Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
July-2019 Volume 18 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2019 Volume 18 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miR‑330‑3p suppresses liver cancer cell migration by targeting MAP2K1

  • Authors:
    • Zhe Jin
    • Baoxing Jia
    • Ludong Tan
    • Yahui Liu
  • View Affiliations / Copyright

    Affiliations: Department of Hepatobiliary and Pancreatic Surgery, The First Affiliated Hospital of Jilin University, Changchun, Jilin 130021, P.R. China
  • Pages: 314-320
    |
    Published online on: April 24, 2019
       https://doi.org/10.3892/ol.2019.10280
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

MicroRNAs, considered as a promising focus for the treatment of tumors, are key regulators of a large number of genes. The aim of the present study was to investigate the biological functions of microRNA (miR)‑330‑3p in liver cancer as it had been identified previously that miR‑330‑3p was deregulated in liver cancer. In order to identify the function of miR‑330‑3p in liver cancer, the expression of miR‑330‑3p was determined in liver cancer tissues and adjacent non‑tumor tissues using reverse transcription‑quantitative polymerase chain reaction analysis. To elucidate the function of miR‑330‑3p in liver cancer, miR‑330‑3p was overexpressed using mimic transfection. Cell migration was inhibited by miR‑330‑3p in liver cancer cells. The miRNA target prediction databases were used to identify potential target genes of miR‑330‑3p in liver cancer. The RNA level of mitogen‑activated protein kinase kinase 1 (MAP2K1) was downregulated by miR‑330‑3p in liver cancer cells. In conclusion, miR‑330‑3p suppresses cell migration by targeting MAP2K1 in liver cancer cells.

Introduction

Liver cancer is the fifth most common type of cancer and the third leading cause of tumor-associated mortality worldwide, being particularly prevalent in Asia (1). The most effective treatment for liver cancer is currently surgery (2). However, the characteristics of liver cancer, including multifocal development or distant metastasis, preclude surgical treatment for the patients from being curative (3). Therefore, in order to determine the biology of liver cancer, it is important to gain a thorough understanding of the underlying molecular mechanisms of tumor growth and metastasis.

Mature microRNAs (miRNAs) are a group of short non-coding RNAs containing between 18 and 26 nucleotides, which, at the post-transcriptional level, regulate target gene expression by targeting the 5′ or 3′-untranslated regions (UTRs) of mRNA (4). miRNAs regulate a number of biological processes, and their dysregulation has been demonstrated to be associated with development, proliferation, stress resistance, metastasis and apoptosis of cancer cells by regulating oncogenes or tumor suppressors (5), including in liver cancer. For example, microRNA (miR)-224 promotes liver cancer proliferation and metastasis (6); conversely, miR-335 (7) and miR-424 (8) suppress liver cancer proliferation and metastasis. Furthermore, miR-330-3p has been identified to be deregulated in malignant liver cancer (9). However, the association of miR-330-3p with liver cancer and its function in liver cancer remains unclear.

In the present study, the function of miR-330-3p in liver cancer was investigated, with the aim of providing new insights into the pathology of liver cancer, which may have value in the development of diagnostics and therapeutics for liver cancer.

Materials and methods

Patient samples

In total, 30 cases of liver cancer samples were collected between May 2012 and April 2015 at The First Hospital of Jilin University (Changchun, China). Prior to surgery, none of the 30 patients received chemotherapy or radiation therapy. Prior to use, the tissue samples were stored in liquid nitrogen. The present study was approved by the ethical committee of the First Affiliated Hospital of Jilin University. Table I presents information concerning patient age, sex, and cancer stage were obtained from patient records.

Table I.

Clinicopathological characteristics of patients with liver cancer and healthy volunteers.

Table I.

Clinicopathological characteristics of patients with liver cancer and healthy volunteers.

Patients with liver cancer (n=30)

CharacteristicBCLC 0 (n=3)BCLC A (n=12)BCLC B (n=5)BCLC C+D (n=10)Normal (n=20)
Clinical factors
  Age, years61.2±9.756.2±8.856.9±8.452.5±11.254.4±12.4
  Sex (male/female)2/110/21/48/214/6
  AST, IU/l48.6±35.756.1±78.254.5±44.667.8±49.311.6±5.4
  ALT, IU/l51.8±47.254.8±83.349.4±33.172.7±58.415.4±8.7
  Child-pugh classification3/011/14/16/420/0
(A/B) (23)
Tumor-associated factors
  AFP, ng/ml148.0±378.3256.5±426.6254.4±405.2789.5±628.76.39±5.85
Tumor number
  (single/multiple)3/011/11/44/6–
  Tumor size, cm32.1±0.53.4±1.26.1±2.37.5±2.7–
  Vascular invasion (−/+)3/012/05/03/7–
  Edmondson grade (I/II/III) (24)0/1/21/9/21/2/21/7/2–

[i] BCLC, Barcelona Clinic Liver Cancer (25); AST, aspartate aminotransaminase; ALT, alanine aminotransferase; AFP, α-fetoprotein.

Cell culture and treatment

The human liver cancer cell line HepG2 were obtained from the American Type Culture Collection (Manassas, VA, USA). HepG2 cells were maintained in Dulbecco's modified Eagle's medium (DMEM; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; HyClone; GE Healthcare, Logan, UT, USA) at 37°C in a humidified atmosphere containing 5% CO2. miR-330-3p mimic (5′-CTGCAGAGAGGCAGCGCTGT-3′) and negative control (NC) (termed as NC, 5′-ACUACUGAGUGACAGUAGA-3′) oligonucleotides were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). Transfection of cells with 50 nM oligonucleotides was carried out using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol.

Target gene prediction and verification

The target genes of miR-330-3p were predicted using three bioinformatics algorithms: PicTar (https://pictar.mdc-berlin.de), miRbase (http://www.mirbase.org) and TargetScan (http://www.targetscan.org). Mitogen-activated protein kinase kinase 1 (MAP2K1) was identified to be downregulated by miR-330-3p, therefore, from human genomic DNA, the full-length 3′UTR of MAP2K1 was amplified and cloned into pMIR-GLOTM luciferase vector (Promega Corporation, Madison, WI, USA) to serve as the wild-type. The mutations were achieved using site-directed mutagenesis QuickChange™ Multi Site-Directed Mutagenesis kit (Clontech Laboratories, Inc., Mountainview, CA, USA). A total of 1×104 HepG2 cells was plated in 48-well plates, and co-transfection was performed using 200 ng wild-type, mutant or pMIR-GLOTM empty vector, and either 80 ng miR-330-3p expression vector or 80 ng pcDNA3.1(+) empty vector. At 48 h after transfection, cells were harvested and were assayed for firefly and Renilla luciferase activity using a Dual-Luciferase Glow assay kit (Promega Corporation) according to the manufacturer's protocol. Overexpression of MAP2K1 was achieved using a pCMV-MAP2K1 expression plasmid. All transfection experiments were conducted in triplicate.

Wound healing assay

For the wound-healing assay, HepG2 cells were collected and trypsinized, followed by seeding equally in 6-well cell culture plates. After 24 h, the cells reached confluence. Using a sterile 100 µl pipette tip, artificial homogeneous wounds in the monolayer were created. The cell culture plate was washed with serum-free DMEM. The wound distance was determined at 0 and 24 h under a reflected-light microscope (magnification, ×40).

Cell migration assay

To determine cell invasion capability, a Transwell assay was used. Prior to the experiment, HepG2 cells were transfected with miR-330-3p mimic or NC oligonucleotides. After 16 h, transfected cells were typsinized and resuspended in DMEM with 10% FBS (Life Technologies; Thermo Fisher Scientific, Inc.), and 1.0×104 cells were placed into the upper chambers (8-µm pore size; EMD Millipore, Billerica, MA, USA) with 200 µl RPMI-1640 medium. The lower chambers were filled with 600 µl DMEM supplemented with 10% FBS. Following incubation at 37°C for 48 h, non-invading cells were removed from the top of the chamber. The migratory cells in the lower chamber were fixed with 90% methyl alcohol at room temperature for 30 min and stained with 0.1% crystal violet. Stained cells in five randomly selected fields were counted under a microscope (magnification, ×200).

To verify the function of MAP2K1 in the suppression of liver cancer cell migration by miR-330-3p, HepG2 cells were transfected with miR-330-3p together with the MAP2K1 expression vector pCMV-MAP2K1. For lentivirus-mediated expression of SNF2H, FLAG-tagged full-length SNF2H ORF was cloned in pWPI.1 (plasmid no. 12254; Addgene, Inc., Cambridge, MA, USA). For RNA interference of SNF2H expression, DNA fragments encoding the hairpin precursors for shSNF2H#1 (5′-CGTCGAATTAAGGCTGATGTT-3′) and shSNF2H#2 (5′-CGACTGCTGATGTAGTAATTT-3′) were inserted into the pLKO.1-TRC cloning vector. A scrambled small interfering RNA precursor (Scr) of similar GC-content to shSNF2H#1 and shSNF2H#2, but without sequence identity to SNF2H cDNA, was used as the control. The MAP2K1 expression vector pCMV-MAP2K1 and miR-330-3p mimic were co-transfected into HepG2 cell using Lipofectamine 2000 (Thermo Fisher Scientific, Inc.). After 48 h, HepG2 cells were collected for the following experiments.

Western blot analysis

HepG2 cells were transfected with miR-330-3p mimic or NC oligonucleotides and incubated at 37°C for 24 h. Total protein was isolated from cell pellets with radioimmunoprecipitation lysis buffer supplemented with Complete protease and phosphatase inhibitor cocktail (Roche Diagnostics, Basel, Switzerland). Proteins (20 µg) were separated by 12% SDS-PAGE. Electrophoretically separated proteins were transferred onto polyvinylidene difluoride membranes (Thermo Fisher Scientific, Inc.). Membranes were blocked with 5% non-fat milk at room temperature for 2 h. Blots were probed for MAP2K1 (1:10,000, cat. no. ab32134; Abcam) and β-actin loading control (1:5,000 cat. no. ab8227; Abcam). Antibodies bound to target proteins were visualized using the Enhanced Chemiluminescence Western Blotting Detection Reagent (Santa Cruz Biotechnology, Dallas, TX, USA). Antibodies bound to target proteins were visualized using the Enhanced Chemiluminescence Western Blotting Detection Reagent (Santa Cruz Biotechnology, Dallas, TX, USA). The images were quantified using the LAS3000 imaging system (Fujifilm Corporation, Tokyo, Japan).

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

HepG2 cells transfected with miR-330-3p mimic or NC oligonucleotides were incubated for 24 h and collected using the mirVana Kit (Ambion Inc., Austin, TX, USA), total RNA was isolated. cDNA was generated using a PrimeScript™ RT-qPCR kit from total RNA and amplified according to the manufacturer's protocol (Takara Biotechnology Co., Ltd., Dalian, China). Amplification was performed with the following thermocycling conditions: 5 min at 95°C, followed by 40 cycles of 95°C for 30 sec and 65°C for 45 sec. Primer sequences are presented in Table II. The expression of the target gene or miRNA was normalized to GAPDH or U6, respectively. Analysis of relative gene expression data was performed using the real-time quantitative PCR and the 2−ΔΔCq method (10).

Table II.

Primer sequence for reverse transcription-quantitative polymerase chain reaction.

Table II.

Primer sequence for reverse transcription-quantitative polymerase chain reaction.

GeneSense primer (5′-3′)Antisense primer (5′-3′)
U6 TGCGGGTGCTCGCTTCGGCA CCAGTGCAGGGTCCGAGGT
β-actin CTCCATCCTGGCCTCGCTGT GCTGTCACCTTCACCGTTCC
miR-330-3p CAACTGCCTCTCTGGGCCTG CTGCAGAGAGGCAGCGCTG
MAP2K1 CAAGAAGAAGCCGACGCCCAT GACGCCAGCAGCATGGGTTG

[i] miR, microRNA; MAP2K1, mitogen-activated protein kinase kinase 1.

Statistical analysis

Results are expressed as the mean ± standard deviation. Each experiment was repeated at least three times. SPSS (version 13.0; SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. The statistical significance of the difference between groups was determined by analysis of variance (two-way ANOVA) with Duncan's post-hoc test) or an unpaired Student's t-test. P≤0.05 was considered to indicate a statistically significant difference.

Results

miR-330-3p is downregulated in patients with liver cancer

In order to determine the expression level of miR-330-3p in liver cancer tissue, mRNAs were extracted from liver cancer tissues and analyzed using RT-qPCR. Compared with normal tissues, the expression of miR-330-3p in liver cancer tissues was significantly decreased (P<0.05; Fig. 1A). The results suggested that deregulation of miR-330-3p was associated with the progression of liver cancer.

Figure 1.

(A) Detection of miR-330-3p expression in liver cancer tissue or non-tumor tissue using the reverse transcription-quantitative polymerase chain reaction. (B) miR-330-3p expression was increased by transfection of miR-330-3p mimic. miR, microRNA. Results are expressed as the mean ± standard deviation for three independent experimental repeats. *P<0.05.

miR-330-3p suppresses migration of liver cancer cells

miR-330-3p expression was significantly upregulated in HepG2 cells by transfection of miR-330-3p mimic (P<0.05; Fig. 1B). As observed in wound healing assays, cell migration was inhibited by the expression of miR-330-3p in HepG2 cells (P<0.01; Fig. 2A). Transwell assays confirmed that overexpression of miR-330-3p significantly inhibited liver cancer cell migration (P<0.05; Fig. 2B).

Figure 2.

(A) Wound healing assay to determine the effect of miR-330-3p on cell migration. (B) A Transwell assay to determine the effect of miR-330-3p on cell migration. Results are expressed as the mean ± standard deviation for three independent experiments. miR, microRNA. **P<0.01, ***P<0.001.

MAP2K1 is post-transcriptionally downregulated by miR-330-3p

To investigate the underlying mechanism by which miR-330-3p inhibits liver cancer cell migration, potential targets of miR-330-3p were identified. As predicted using TargetScan, PicTar and miRanda, MAP2K1 was selected as the candidate for further research owing to its vital functions in tumorigenesis and cancer progression. Wild-type and mutant MAP2K1 3′UTRs were constructed and it was identified that miR-330-3p significantly decreased luciferase activity in HepG2 cells transfected with wild-type MAP2K1 3′UTR (P<0.01; Fig. 3), which was not observed following transfection with mutant 3′UTR.

Figure 3.

(A) Complementarity between miR-330-3p and MAP2K1 sequences. (B) Construction of reporter gene plasmids and point mutation plasmids of MAP2K1 3′UTR. (C) A luciferase reporter assay results demonstrated a significant decrease in the activity of wild-type gene plasmid MAP2K1 3′UTR, but no effect on mutant plasmids. Results are expressed as the mean ± standard deviation. **P<0.01. miR, microRNA; MAP2K1, mitogen-activated protein kinase kinase 1; UTR, untranslated region; hsa, human; Wt, wild-type; Mut, mutant.

Conversely, overexpression of miR-330-3p in liver cancer cells inhibited the expression of MAP2K1 at the mRNA and protein levels (Fig. 4). These results suggested that miR-330-3p regulates the expression of MAP2K1 in liver cancer.

Figure 4.

HepG2 cells were transfected using miR-330-3p mimic or negative control, prior to determining MAP2K1 mRNA and protein expression. Results are expressed as the mean ± standard deviation. *P<0.05. miR, microRNA; MAP2K1, mitogen-activated protein kinase kinase 1. *P<0.05, **P<0.01.

miR-330-3p inhibits liver cancer cell migration by downregulating MAP2K1

To verify the function of MAP2K1 in the suppression of liver cancer cell migration by miR-330-3p, HepG2 cells were transfected with miR-330-3p together with the MAP2K1 expression vector pCMV-MAP2K1. Compared with the control group, an increased number of liver cancer cells transfected with miR-330-3p lost the ability of migration, while cells co-transfected with pCMV-MAP2K1 exhibited increased migration abilities in the Transwell assay (Fig. 5). The results suggested that the increased expression of MAP2K1 contributed to the migratory ability of HepG2 cells.

Figure 5.

Migratory ability of HepG2 cells with the indicated transfections were determined using Transwell assays. Results are expressed as the mean ± standard deviation. *P<0.05. miR, microRNA.

Discussion

Invasion typically leads to metastasis and these events are primary reasons for the poor prognosis of liver cancer (11). For liver cancer, surgical resection is the most effective therapy, but only between 10 and 15% of patients are suitable for surgery; the majority of the remaining patients exhibit distant metastases at diagnosis, which renders curing liver cancer difficult (11,12). Therefore, it is important to identifyfactors vital in invasion and metastasis and the underlying mechanisms. Investigation into miRNAs has led to novel studies to identify the molecular mechanism of cancer cell metastasis (13,14), and therefore the development of potential therapeutics in the treatment of human cancer.

Previous results support a fundamental function of microRNAs in tumor invasion and metastasis; these biological functions are associated with the deregulation of microRNAs in various types of cancer (14). Previous studies have suggested that miR-330-3pis deregulated in the tissues and blood of patients with non-small-cell lung cancer (15). In the present study, it was identified that miR-330-3p was downregulated in patients with liver cancer. Furthermore, miR-330-3p regulates the proliferation and migration of prostate cancer cells (16). These results prompted the investigation of whether miR-330-3p functioned in a similar manner in liver cancer. Therefore, miR-330-3p was restored in liver cancer cells by high efficiency transfection. The results revealed that the migration of liver cancer cells was inhibited by miR-330-3p. By combining the 3′UTRs of target genes, miRNAs were able to regulate many genes. Studies to identify miRNA target genes have identified several novel cancer invasion and metastasis suppressor genes. Identification of new targets involved in the metastasis of liver cancer may lead to novel diagnostic strategies or drug development.

Mitogen-activated protein kinase/extracellular-signal-regulated kinase activation has been reported to be associated with the malignant progression of liver cancer. Overexpression of activated MAP2K1 enhances cancer cell proliferation and confers drug resistance on the cells (17). Using bioinformatic analysis, MAP2K1 was identified as one of the targets of miR-330-3p. It was also observed that upregulation of miR-330-3p in liver cancer cells led to downregulation of MAP2K1 at the RNA and protein levels. The negative regulation of MAP2K1 by miR-330-3p was demonstrated using a luciferase reporter assay. Furthermore, when MAP2K1 and miR-330-3p were knocked down, the migratory ability of HepG2 cells was also inhibited. These results suggested that the function of miR-330-3p in suppressing migration of liver cancer cells was mediated by MAP2K1.

As a number of miRNAs have been reported to be associated with the progression of liver cancer (18–20), those miRNAs may have synergistic or expanded effect on biological behavior of tumor cells. Compared with pure blocking reagent, miRNAs may have an advantage on influencing the tumor microenvironment (21,22). In this regard, the results of the present study provide novel insights into the suppressor function of miR-330-3p and network of miRNAs in liver cancer. The focus of future studies will be on the effect of miR-330-3p in vivo.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contribution

ZJ designed the study, analyzed the data and wrote the manuscript. BJ and LT performed the experiments and prepared the figures. LT and YL collected the clinical specimens and analyzed the clinical data. All authors reviewed the manuscript.

Ethics approval and consent to participate

All protocols dealing with the patients conformed to the ethical guidelines of the Helsinki Declaration and were approved by the ethics committee of First affiliated Hospital of Jilin University. Patients provided written informed consent.

Patient consent for publication

Patients provided consent for the publication of any data and associated images.

Competing interests

The authors declare that they have no competing interests.

References

1 

Ferlay J, Shin HR, Bray F, Forman D, Mathers C and Parkin DM: Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 127:2893–2917. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Forner A, Hessheimer AJ, Isabel Real M and Bruix J: Treatment of hepatocellular carcinoma. Crit Rev Oncol Hematol. 60:89–98. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Jeng KS and Ching HJ: The role of surgery in the management of unusual complications of transcatheter arterial embolization for hepatocellular carcinoma. World J Surg. 12:362–368. 1988. View Article : Google Scholar : PubMed/NCBI

4 

Bartel DP: MicroRNAs: Target recognition and regulatory functions. Cell. 136:215–233. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Ryan BM, Robles AI and Harris CC: Genetic variation in microRNA networks: The implications for cancer research. Nat Rev Cancer. 10:389–402. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Ma D, Tao X, Gao F, Fan C and Wu D: miR-224 functions as an onco-miRNA in hepatocellular carcinoma cells by activating AKT signaling. Oncol Lett. 4:483–488. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Liu H, Li W, Chen C, Pei Y and Long X: MiR-335 acts as a potential tumor suppressor miRNA via downregulating ROCK1 expression in hepatocellular carcinoma. Tumour Biol. 36:6313–6319. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Zhang Y, Li T, Guo P, Kang J, Wei Q, Jia X, Zhao W, Huai W, Qiu Y, Sun L and Han L: MiR-424-5p reversed epithelial-mesenchymal transition of anchorage-independent HCC cells by directly targeting ICAT and suppressed HCC progression. Sci Rep. 4:62482014. View Article : Google Scholar : PubMed/NCBI

9 

Chen J, Wu X, Cai B, Su Z, Li L, An Y and Wang L: Circulating microRNAs as potential biomarkers of HBV infection persistence. Infect Genet Evol. 54:152–157. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Kenneth J and Livak TD: Analysis of relative gene expression data using rea l&mdash;time quantitative PCR a nd the 2 □ ct method. Method. 2001.

11 

Vitali GC, Laurent A, Terraz S, Majno P, Buchs NC, Rubbia-Brandt L, Luciani A, Calderaro J, Morel P, Azoulay D and Toso C: Minimally invasive surgery versus percutaneous radio frequency ablation for the treatment of single small (</=3 cm) hepatocellular carcinoma: A case-control study. Surg Endosc. 30:2301–2307. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Xiong W, Sun LP, Chen XM, Li HY, Huang SA and Jie SH: Comparison of microRNA expression profiles in HCC-derived microvesicles and the parental cells and evaluation of their roles in HCC. J Huazhong Univ Sci Technolog Med Sci. 33:346–352. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Deng S, Calin GA, Croce CM, Coukos G and Zhang L: Mechanisms of microRNA deregulation in human cancer. Cell Cycle. 7:2643–2646. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Dinkova-Kostova AT, Jenkins SN, Fahey JW, Ye L, Wehage SL, Liby KT, Stephenson KK, Wade KL and Talalay P: Protection against UV-light-induced skin carcinogenesis in SKH-1 high-risk mice by sulforaphane-containing broccoli sprout extracts. Cancer Lett. 240:243–252. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Wei CH, Wu G, Cai Q, et al: MicroRNA-330-3p promotes cell invasion and metastasis in non-small cell lung cancer through GRIA3 by activating MAPK/ERK signaling pathway. J Hematol Oncol. 10:1252017. View Article : Google Scholar : PubMed/NCBI

16 

Mao Y, Chen H, Lin Y, Xu X, Hu Z, Zhu Y, Wu J, Xu X, Zheng X and Xie L: microRNA-330 inhibits cell motility by downregulating Sp1 in prostate cancer cells. Oncol Rep. 30:327–333. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Huynh H, Nguyen TT, Chow KH, Tan PH, Soo KC and Tran E: Over-expression of the mitogen-activated protein kinase (MAPK) kinase (MEK)-MAPK in hepatocellular carcinoma: Its role in tumor progression and apoptosis. BMC Gastroenterol. 3:192003. View Article : Google Scholar : PubMed/NCBI

18 

Liang HH, Wei PL, Hung CS, Wu CT, Wang W, Huang MT and Chang YJ: MicroRNA-200a/b influenced the therapeutic effects of curcumin in hepatocellular carcinoma (HCC) cells. Tumour Biol. 34:3209–3218. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Chen X, Zhang L, Zhang T, Hao M, Zhang X, Zhang J, Xie Q, Wang Y, Guo M, Zhuang H and Lu F: Methylation-mediated repression of microRNA 129-2 enhances oncogenic SOX4 expression in HCC. Liver Int. 33:476–486. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Zhang D, Zhou P, Wang W, Wang X, Li J, Sun X and Zhang L: MicroRNA-616 promotes the migration, invasion and epithelial-mesenchymal transition of HCC by targeting PTEN. Oncol Rep. 35:366–374. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Paiva I, Gil da Costa RM, Ribeiro J, Sousa H, Bastos MM, Faustino-Rocha A, Lopes C, Oliveira PA and Medeiros R: MicroRNA-21 expression and susceptibility to HPV-induced carcinogenesis-role of microenvironment in K14-HPV16 mice model. Life Sci. 128:8–14. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Paiva I, Gil da Costa RM, Ribeiro J, Sousa H, Bastos M, Faustino-Rocha A, Lopes C, Oliveira PA and Medeiros R: A role for microRNA-155 expression in microenvironment associated to HPV-induced carcinogenesis in K14-HPV16 transgenic mice. PLoS One. 10:e01168682015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Jin Z, Jia B, Tan L and Liu Y: miR‑330‑3p suppresses liver cancer cell migration by targeting MAP2K1. Oncol Lett 18: 314-320, 2019.
APA
Jin, Z., Jia, B., Tan, L., & Liu, Y. (2019). miR‑330‑3p suppresses liver cancer cell migration by targeting MAP2K1. Oncology Letters, 18, 314-320. https://doi.org/10.3892/ol.2019.10280
MLA
Jin, Z., Jia, B., Tan, L., Liu, Y."miR‑330‑3p suppresses liver cancer cell migration by targeting MAP2K1". Oncology Letters 18.1 (2019): 314-320.
Chicago
Jin, Z., Jia, B., Tan, L., Liu, Y."miR‑330‑3p suppresses liver cancer cell migration by targeting MAP2K1". Oncology Letters 18, no. 1 (2019): 314-320. https://doi.org/10.3892/ol.2019.10280
Copy and paste a formatted citation
x
Spandidos Publications style
Jin Z, Jia B, Tan L and Liu Y: miR‑330‑3p suppresses liver cancer cell migration by targeting MAP2K1. Oncol Lett 18: 314-320, 2019.
APA
Jin, Z., Jia, B., Tan, L., & Liu, Y. (2019). miR‑330‑3p suppresses liver cancer cell migration by targeting MAP2K1. Oncology Letters, 18, 314-320. https://doi.org/10.3892/ol.2019.10280
MLA
Jin, Z., Jia, B., Tan, L., Liu, Y."miR‑330‑3p suppresses liver cancer cell migration by targeting MAP2K1". Oncology Letters 18.1 (2019): 314-320.
Chicago
Jin, Z., Jia, B., Tan, L., Liu, Y."miR‑330‑3p suppresses liver cancer cell migration by targeting MAP2K1". Oncology Letters 18, no. 1 (2019): 314-320. https://doi.org/10.3892/ol.2019.10280
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team