International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.
International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.
Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.
Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.
Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.
Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.
Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.
International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.
Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.
Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.
Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.
An International Open Access Journal Devoted to General Medicine.
Severe acute respiratory syndrome-coronavirus nonstructural protein-10 (SARS-CoV nsp-10) is the main transcriptase of SARS that cleaves polyproteins orf1a (187–260 kDa) and orf1b (345–422 kDa) during infection (1). Human embryo lung cellular protein interacting with SARS-CoV nsp-10 (HEPIS) is a novel gene that was previously isolated from a cDNA library of human embryonic lung tissue and the protein it encodes interacts with SARS-CoV nsp10 (2). The HEPIS gene is expressed as two different isoforms, isoform A and isoform B, which are 220 and 147 amino acids long, respectively (2,3). Previously, it was demonstrated that HEPIS is differentially expressed in ten different types of cancer, including stomach, liver, and prostate cancer (4). Furthermore, the transcription factors Oct-1, NF-κB and C-Jun are associated with transcriptional regulation of the HEPIS gene (4). Breast cancer is one of the most common malignancies affecting women worldwide (5,6), with the incidence of 92.8 per 100,000 women in western Europe in 2018 (7). Breast cancer progression is a complex process comprising cell cycle dysregulation (8) and metastasis to distant organs (9). A variety of steroid hormones, such as estrogen and progesterone (10), and the expression of specific genes, such as zinc finger E-box-binding homeobox 1 and matrix metallopeptidases (9), have been attributed to the growth and metastasis of breast cancer cells. A previous study showed that the transcription factor Zinc finger E-box-binding homeobox 1 regulates the expression of the p21 and CDK4 genes to promote breast cancer cell proliferation (11). Bone morphogenetic protein 6 has been found to inhibit breast cancer cell proliferation by targeting microRNA-192 and its direct target RB transcriptional corepressor 1 (12). Clinically, therapeutic interventions for the growth and metastasis of breast cancer remain limited. Our previous study demonstrated that the expression of HEPIS was significantly higher in T-47D compared with ZR-75-30, MDA-MB-231 and MCF-7 cells (4). However, the function of HEPIS in breast cancer cell proliferation has not yet been elucidated, and the elucidation of such a mechanism may provide novel approaches for therapy.
In order to reveal the role of HEPIS in the development of breast cancer, the function of HEPIS in MCF-7 cell proliferation and the regulated genes of HEPIS was investigated in the present study. Our results may provide a basis for establishing a more effective treatment strategy for breast cancer.
Full-length HEPIS isoform A and B coding sequence (CDS) was amplified from MCF-7 cDNA using PCR with the following primers: Forward, 5′-TTCAAGCTTATGTCTGCCCATATGTCAGG-3′ and reverse, 5′-TAAGGATCCGTCACAGGATTTCTCTAAGTCT-3′. The PCR fragments were run on an agarose gel, photographed, recovered, digested with HindIII (AAGCTT) and BamHI (GGATCC) and cloned into the pEGFP-C3 vector (BD Biosciences). pEGFP-C3-HEPISa plasmid contained the CDS sequence of HEPIS isoform A, whereas pEGFP-C3-HEPISb plasmid contained the CDS sequence of HEPIS isoform B.
The partial human HEPIS CDS was amplified from MCF-7 cDNA using PCR with the following primers: Forward, 5′-ATACTCGAGGAAGTGGAGCAGGATGTA-3′ and reverse, 5′-ATAGCGGCCGCTCAGTCACAGGATTTCTC-3′, and the PCR fragments were cloned into the psiCHECK™−2 (Promega Corporation) vector using XhoI (CTCGAG) and NotI (GCGGCCGC) restriction sites. This partial human HEPIS CDS sequence contained the targeting site of the small interfering (si)RNAs described below.
The target siRNA sequences for human HEPIS were 5′-GATGCTAACCTCCAAGTTT-3′, 5′-GCAAGCAGCAGAAGAGAAA-3′ and 5′-AGTTTAGTCCTGCAGAGAT-3′. These oligonucleotides were annealed and ligated into pSilencer 4.1-CMVneo (Ambion; Thermo Fisher Scientific, Inc.) to construct HEPIS-specific siRNA expression plasmids siHEPIS-1, siHEPIS-2, and siHEPIS-3, respectively, according to the manufacturer's protocol. pSilencer 4.1-CMVneo expressing scrambled siRNA (Ambion; Thermo Fisher Scientific, Inc.) was used as si-control.
HeLa and MCF-7 cells (ATCC) were maintained in high glucose DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (FBS; HyClone; GE Healthcare Life Sciences), penicillin (100 U/ml) and streptomycin (100 U/ml) and incubated at 37°C with 5% CO2.
HeLa and MCF-7 cells were transfected with plasmid using Lipofectamine™ 2000 (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol.
HeLa cells were seeded at a density of 1×104 cells/well in 96-well plates, after 24 h of culture, the cells were transfected with 200 ng/well pEGFP-C3-HEPISa, pEGFP-C3-HEPISb, or pEGFP-C3 for subcellular localization. HeLa cells were seeded at a density of 7×104 cells/well in 24-well plates. After 24 h of culture, the cells were transfected with 800 ng/well pEGFP-C3, pEGFP-C3-HEPISa or pEGFP-C3-HEPISb plasmids for reverse transcription-quantitative PCR (RT-qPCR).
MCF-7 cells were seeded at a density of 1×104 cells/well in 96-well plates. After 24 h of culture, the cells were co-transfected with 100 ng/well of either si-control, siHEPIS-1, siHEPIS-2 or siHEPIS-3 and 100 ng/well psiCHECK™-2-HEPIS for silencing target site selection; the cells were transfected with 200 ng/well pEGFP-C3-HEPISa, pEGFP-C3-HEPISb, pEGFP-C3, siHEPIS-3 or si-control for Cell Counting Kit-8 (CCK-8) assay; the cells were co-transfected with 80 ng/well of pEGFP-C3-HEPISa, pEGFP-C3-HEPISb, pEGFP-C3, siHEPIS-3 or si-control, 80 ng/well of pNF-κB-Luc and 40 ng/well pRL-TK for Dual-luciferase reporter (DLR) assay.
MCF-7 cells were seeded at a density of 7×104 cells/well in 24-well plates. After 24 h of culture, the cells transfected with 800 ng/well pEGFP-C3, pEGFP-C3-HEPISa, pEGFP-C3-HEPISb, si-control or siHEPIS-3 plasmids for 5-Ethynyl-2′-deoxyuridine (EdU) cell proliferation assay and RT-qPCR; the cells were transfected with 800 ng/well of either pEGFP-C3-HEPISa, pEGFP-C3-HEPISb or pEGFP-C3 for western blotting. The cells were transfected with 800 ng/well of either pEGFP-C3-HEPISa or pEGFP-C3 for gene chip assay.
The transmembrane domain of HEPIS was predicted by Transmembrane Hidden Markov Model (TMHMM) Server v.2.0 (http://www.cbs.dtu.dk/services/TMHMM/).
HeLa cells were transfected as aforementioned. At 24 h post-transfection, the cells were stained with DAPI for 30 mins at 37°C, and visualized under an inverted fluorescent microscope as described previously (13).
MCF-7 cells were transfected with EGFP-C3-HEPISa, pEGFP-C3-HEPISb or pEGFP-C3 as aforementioned. At 24 h post-transfection, western blotting was performed as described previously (14). Primary antibodies specific for GFP (cat. no. SC-8334; Santa Cruz; 1:1,000 dilution) and β-actin (cat. no. ab8227; Abcam; 1:1,000 dilution) and a secondary antibody Goat Anti-Rabbit IgG H&L (HRP) (cat. no. ab6721; Abcam; 1:10,000 dilution) were used.
MCF-7 cells were transfected with the psiCHECK™-2 vector as aforementioned. At 24 h, the cells were lysed and cell lysates were assayed for firefly and Renilla luciferase activity using a Dual-Luciferase Reporter Assay System (Promega Corporation) according to the manufacturer's protocol. Renilla luciferase activity was normalized to firefly luciferase activity. Experiments were performed in triplicate.
MCF-7 cells were transfected as aforementioned. At 24 h, the cells were seeded into 96-well plates at a density of 2×103 cells/well, with six replicates per experiment. The CCK-8 assay (Dojindo Molecular Technologies, Inc.) was performed 1, 2, 3, 4 and 5 days after transfection as described previously (13).
For the EdU assay, MCF-7 cells were transfected as aforementioned. The cells were incubated with 50 µM EdU at 37°C for 1 h 48 h after transfection. The cells were fixed with 4% paraformaldehyde at 37°C for 30 min and stained with 5 mg/ml Hoechst as described previously (12). Images were captured and EdU-positive cells were calculated as described previously (12).
The pNF-κB-Luc reporter plasmid (PathDetect; Agilent Technologies, Inc.) contains the NF-κB response element, GGGAATTTCCGGGAATTTCCGGGAACCGGATTGACCGGCCATGGCGATCGCCCTTAAAGGCCCTTAAAGGCCCTTTTTCCGGGAATTTCC, which was cloned into the 3′UTR of firefly luciferase. pNF-κB-Luc was therefore used to measure transcriptional activity of NF-κB. The internal control pRL-TK plasmid contained the Renilla luciferase gene (Promega Corporation). MCF-7 cells transfected with as aforementioned. At 24 h post-transfection, the DLR assay was performed using Dual-Luciferase Reporter Assay System (Promega Corporation) according to the manufacturer's protocol. Firefly luciferase activity was normalized to Renilla luciferase activity.
An RNA microarray containing samples from 39 cases of breast cancer and matching adjacent normal tissue was obtained from Shanxi Chaoying Biotechnology Co., Ltd. (cat. no. BR804a). An antisense probe with a sequence matching part of HEPIS was used: 5′-FITC-TCTGCCCATATGTCAGGATTGGAAATAATGGAT-3′. Hybridization was performed as previously described (15). DAPI was used as the counterstain. The stained cells were visualized and images were captured using a laser scanning confocal microscope under consistent excitation wavelength among all groups. The results of the staining were analyzed using ImageJ software version 1.46 (National Institutes of Health).
MCF-7 cells were transfected as aforementioned. After 48 h of transfection, RNA was extracted using TRIzol (cat. no. 15596-018; Invitrogen; Thermo Fisher Scientific, Inc.), and further purified using an RNeasy mini kit (cat. no. 74106) and RNase-Free DNase set (cat. no. 79254; both Qiagen GmbH). Total RNA was amplified and labeled using the low input quick amp labeling kit, one-color (cat. no. 5190-2305; Agilent Technologies, Inc.), according to the manufacturer's protocol. Labeled complementary RNA (cRNA) was purified using the RNeasy mini kit (cat. no. 74106; Qiagen GmbH) as previously described (16). Each slide (Agilent SurePrint G3 Human Gene Expression Microarray 8×60K) was hybridized with 600 ng Cy3-labeled cRNA using a hybridization kit (cat. no. 5188-5242) and washed in staining dishes with wash buffer kit (cat. no. 5188-5327; all Agilent Technologies, Inc.) 17 h after hybridization, according to the manufacturer's instructions. Slides were scanned using an Agilent microarray scanner (cat. no. G2565CA; Agilent Technologies, Inc.) with the following default settings: Dye channel, green; scan resolution, 3 µm; photomultiplier tube, 100%, color depth, 16 bit. Data were extracted using Feature Extraction software v10.7 (Agilent Technologies, Inc.). Raw data were normalized using the quantile algorithm, limma packages in R version 3.5.3 (http://www.R-project.org/) (17). Two samples were used for gene chip assay.
Differentially expressed mRNAs were identified as |log2(fold change)|≥2 and P<0.05. GO enrichment (http://geneontology.org, release number 2019-01-01) and KEGG pathway (http://www.genome.jp/kegg, release number 91.0, July 2019) analysis of the differentially expressed mRNAs were performed as described previously (18).
MCF-7 and HeLa cells were transfected as aforementioned and 24 h after transfection, the RNA was extracted using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) and purified using RNeasy mini kit (Qiagen GmbH). Total RNA (0.5 µg) from each sample was used for first-strand cDNA synthesis using M-MLV reverse transcription kit (Promega Corporation) according to the manufacturer's protocol. The specific products of human HEPIS were amplified using qPCR with the following primers: HEPIS forward, 5′-GCCAAAGCCCAGTGTTAAAAG-3′ and reverse, 5′-GGAGGTTAGCATCACATTGTCA-3′; and GAPDH forward, 5′-TGACTTCAACAGCGACACCCA-3′ and reverse, 5′-CACCCTGTTGCTGTAGCCAAA-3′. GAPDH was used as an internal control.
MCF-7 cells were transfected with pEGFP-C3-HEPISa or pEGFP-C3 as aforementioned, and 24 and 48 h after transfection, RNA extraction, purification and reverse transcription were performed as aforementioned. Specific products of human interleukin 2 receptor subunit α (IL2RA), interferon α and β receptor subunit 2 (IFNAR2) and IFNA8 genes were amplified using qPCR using the following primers: IL2RA forward, 5′-GGCAGCGGAGACAGAGGAA-3′ and reverse, 5′-CCTGGGCGACCATTTAGC-3′; IFNAR2 forward, 5′-TGATAGCGATACTGAGGC-3′ and reverse, 5′-CTGGGATTCTGTAGAGGTG-3′; and IFNA8 forward 5′-GACTCATCTGCTGCTTTG-3′ and reverse, 5′-GAATCATTTCCGTGTTGTA-3′. GAPDH was used as an internal control.
Universal PCR Max Mix (Applied Biosystems) was used for qPCR, according to the manufacturer's protocol QPCR was performed using the following thermocycling conditions: 94°C for 15 sec, 60°C for 15 sec and 72°C for 15 sec for 40 cycles. Quantification was performed using the 2−ΔΔCq method as described previously (19).
Data are presented as the mean ± standard deviation. SPSS v9.0 software (SPSS, Inc.) was used for statistical analysis. The data of RT-qPCR and EdU cell proliferation assay were analyzed using Student's t-test, the CCK-8 data were analyzed using one-way ANOVA followed by a Dunnett's post hoc test. Optical density or integrated optical density of breast cancer or normal breast tissue was analyzed using Student's t-test. P<0.05 was considered to indicate a statistically significant difference. Data represent three independent experiments.
HEPIS exists in two different isoforms, A and B. PCR was performed to determine the expression levels of the A and B isoforms in MCF-7 cells. The results revealed that both the isoforms were expressed in MCF-7 cells. Isoform A was the most abundant form of HEPIS, based on the intensity of the band (Fig. 1A). Isoforms A and B consist of 220 and 147 amino acids, respectively (Fig. 1B), with predicted molecular masses of 28 and 18 kDa, respectively. Protein analyses on TMHMM revealed that the HEPIS protein has no predicted transmembrane domain, suggesting that it may be a soluble protein. To determine its subcellular localization, cDNAs of both the isoforms were fused to GFP in the pEGFP-C3 vector and transfected into HeLa cells. Overexpression of HEPISa and HEPISb was confirmed using qPCR (Fig. 1C). HEPISa-GFP and HEPISb-GFP fusion proteins were primarily expressed in the cytoplasm of HeLa cells (Fig. 1D). Results of the western blot analysis revealed that pEGFP-C3-HEPISa expressed a 55-kDa HEPISa-GFP fusion protein, and pEGFP-C3-HEPISb plasmids expressed a 45-kDa HEPISb-GFP fusion protein in MCF-7 cells (Fig. 1E).
In our previous study, it was reported that HEPIS was differentially expressed in T-47D, ZR-75-30, MDA-MB-231 and MCF-7 breast cancer cell lines (4). In the present study, RNA in situ hybridization was performed using a tissue microarray containing breast cancer tissue and adjacent normal tissue from 39 cases to study the expression of HEPIS. HEPIS-positive staining was primarily found in the cytoplasm of case 2 (Fig. 2). The integrated optical density of HEPIS was significantly lower (P<0.05) in malignant breast cancer tissue compared with the adjacent normal breast tissue (Table I).
A previous study reported that HEPIS reduces the proliferation of HeLa cell (2). To assess the effect of HEPIS on the proliferation of breast cancer cells, MCF-7 cells were transfected with the HEPIS-expressing plasmids pEGFP-C3-HEPISa or pEGFP-C3-HEPISb, and a CCK-8 assay was performed. As shown in Fig. 3A, the results of the CCK-8 assay indicated that overexpression of both isoforms of HEPIS in MCF-7 cells significantly decreased the cell proliferation compared with MCF-7 cells transfected with empty vector controls. To test the effect of knockdown of endogenous HEPIS expression on MCF-7 cell proliferation, three different siRNA plasmids which targeted human HEPIS were constructed (siHEPIS-1, siHEPIS-2 and siHEPIS-3), and the ability of these three plasmids to inhibit HEPIS gene expression using a DLR assay with the psiCHECK™-2 vector was performed. The results revealed that HEPIS expression was lowest in cells transfected with siHEPIS-3 (Fig. 3B). Results of the qPCR analysis showed that overexpression of siHEPIS-3 significantly reduced the expression of HEPIS at the transcriptional level (Fig. 3C). As shown in Fig. 3D, the knockdown of HEPIS by siHEPIS-3 significantly increased the number of MCF-7 cells compared with the control, confirming that HEPIS has a growth-inhibiting effect on MCF-7 cells. Furthermore, the results of the EdU proliferation assay revealed that overexpression of both isoforms of HEPIS decreased the number of cells in the S phase from 51.2 to 38.1% (HEPISa) or 36.3% (HEPISb) (Fig. 3E). In contrast, HEPIS knockdown resulted in a marked increase in the number of cells in the S phase, showing an increase from 47.1 to 63.8% (Fig. 3F). Based on the above results, it was confirmed that HEPIS inhibits MCF-7 cell proliferation.
The DLR assay was performed to further identify the potential cellular pathways regulated by HEPIS, which revealed that the two isoforms of HEPIS overexpression significantly inhibited the NF-kB reporter gene in MCF-7 cells compared with the control group (Fig. 4A). By contrast, HEPIS knockdown resulted in a significant increase in NF-κB reporter gene activity (Fig. 4B).
To understand the molecular changes following HEPIS overexpression, gene chip analysis was performed to identify the mRNAs that were differentially expressed between the HEPIS-overexpressing MCF-7 cells and control cells. Results of the gene chip assay showed that 2,231 genes were differentially expressed in HEPIS-overexpressing cells, including 1,095 genes that were upregulated and 1,136 that were downregulated (Fig. 5A). The differentially expressed genes were analyzed using GO enrichment and KEGG pathway analysis. Top 10 significant enrichment pathways from GO enrichment analysis included ‘transmembrane receptor protein serine/threonine kinase activity’ and ‘regulation of T cell tolerance induction’, among others (Table II). Top 15 significant enrichment pathways from KEGG pathways are listed in Table III and included ‘mitogen-activated protein kinase (MAPK) signaling pathway’, ‘Janus kinase-signal transducer and activator of transcription (JAK-STAT) signaling pathway’, ‘focal adhesion’ and others. The IL2RA, IFNAR2, and IFNA8 genes were selected for qPCR analysis, as they were enriched in the JAK-STAT signaling pathway, from the KEGG enrichment analysis. qPCR results confirmed that the mRNA levels of these three genes were downregulated in HEPIS-overexpressing MCF-7 cells compared with that in the pEGFP-C3 group at 24 and 48 h post-transfection (Fig. 5B).
Previously, the HEPIS isoform B has been identified as 147 amino acid long protein with several casein kinase II phosphorylation sites (2). In the present study, HEPIS isoforms A and B were both found to be expressed in MCF-7 cells. Of these, isoform A was the more abundantly expressed isoform. Similar to the present study, a previous study also showed that overexpression of HEPIS isoform B reduced the proliferation of HeLa cells (2). In the present study, it was demonstrated that overexpression of both HEPIS isoforms significantly inhibited cell cycle progression in MCF-7 breast cancer cells by inhibiting G1-S transition, and RNA interference targeting HEPIS exhibited resulted in increased cell cycle progression, confirming the potential role of HEPIS in the regulation of cell proliferation. Our group previously reported that HEPIS expression was significantly increased in four breast cancer cell lines: T-47D, ZR-75-30, MDA-MB-231, and MCF-7 (4). In addition, the HEPIS expression levels were 8-fold higher in the T-47D cell line compared with that in the MCF-7 cell line (4). Cell proliferation is a complex process that is regulated by multiple genes, such as c-Myc and cyclin D1 (8). The difference in expression of the HEPIS gene does not completely determine the growth rate of MCF-7 and T-47D cells. HEPIS in esophageal squamous cell carcinoma exhibits upregulated expression compared with adjacent normal tissue, whereas in rectal adenocarcinoma, the reverse has been observed; therefore HEPIS may possess varying functions in different types of cancer, due to each cancer having its own complex mechanism (4). In the present study HEPIS expression was down-regulated in breast cancer tissue compared with the adjacent normal tissue.
NF-κB belongs is a member the Rel/NF-κB family, and it is a hetero- or homo-dimeric transcription factor (20,21). NF-κB serves a vital role in cell proliferation and apoptosis (20,22). The results of the present study demonstrated that HEPIS inhibits the activity of the NF-κB reporter gene. HEPIS may serve an important role by regulating NF-κB signal pathway.
The JAK-STAT signaling pathway transmits information from extracellular signals, including a wide array of cytokines (IFN-α, IFN-γ, etc.) and growth factors (epidermal growth factor, platelet-derived growth factor, etc.) (23). This pathway plays a role in proliferation, migration and apoptosis (24,25), and disruption or dysregulation of this pathway can result in prostate cancer (26) or breast cancer (27). MAPKs are a highly conserved family of serine/threonine protein kinases, and are involved in different cellular processes, such as proliferation, survival, apoptosis, differentiation, motility and development (28). ERK, JNK/stress-activated protein kinase, and p38 are three major MAPK families that serve important roles in tumor progression in breast cancer (29,30). KEGG pathway analysis showed that the differentially expressed genes, which were regulated by HEPIS, were functionally enriched in the MAPK and JAK-STAT signaling pathways. Therefore, HEPIS may regulate the progression of breast cancer by influencing the MAPK and JAK-STAT signaling pathways.
The IL-2/IL-2 receptor pathway is involved in the regulation of carcinoma cell proliferation, and endogenous IL-2 promotes growth and protects tumor cells from apoptosis (31). IFN/IFNAR2 leads to the phosphorylation of JAK/STAT and gene induction, as well as antiviral and antiproliferative cellular responses (32). In the present study, qPCR results revealed that IL2RA and IFNAR2 were downregulated by HEPIS. Therefore, HEPIS may inhibit MCF-7 cell proliferation by regulating IL2RA and IFNAR2.
In conclusion, the results showed that HEPIS is primarily expressed in the cytoplasm of MCF-7 cells and inhibits the activity of the NF-κB reporter gene. Furthermore, the novel function of HEPIS was revealed as a proliferation inhibitor in breast cancer progression. Results from the gene chip analysis revealed that 2,231 genes were differentially expressed in the HEPIS overexpression group; these genes were enriched in the MAPK and JAK-STAT signaling pathways. The differential expression of the IL2RA, IFNAR2, and IFNA8 genes was confirmed using qPCR. Together, HEPIS may represent a novel target molecule for repression of breast cancer progression.
Not applicable.
This study was supported by grants from the General Higher Education Young Talents Program of Hebei Province (grant no. BJ2014027) and the Natural Science Foundation of Hebei Province (grant nos. H2018209140 and C2017209062).
The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.
FH, YZ, and ML performed the in vitro experiments. YZ and YB analyzed the gene chip data. XZ performed the RNA in situ hybridization. FH and XZ were major contributors in writing the manuscript. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
|
Sawicki SG, Sawicki DL, Younker D, Meyer Y, Thiel V, Stokes H and Siddell SG: Functional and genetic analysis of coronavirus replicase-transcriptase proteins. PLoS Pathog. 1:e392005. View Article : Google Scholar : PubMed/NCBI | |
|
Hong M, Li W, Wang L, Jiang L, Liu L, Zhao H and Li Q: Identification of a novel transcriptional repressor (HEPIS) that interacts with nsp-10 of SARS coronavirus. Viral Immunol. 21:153–162. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Huttlin EL, Ting L, Bruckner RJ, Gebreab F, Gygi MP, Szpyt J, Tam S, Zarraga G, Colby G, Baltier K, et al: The BioPlex Network: A systematic exploration of the human interactome. Cell. 162:425–440. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Hu F and Zhang Y: Expression profile and promoter analysis of HEPIS. Exp Ther Med. 15:569–575. 2018.PubMed/NCBI | |
|
Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ and Clarke MF: Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci USA. 100:3983–3988. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Proceedings of the National Academy of Sciences of the United States of America, . Annual subject and author indexes. Proc Natl Acad Sci USA. 87 (Suppl):S10069–S10240. 1990. | |
|
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394–424. 2018. View Article : Google Scholar : PubMed/NCBI | |
|
Pike MC, Spicer DV, Dahmoush L and Press MF: Estrogens, progestogens, normal breast cell proliferation, and breast cancer risk. Epidemiol Rev. 15:17–35. 1993. View Article : Google Scholar : PubMed/NCBI | |
|
Braun S and Harbeck N: Molecular markers of metastasis in breast cancer: Current understanding and prospects for novel diagnosis and prevention. Expert Rev Mol Med. 3:1–14. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Darbre PD and King RJ: Steroid hormone regulation of cultured breast cancer cells. Cancer Treat Res. 40:307–341. 1988. View Article : Google Scholar : PubMed/NCBI | |
|
Hu F, Wang C, Du J, Sun W, Yan J, Mi D, Zhang J, Qiao Y, Zhu T and Yang S: DeltaEF1 promotes breast cancer cell proliferation through down-regulating p21 expression. Biochim Biophys Acta. 1802:301–312. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Hu F, Meng X, Tong Q, Liang L, Xiang R, Zhu T and Yang S: BMP-6 inhibits cell proliferation by targeting microRNA-192 in breast cancer. Biochim Biophys Acta. 1832:2379–2390. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Hu F, Gou L, Liu Q, Zhang W, Luo M and Zhang X: G-patch domain containing 2, a gene highly expressed in testes, inhibits nuclear factor-KB and cell proliferation. Mol Med Rep. 11:1252–1257. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Liu Q, Song YJ, Meng LJ, Hu F, Gou LX, Jia CH, Tang HM, Wang WJ, Li M, Zhang XJ and Jia MC: Role of LM23 in cell proliferation and apoptosis and its expression during the testis development. Asian J Androl. 15:539–544. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Hu F, Yang S, Lv S, Peng Y, Meng L, Gou L and Zhang X: Analysis of AC3-33 gene expression in multiple organ cancer and adjacent normal tissue by RNA in situ hybridization. Oncol Lett. 9:2795–2798. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Zhao F, Pan S, Gu Y, Guo S, Dai Q, Yu Y and Zhang W: Small activating RNA restores the activity of the tumor suppressor HIC-1 on breast cancer. PLoS One. 9:e864862014. View Article : Google Scholar : PubMed/NCBI | |
|
R Core Team, . R: A language and environment for statistical computingR Foundation for Statistical Computing; Vienna, Austria: 2012, https://www.R-project.org | |
|
Zhang X, Hao L, Meng L, Liu M, Zhao L, Hu F, Ding C, Wang Y, He B, Pan Y, et al: Digital gene expression tag profiling analysis of the gene expression patterns regulating the early stage of mouse spermatogenesis. PLoS One. 8:e586802013. View Article : Google Scholar : PubMed/NCBI | |
|
Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Huxford T, Malek S and Ghosh G: Structure and mechanism in NF-kappa B/I kappa B signaling. Cold Spring Harb Symp Quant Biol. 64:533–540. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Baldwin AS Jr: The NF-kappa B and I kappa B proteins: New discoveries and insights. Annu Rev Immunol. 14:649–683. 1996. View Article : Google Scholar : PubMed/NCBI | |
|
Gebel HM, Braun DP, Tambur A, Frame D, Rana N and Dmowski WP: Spontaneous apoptosis of endometrial tissue is impaired in women with endometriosis. Fertil Steril. 69:1042–1047. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Rawlings JS, Rosler KM and Harrison DA: The JAK/STAT signaling pathway. J Cell Sci. 117:1281–1283. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Igaz P, Toth S and Falus A: Biological and clinical significance of the JAK-STAT pathway; lessons from knockout mice. Inflamm Res. 50:435–441. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
O'Shea JJ, Gadina M and Schreiber RD: Cytokine signaling in 2002: New surprises in the Jak/Stat pathway. Cell. 109 (Suppl):S121–S131. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Kroon P, Berry PA, Stower MJ, Rodrigues G, Mann VM, Simms M, Bhasin D, Chettiar S, Li C, Li PK, et al: JAK-STAT blockade inhibits tumor initiation and clonogenic recovery of prostate cancer stem-like cells. Cancer Res. 73:5288–5298. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Hernandez-Vargas H, Ouzounova M, Le Calvez-Kelm F, Lambert MP, McKay-Chopin S, Tavtigian SV, Puisieux A, Matar C and Herceg Z: Methylome analysis reveals Jak-STAT pathway deregulation in putative breast cancer stem cells. Epigenetics. 6:428–439. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Plotnikov A, Zehorai E, Procaccia S and Seger R: The MAPK cascades: Signaling components, nuclear roles and mechanisms of nuclear translocation. Biochim Biophys Acta. 1813:1619–1633. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Davidson B, Konstantinovsky S, Kleinberg L, Nguyen MT, Bassarova A, Kvalheim G, Nesland JM and Reich R: The mitogen-activated protein kinases (MAPK) p38 and JNK are markers of tumor progression in breast carcinoma. Gynecol Oncol. 102:453–461. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Cocolakis E, Lemay S, Ali S and Lebrun JJ: The p38 MAPK pathway is required for cell growth inhibition of human breast cancer cells in response to activin. J Biol Chem. 276:18430–18436. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Reichert TE, Kashii Y, Stanson J, Zeevi A and Whiteside TL: The role of endogenous interleukin-2 in proliferation of human carcinoma cell lines. Br J Cancer. 81:822–831. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Schreiber G and Piehler J: The molecular basis for functional plasticity in type I interferon signaling. Trends Immunol. 36:139–149. 2015. View Article : Google Scholar : PubMed/NCBI |