that MIAT was able to promote the proliferation and invasion of osteosarcoma cells via the MIAT-miR-150-5p-ZEB1 axis.

Discussion

Osteosarcoma has been considered a common type of basic malignancy of bone and is derived from the progenitor mesenchymal cells of bone-forming cells (22). The morbidity associated with osteosarcoma is high since early diagnosis is difficult, and therapeutic solutions to osteosarcoma are lacking. Therefore, it is important to identify new molecules associated with developing osteosarcomas and develop novel targeted therapy strategies.

Previous studies have demonstrated the role of lncRNAs (23) and the molecular mechanisms through which lncRNAs affect human tumors (2426). However, the mechanism involving the lncRNA MIAT in osteosarcoma has remained unknown. This research shows that highly overexpressed MIAT in cell lines and osteosarcoma tissues may have a monogenic role.

miR-150-5p was first considered as the main miRNA in immune and hematopoietic cells (27). Research has recently shown that specific cellular functions in diverse tumors also involve miR-150-5p (2830). A previous study demonstrated that expression of miR-150-5p was decreased in osteosarcoma cells compared to analogous human normal osteoblasts and cells from normal tissues (31).

MIAT was identified as a target of miR-150-5p with both MIAT and miR-150-5p having an inhibitory effect. These results demonstrate that MIAT may improve tumor progression in osteosarcoma since it can inhibit miR-150-5p and activate ZEB1. The present study demonstrated that in osteosarcoma tissues, MIAT expression was increased compared with the adjacent normal tissues. The present study also identifies that MIAT is important in the development and progression of osteosarcoma. However, the mechanisms associated with MIAT-mediated gene expression in tumorigenesis need to be clarified.

Research has revealed that MIAT acts as a molecular sponge by managing microRNAs in the progression of breast cancer (32). It has been reported that during specific cellular processes, lncRNAs are able to compete with endogenous RNAs to manage microRNAs (33). MIAT may therefore be considered as an endogenous miRNA which controls miR-150-5p-5p and manages its role. Although several potential miRNA binding partners were identified, the present study focused on miR-150-5p, as it has been demonstrated to be important in numerous cancers, including lung (34) and liver cancer (35). The present study revealed that miR-150-5p levels were decreased in the osteosarcoma cell lines MG63 and Saos-2 cells. An opposing association was observed between miR-150-5p and MIAT levels in Saos-2 and MG63 cells, suggesting that there may be an association between miR-150-5p and MIAT to control osteosarcoma cell proliferation and invasion. In addition, miR-150-5p expression decreased ZEB1 levels in Saos-2 cells and MG63. Furthermore, the present data suggested that the MIAT sequence had miR-150-5p sites for binding and implied that miR-150-5p reduced MIAT level by directly binding MIAT. ZEB1 is a master regulator of the EMT phenotype within the progression of cancer (36). The present study demonstrates that by the miR-150-5p/ZEB1 pathway, MIAT may induce EMT phenotype in osteosarcoma cells.

To conclude, the present study revealed that MIAT may be a biomarker for patients with osteosarcoma. It is hypothesized that the MIAT-miR-150-5p-ZEB1 axis may be a potential therapeutic target in osteosarcoma.

Acknowledgements

Not applicable.

Funding

This study was financially supported by Heilongjiang provincial academy of medical sciences (grant no. 201618).

Availability of data and materials

The analyzed datasets generated during the study are available from the corresponding author on reasonable request.

Authors' contributions

HJ performed the flow cytometric analysis and drafted the manuscript. XJ performed cell culture and viral preparation experiments. WC and FD contributed to statistical analyses. ZY, YL and WW designed the study.

Ethics approval and consent to participate

Written informed consent was obtained from all patients. The study was approved by the Research Ethics Committee at Harbin Medical University.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Liu C and Lin J: Long noncoding RNA ZEB1-AS1 acts as an oncogene in osteosarcoma by epigenetically activating ZEB1. Am J Transl Res. 8:4095–4105. 2016.PubMed/NCBI

2 

Mirabello L, Troisi RJ and Savage SA: Osteosarcoma incidence and survival rates from 1973 to 2004: Data from the surveillance, epidemiology, and end results program. Cancer. 115:1531–1543. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Daw NC, Chou AJ, Jaffe N, Rao BN, Billups CA, Rodriguez-Galindo C, Meyers PA and Huh WW: Recurrent osteosarcoma with a single pulmonary metastasis: A multiinstitutional review. Br J Cancer. 112:278–282. 2012. View Article : Google Scholar

4 

Yu L, Liu S, Guo W, Zhang C, Zhang B, Yan H and Wu Z: hTERT promoter activity identifies osteosarcoma cells with increased EMT characteristics. Oncol Lett. 7:239–244. 2014. View Article : Google Scholar : PubMed/NCBI

5 

Sung JY, Park SY, Kim JH, Kang HG, Yoon JH, Na YS, Kim YN and Park BK: Interferon consensus sequence-binding protein (ICSBP) promotes epithelial-to-mesenchymal transition (EMT)-like phenomena, cell-motility, and invasion via TGF-β signaling in U2OS cells. Cell Death Dis. 5:e12242014. View Article : Google Scholar : PubMed/NCBI

6 

Al-Khalaf HH and Aboussekhra A: MicroRNA-141 and microRNA-146b-5p inhibit the prometastatic mesenchymal characteristics through the RNA-binding protein AUF1 targeting the transcription factor ZEB1 and the protein kinase AKT. J Biol Chem. 289:31433–31447. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Putzke AP, Ventura AP, Bailey AM, Akture C, Opoku-Ansah J, Celiktaş M, Hwang MS, Darling DS, Coleman IM, Nelson PS, et al: Metastatic progression of prostate cancer and e-cadherin regulation by zeb1 and SRC family kinases. Am J Pathol. 179:400–410. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Roy BC, Kohno T, Iwakawa R, Moriguchi T, Kiyono T, Morishita K, Sanchez-Cespedes M, Akiyama T and Yokota J: Involvement of LKB1 in epithelial-mesenchymal transition (EMT) of human lung cancer cells. Lung Cancer. 70:136–145. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Shen A, Zhang Y, Yang H, Xu R and Huang G: Overexpression of ZEB1 relates to metastasis and invasion in osteosarcoma. J Surg Oncol. 105:830–834. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Nagano T and Fraser P: No-nonsense functions for long noncoding RNAs. Cell. 145:178–181. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Chen LL and Zhao JC: Functional analysis of long noncoding RNAs in development and disease. Adv Exp Med Biol. 825:129–158. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Zhu HY, Bai WD, Li C, Zheng Z, Guan H, Liu JQ, Yang XK, Han SC, Gao JX, Wang HT and Hu DH: Knockdown of lncRNA-ATB suppresses autocrine secretion of TGF-β2 by targeting ZNF217 via miR-200c in keloid fibroblasts. Sci Rep. 6:247282016. View Article : Google Scholar : PubMed/NCBI

13 

Wu X, He X, Li S, Xu X, Chen X and Zhu H: Long non-coding RNA ucoo2kmd.1 regulates CD44-dependent cell growth by competing for miR-211-3p in colorectal cancer. PLoS One. 11:e01512872016. View Article : Google Scholar : PubMed/NCBI

14 

Wang GQ, Wang Y, Xiong Y, Chen XC, Ma ML, Cai R, Gao Y, Sun YM, Yang GS and Pang WJ: Sirt1 AS lncRNA interacts with its mRNA to inhibit muscle formation by attenuating function of miR-34a. Sci Rep. 6:218652016. View Article : Google Scholar : PubMed/NCBI

15 

Ishii N, Ozaki K, Sato H, Mizuno H, Saito S, Takahashi A, Miyamoto Y, Ikegawa S, Kamatani N, Hori M, et al: Identification of a novel non-coding RNA, MIAT, that confers risk of myocardial infarction. J Hum Genet. 51:1087–1099. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Crea F, Venalainen E, Ci X, Cheng H, Pikor L, Parolia A, Xue H, Saidy Nur NR, Lin D, Lam W, et al: The role of epigenetics and long noncoding RNA MIAT in neuroendocrine prostate cancer. Epigenomics. 8:721–731. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Sha M, Lin M, Wang J, Ye J, Xu J, Xu N and Huang J: Long non-coding RNA MIAT promotes gastric cancer growth and metastasis through regulation of miR-141/DDX5 pathway. J Exp Clin Cancer Res. 37:582018. View Article : Google Scholar : PubMed/NCBI

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Yan H, Zhang B, Fang C and Chen L: miR-340 alleviates chemoresistance of osteosarcoma cells by targeting ZEB1. Anticancer Drugs. 29:440–448. 2018. View Article : Google Scholar : PubMed/NCBI

20 

Yan B, Yao J, Liu JY, Li XM, Wang XQ, Li YJ, Tao ZF, Song YC, Chen Q and Jiang Q: LncRNA-MIAT regulates microvascular dysfunction by functioning as a competing endogenous RNA. Circ Res. 116:1143–1156. 2015. View Article : Google Scholar : PubMed/NCBI

21 

Jin M, Yang Z, Ye W, Xu H and Hua X: MicroRNA-150 predicts a favorable prognosis in patients with epithelial ovarian cancer, and inhibits cell invasion and metastasis by suppressing transcriptional repressor ZEB1. PLoS One. 9:e1039652014. View Article : Google Scholar : PubMed/NCBI

22 

Lulla RR, Costa FF, Bischof JM, Chou PM, de F Bonaldo M, Vanin EF and Soares MB: Identification of differentially expressed MicroRNAs in osteosarcoma. Sarcoma. 2011:7326902011. View Article : Google Scholar : PubMed/NCBI

23 

Orom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, Bussotti G, Lai F, Zytnicki M, Notredame C, Huang Q, et al: Long noncoding RNAs with enhancer-like function in human cells. Cell. 143:46–58. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Barnhill LM, Williams RT, Cohen O, Kim Y, Batova A, Mielke JA, Messer K, Pu M, Bao L, Yu AL and Diccianni MB: High expression of CAI2, a 9p21-embedded long noncoding RNA, contributes to advanced-stage neuroblastoma. Cancer Res. 74:3753–3763. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Nie FQ, Zhu Q, Xu TP, Zou YF, Xie M, Sun M, Xia R and Lu KH: Long non-coding RNA MVIH indicates a poor prognosis for non-small cell lung cancer and promotes cell proliferation and invasion. Tumour Biol. 35:7587–7594. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Zhen L, Yun-Hui L, Hong-Yu D, Jun M and Yi-Long Y: Long noncoding RNA NEAT1 promotes glioma pathogenesis by regulating miR-449b-5p/c-Met axis. Tumour Biol. 37:673–683. 2016. View Article : Google Scholar : PubMed/NCBI

27 

He Y, Jiang X and Chen J: The role of miR-150-5p in normal and malignant hematopoiesis. Oncogene. 33:3887–3893. 2014. View Article : Google Scholar : PubMed/NCBI

28 

Wang X, Ren Y, Wang Z, Xiong X, Han S, Pan W, Chen H, Zhou L, Zhou C, Yuan Q and Yang M: Down-regulation of 5S rRNA by miR-150-5p and miR-383 enhances c-Myc-rpL11 interaction and inhibits proliferation of esophageal squamous carcinoma cells. FEBS Lett. 589:3989–3997. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Liu DZ, Zhang HY, Long XL, Zou SL, Zhang XY, Han GY and Cui ZG: MIR-150-5P promotes prostate cancer stem cell development via suppressing p27Kip1. Eur Rev Med Pharmacol Sci. 19:4344–4352. 2015.PubMed/NCBI

30 

Li J, Hu L, Tian C, Lu F, Wu J and Liu L: microRNA-150 promotes cervical cancer cell growth and survival by targeting FOXO4. BMC Mol Biol. 16:242015. View Article : Google Scholar : PubMed/NCBI

31 

Qu Y, Pan S, Kang M, Dong R and Zhao J: MicroRNA-150 functions as a tumor suppressor in osteosarcoma by targeting IGF2BP1. Tumor Biol. 37:5275–5284. 2016. View Article : Google Scholar

32 

Luan T, Zhang X, Wang S, Wang S, Song Y, Zhou S, Lin J, An W, Yuan W, Yang Y, et al: Long non-coding RNA MIAT promotes breast cancer progression and functions as ceRNA to regulate DUSP7 expression by sponging miR-155-5p. Oncotarget. 8:76153–76164. 2017. View Article : Google Scholar : PubMed/NCBI

33 

Mercer TR, Dinger ME and Mattick JS: Long non-coding RNAs: Insights into functions. Nat Rev Genet. 10:155–159. 2009. View Article : Google Scholar : PubMed/NCBI

34 

Cao M, Hou D, Liang H, Gong F, Wang Y, Yan X, Jiang X, Wang C, Zhang J, Zen K, et al: miR-150-5p promotes the proliferation and proliferation of lung cancer cells by targeting SRC kinase signalling inhibitor 1. Eur J Cancer. 50:1013–1024. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Li T, Xie J, Shen C, Cheng D, Shi Y, Wu Z, Zhan Q, Deng X, Chen H, Shen B, et al: miR-150-5p-5p inhibits hepatoma cell proliferation and invasion by targeting MMP14. PLoS One. 9:e1155772014. View Article : Google Scholar : PubMed/NCBI

36 

Preca BT, Bajdak K, Mock K, Sundararajan V, Pfannstiel J, Maurer J, Wellner U, Hopt UT, Brummer T, Brabletz S, et al: A self-enforcing CD44S/ZEB1 feedback loop maintains EMT and stemness properties in cancer cells. Int J Cancer. 137:2566–2577. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

January 2019
Volume 17 Issue 1

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Jin, H., Jin, X., Chai, W., Yin, Z., Li, Y., Dong, F., & Wang, W. (2019). Long non‑coding RNA MIAT competitively binds miR‑150‑5p to regulate ZEB1 expression in osteosarcoma. Oncology Letters, 17, 1229-1236. https://doi.org/10.3892/ol.2018.9671
MLA
Jin, H., Jin, X., Chai, W., Yin, Z., Li, Y., Dong, F., Wang, W."Long non‑coding RNA MIAT competitively binds miR‑150‑5p to regulate ZEB1 expression in osteosarcoma". Oncology Letters 17.1 (2019): 1229-1236.
Chicago
Jin, H., Jin, X., Chai, W., Yin, Z., Li, Y., Dong, F., Wang, W."Long non‑coding RNA MIAT competitively binds miR‑150‑5p to regulate ZEB1 expression in osteosarcoma". Oncology Letters 17, no. 1 (2019): 1229-1236. https://doi.org/10.3892/ol.2018.9671