Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
September-2022 Volume 24 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2022 Volume 24 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Connexin 43 overexpression induces lung cancer angiogenesis in vitro following phosphorylation at Ser279 in its C‑terminus

  • Authors:
    • Zizi Zhou
    • Wenxiang Chai
    • Yi Liu
    • Yao Liu
    • Huiyu Pan
    • Qiang Wu
    • Xiaoming Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Cardio‑Thoracic Surgery, Shenzhen University General Hospital, Shenzhen, Guangdong 518055, P.R. China
    Copyright: © Zhou et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 293
    |
    Published online on: July 5, 2022
       https://doi.org/10.3892/ol.2022.13413
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Blocking angiogenesis can inhibit tumor growth and metastasis. However, the mechanism underlying regulation of lung cancer angiogenesis remains unclear. The gap junction protein connexin 43 (Cx43) is implicated in angiogenesis. The aim of the present study was to determine the role of Cx43 in angiogenesis in vitro and its signaling pathways. Human pulmonary microvascular endothelial cells were transfected with Cx43‑targeting siRNA or Cx43‑overexpressing recombinant plasmid vector. Reverse transcription‑quantitative polymerase chain reaction and western blotting were performed to determine Cx43, zonula occludens‑1 (ZO‑1), E‑cadherin, β‑catenin, von Willebrand factor (vWF), and plasminogen activator inhibitor‑1 (PAI‑1) mRNA and protein expression levels, respectively. Tyr265, Ser279, Ser368, and Ser373 phosphorylation levels in the C‑terminus of Cx43 and intracellular and membranal Cx43 contents were determined using western blotting. Additionally, immunofluorescence, tube formation, Cell Counting Kit‑8, and Transwell migration assays were performed. The results revealed that compared with that in the control samples, Cx43, ZO‑1, E‑cadherin, β‑catenin, vWF, and PAI‑1 mRNA and protein expression were significantly increased in the Cx43 overexpression group and significantly decreased in the Cx43‑knockdown group. Moreover, the phosphorylation level of Ser279 as well as cell proliferation and migration rates were markedly increased in the Cx43 overexpression group, and tube formation revealed that the potential of angiogenesis was also increased. Conversely, in the Cx43‑knockdown group, the phosphorylation level of Ser279 and cell proliferation and migration rates were reduced, and the potential of angiogenesis was greatly impaired. Under Cx43 overexpression, membranal Cx43 content was significantly increased, whereas under Cx43 knockdown, it was significantly reduced. Therefore, Cx43 overexpression could induce pulmonary angiogenesis in vitro by promoting cell proliferation and migration and activating ZO‑1, E‑cadherin, β‑catenin, vWF, and PAI‑1. This may be achieved by promoting phosphorylation and activation of the intracellular signal site Ser279 at the C‑terminus of Cx43.

Introduction

Although lung cancer is a malignant tumor with the highest rates of morbidity and mortality in the world (1), its pathogenesis remains unclear. Recurrence and metastasis are the main hurdles in lung cancer treatment. Angiogenesis plays a key role in tumor growth, development, and metastasis (2). Thus, blocking angiogenesis can inhibit tumor growth and metastasis and induce tumor cell dormancy and apoptosis. However, the mechanism underlying the regulation of lung cancer angiogenesis remains unclear.

Gap junctional intercellular communication (GJIC) plays an important role in the control of cell growth, differentiation, homeostasis, and morphogenesis (3). Gap junction proteins, also called connexins (Cxs), coordinate the functions of various cells by forming gap junctions and affect cell growth and differentiation by regulating gene expression (4). Cxs are four-joint integral membrane proteins assembled by hexamers to form a hemichannel, which connects cells in a head-to-head manner to form gap junctions (5). The functions of gap junctions, including exchange of metabolites and electrical signals between cells, are highly diverse and also include functions not related to cell-cell communication (6). Gap junctions allow inorganic ions (Na+, K+, and Ca2+) and molecules <1,000 Da to directly diffuse between adjacent cells (5,7–10), which is important for the development of cells, tissues, and organs as well as for normal metabolism and homeostasis (11–13). Recently, the association between gap junctions and angiogenesis has become a research hotspot. The activity of gap junction channels is regulated through changes in voltage, calcium ion concentration, pH, phosphorylation level, and protein interactions (6,8). Among them, phosphorylation is deeply involved in the regulation process during gap junction protein synthesis, transport, assembly, membrane insertion, internalization, and degradation as well as protection of gap junction hemichannels and complete channels (7,8,12).

In a previous study by the authors, it was determined that the expression of Cx43 was improved in vascular endothelium of lung cancer compared with the normal control (Zhou et al, unpublished data). Previous research has revealed that Cx43 may participate in angiogenesis mainly by regulating branching of capillaries (14,15), and formed gap junctions play an important role in determining the fate of endothelial cells, necessary for vascularization during the process of damage repair (16–18). Moreover, decreased expression of Cx43 can cause vascular dysfunction and impair the process of neovascularization (18–20); it can also directly inhibit endothelial cell migration, proliferation, and angiogenesis and reduce vascular endothelial growth factor (VEGF) transcription and translation (20). Recently, it was revealed that Cx43 plays an important role in angiogenesis (21). Based on these studies, it was hypothesized that Cx43 was the key regulator factor involved in angiogenesis. However, its specific mechanism in angiogenesis especially in lung cancer angiogenesis remains to be elucidated.

The C-terminal region is the primary region of Cx43 that is phosphorylated. It contains 21 serine and 2 tyrosine residues, which are the targets of phosphorylation by several protein kinases, such as mitogen-activated protein kinase (MAPK), protein kinase A (PKA), protein kinase C (PKC), p34 (Cdc2)/cyclin B kinase, casein kinase 1, and pp60 (src) kinase (12,22,23). Tyr265 is phosphorylated by Src, Ser279 by MAPK, Ser368 by PKC, and Ser373 by AKT/PKB (24).

Based on the available evidence, it was hypothesized that several downstream proteins could be involved in angiogenesis, and activation of the phosphorylation sites on the C-terminus of Cx43 may trigger this regulatory pathway. In the present study, a specific small-interfering RNA (siRNA) to inhibit Cx43 intracellularly and Cx43-overexpressing recombinant plasmid were used to explore the role of Cx43 in regulating angiogenesis in lung cancer. Furthermore, it was explored whether Cx43 modulates angiogenesis depending on the activation of its C-terminal phosphorylation sites and its possible association with downstream zonula occludens-1 (ZO-1), E-cadherin, β-catenin, von Willebrand factor (vWF), and plasminogen activator inhibitor-1 (PAI-1) signaling proteins. Through in vitro experiments, the effect and underlying action mechanism of Cx43 in angiogenesis was explored. Finally, it was determined whether Cx43 is a proangiogenic effector and the corresponding signaling pathway was explored, which will provide new insight for the treatment of lung adenocarcinoma by regulating Cx43-related angiogenesis.

Materials and methods

Reagents and instruments

The main reagents and instruments used the present study included the following: Human pulmonary microvascular endothelial cells (HPMECs; cat. no. HUM-iCell-a001; iCell Bioscience, Inc.), Endothelial Cell Medium (ECM; ScienCell Research Laboratories, Inc.); Lucifer Yellow CH (Invitrogen; Thermo Fisher Scientific, Inc.), Matrigel (Corning, Inc.), Cell Lysis Buffer (product no. 9803; Cell Signaling Technology, Inc.), vWF antibody (product no. 65707; Cell Signaling Technology, Inc.), PAI-1 antibody (product code ab66705; Abcam), phosphorylated (p)-Cx43 (Tyr265) antibody (cat. no. AF2306; Affinity Biosciences), p-Cx43 (Ser279) antibody (cat. no. AF8228; Affinity Biosciences), p-Cx43 (Ser368) antibody (cat. no. AF3199; Affinity Biosciences), p-Cx43 (Ser373) antibody (cat. no. PA5-64670; Invitrogen; Thermo Fisher Scientific, Inc.), Cx43 antibody (cat. no. AF0137; Affinity Biosciences), ZO-1 antibody (product code ab96587; Abcam), E-cadherin antibody (product no. 3195; Cell Signaling Technology, Inc.), β-catenin antibody (product no. 8480; Cell Signaling Technology, Inc.), Na+/K+-ATPase (product code ab76020; Abcam), GAPDH (product code ab37168; Abcam), TRIpure Total RNA Extraction Reagent (cat. no. EP013), EntiLink™ 1st Strand cDNA Synthesis Kit (cat. no. EQ003), EntiLink™ PCR Master Mix (cat. no. EQ004), Gel DNA Purification Kit (cat. no. EP006) and EndoFree Plasmid Miniprep Kit [cat. no. EP004; all from Elk (Wuhan) Biotechnology Co., Ltd.], an inverted microscope (OLYMPUS IX51; Olympus Corporation), a fluorescence microscope (OLYMPUS BX51; Olympus Corporation), a CO2 incubator (model no. SCO6WE; SHEL LAB; Sheldon Manufacturing, Inc.), a biological safety cabinet (model no. SW-CJ-1FD; Suzhou Antai Airtech Co., Ltd.), an imaging system (MicroPublisher; QImaging), a microplate reader (model no. DR-200Bs; Diatek), scanner (model no. LiDE110; Canon, Inc.), and a real-time PCR system (StepOne™ Real-Time PCR System; Life Technologies; Thermo Fisher Scientific, Inc.).

Plasmid constructs and transfection of siRNA and plasmid-DNA
Design, synthesis, and silencing efficiency of siRNA targeting Cx43 gene

siRNAs targeting the Cx43 gene (GenBank ID: NM_000165.5) were designed. Multiple siRNA candidates were obtained, of which three candidates with strong specificity were selected for further analysis using the Basic Local Alignment Search Tool (BLAST; http://blast.ncbi.nlm.nih.gov/Blast.cgi). The three candidate siRNAs [siRNA-1 base sequence (5′-3′): sense, GCGCCUUAGGCAAACUCCUUGACAATT and antisense, UUGUCAAGGAGUUUGCCUAAGGCGCTT; siRNA-2 base sequence (5′-3′): sense, CCACACUCUUGUACCUGGCUCAUGUTT and antisense, ACAUGAGCCAGGUACAAGAGUGUGGTT; siRNA-3 base sequence (5′-3′): sense, AGUACGGUAUUGAAGAGCAUGGUAATT and antisense, UUACCAUGCUCUUCAAUACCGUACUTT] and siRNAs with no homologous sequence to the Cx43 fragment (i.e., siRNA control group; base sequence (5′-3′): sense, GCGGAUUAACGCUCAGUUCACCCAATT and antisense, UUGGGUGAACUGAGCGUUAAUCCGCTT) were chemically synthesized by HYcell Biotechnology Company. The siRNAs were then individually transfected into HPMECs cells, and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was used to detect the expression of Cx43 in the cells after 24 h. The silencing efficiency of each candidate siRNA was determined, and the siRNA sequence [base sequence (5′-3′): sense, CCACACUCUUGUACCUGGCUCAUGUTT and antisense, ACAUGAGCCAGGUACAAGAGUGUGGTT) with the highest interference efficiency was selected for subsequent experiments.

Construction and identification of recombinant plasmid

To biosynthesize the Cx43 gene, pcDNA3.1-CX43-HA plasmid (GenScript) was constructed using the PCR-based Accurate Synthesis method (25). The plasmid was transferred to a TOP10 cloned strain, which was cultured on Luria Bertani medium containing ampicillin overnight at 37°C. A single colony was selected and inoculated in Luria Bertani broth containing ampicillin and cultured overnight at 37°C and 13,000 × g. Following incubation, Escherichia coli cells containing the pcDNA3.1-CX43-HA plasmid were obtained [EndoFree Plasmid Miniprep Kit; Elk (Wuhan) Biotechnology Co., Ltd.], and the Cx43 fragment was amplified with bacterial plasmid as a template. After the plasmid was extracted [Gel DNA Purification Kit, Elk (Wuhan) Biotechnology Co., Ltd.] from the E. coli cells, it was identified through XhoI and KpnI enzyme digestion, and the whole recombinant plasmid was sequenced [EntiLink™ PCR Master Mix, Elk (Wuhan) Biotechnology Co., Ltd.].

Transfection

Log-phase HPMECs were seeded in a 6-well plate at 2×105 cells/well and cultured at 37°C in a 5% CO2 incubator. After the cells were observed to adhere to the walls for 24 h and reached 80-90% confluence (inverted microscope; Olympus Corporation), they were transfected for 6 h at 37°C following the Lipofectamine™ 2000 transfection procedure of Invitrogen; Thermo Fisher Scientific, Inc.

Cell culture and experimental design

Frozen vials of primary cells were removed from a liquid nitrogen storage tank and thawed quickly by placing the vials in a 37°C water bath and simultaneously shaking them vigorously. The cell suspensions (1 ml) from the vials were transferred to 175-cm2 culture flasks containing ECM (ScienCell Research Laboratories, Inc.). The flasks were incubated at 37°C and 5% CO2. Subsequently, the medium was changed to fresh standard cell culture medium to remove dimethyl sulfoxide and incubated overnight. The medium was replaced every other day until the cells reached 80-90% confluence (inverted microscope; Olympus Corporation). Then, the cells were digested with trypsin/EDTA solution and neutralized using complete medium containing 5% fetal bovine serum (ScienCell Research Laboratories, Inc.). Next, the cells were transferred to a 50-ml centrifuge tube and centrifuged for 3 min at 220 × g at room temperature, and the supernatant was discarded. The cells were resuspended in standard cell culture medium and counted using disposable hemocytometers. The cells were seeded at 30,000 cells per cm2 at 37°C in a 5% CO2 humidified incubator for rapid growth. Passage numbers 3-5 were used for subsequent experiments. RT-qPCR, western blotting, Scrape loading/dye transfer assay, Cell Counting Kit-8 (CCK-8) assay, Transwell migration assay, and immunofluorescence assay were performed in a biological safety cabinet (Suzhou Antai Airtech Co., Ltd.). An angiogenesis 96-well microplate was used for the tube formation assay.

Tube formation assay

Matrigel (Corning, Inc.) was placed on ice and refrigerated (−4°C) overnight the day before cells were seeded. Matrigel (10 µl) was then applied to each inner well, and the slide was covered with a lid. Next, the slide was placed in an incubator for polymerization (60 min). In addition, the cell suspension was prepared. For a final density of 15,000 cells/well, a cell suspension of 3×105 cells/ml was used from each group (normal control group, connexin 43 group and small-interfering RNA group; resuspended in antibiotic-free standard medium) and pipetted up and down to mix thoroughly. The slide was removed from the incubator and placed on a rack, and 50 µl of cell suspension was added to each top well of the slide (repeated six times for each group). The slide was covered with the lid and observed for well-proportioned cells. The cells were then incubated at 37°C for 20 h in a humidified incubator. Finally, images were acquired using a microscope (inverted microscope; Olympus Corporation; magnification, ×50) and preserved. Tube network formation was assessed by measuring all parameters with ImageJ Angiogenesis Analyzer (ImageJ bundled with 64-bit Java 1.8.0_172; National Institutes of Health), including the number of branches and nodes and the length and spacing of the branches, which were selected for evaluating the angiogenic potential.

Scrape loading/dye transfer and characterization of gap junction channel function

Cells were cultured in a 6-well plate to 100% confluency (inverted microscope; Olympus Corporation) as aforementioned. The medium was discarded via suction with a pipette, and Dulbecco's phosphate-buffered saline (DPBS) (Ca/Mg) (product no. 14040133; Gibco; Thermo Fisher Scientific, Inc.) was used to wash the cells three times (2 ml/well). Cells in each well were then covered with LY dye solution (Lucifer Yellow CH; Invitrogen; Thermo Fisher Scientific, Inc.; 1 ml); the dye was loaded onto the cells by scratching one line with a blade tip of a no. 15 surgical scalpel. Subsequently, the plates were kept on a clean bench at room temperature for up to 4 min, allowing the LY dye to pass across several adjacent cell layers through functional gap junctions. To minimize fluorescence photobleaching of the dye, the plates were concurrently covered with aluminum foil. LY dye solution was then discarded from the plate wells. The cells were rinsed twice with DPBS (Ca/Mg) to discard the extracellular dye, and 2 ml of normal medium was then added into every well. The cells were immediately observed using a fluorescence microscope (Olympus Corporation) at a 100-fold magnification. The fluorescence distance of the dye spread was measured using ImageJ (ImageJ bundled with 64-bit Java 1.8.0_172; National Institutes of Health) This experiment was performed eight times. Four images and associated results were randomly selected from the normal control group, connexin 43 group and small-interfering RNA group.

CCK-8 assay

Once the cells reached 90% confluence (inverted microscope; Olympus Corporation), conventional hemocytometer-based cell counting was performed. Each of the 60 wells in the center of a 96-well plate was pipetted with 100 µl of cells (concentration 2×105 cells/ml), and the surrounding wells were pipetted with an equal volume of PBS (100 µl). Cells were labeled and incubated at 37°C for 24 h. After 24 h of serum deprivation in an equal volume of serum-free medium, the cells were washed once with PBS. Then cells were grouped (normal control group, connexin 43 group and small-interfering RNA group). Six replicates were performed for each of the groups, and the cells were cultured for 24 h after treatment. A 10% CCK-8 solution was prepared by adding 1.2 ml of CCK-8 (Dojindo Molecular Technologies, Inc.) into 12 ml of Endothelial Cell Medium (ScienCell Research Laboratories, Inc.). The treated cells were washed with PBS, and 100 µl of 10% CCK-8 was added to each well. Following incubation for 3 h, the absorbance (OD value) at 450 nm was measured using a microplate reader.

Transwell migration assays

Cells were counted using a hemocytometer, and the concentration was adjusted to 1×105 cells/ml. In a Transwell plate (pore size, 3 µm; thickness, 10 µm; diameter, 12 mm), 200 µl of solution of each group (normal control group, connexin 43 group and small-interfering RNA group) was respectively added to corresponding chamber; 800 µl complete medium was added to each of the three wells. Cells were labeled and cultured for 24 h; after a single PBS wash, the non-migrated cells were then swabbed with cotton; whereas, migrated cells were fixed using paraformaldehyde (concentration, 4%; duration, 30 min; room temperature). After 20 min of 0.1% crystal violet staining at room temperature, the migrated cells were washed thrice with PBS and the entire chamber was cleaned to remove any residual dye. The filter membrane was air-dried, cut and examined under a microscope (inverted microscope; Olympus Corporation) on a glass slide. Three fields were selected at random for cell counting.

Western blotting

Total protein was extracted from the three groups of cells using Cell Lysis Buffer (Cell Signaling Technology, Inc.), and the protein concentration was measured using a BCA protein assay kit (cat. no. AS1086; Wuhan Aspen Biotechnology Co., Ltd.). Subsequently, 50 µg of total protein from each sample was added to 10% polyacrylamide gel electrophoresis gels. According to the pre-stained marker display, after judging that the target protein was sufficiently separated, electrophoresis was terminated. The proteins were then electroblotted onto a PVDF membrane and the membrane was blocked with 1% western blocking reagent (product no. 11921681001; Roche Diagnostics GmbH) at room temperature for 1 h. Subsequently, the membrane was successively incubated in the primary antibody solutions for the targeted proteins [p-Cx43 (Tyr265) antibody (Affinity Biosciences), p-Cx43 (Ser279) antibody (Affinity Biosciences), p-Cx43 (Ser368) antibody (Affinity Biosciences), p-Cx43 (Ser373) antibody (Invitrogen; Thermo Fisher Scientific, Inc.), Cx43 antibody (Affinity Biosciences), ZO-1 antibody (Abcam), E-cadherin antibody (Cell Signaling Technology, Inc.), β-catenin antibody (Cell Signaling Technology, Inc.), vWF antibody (Cell Signaling Technology, Inc.), PAI-1 antibody (Abcam), Na+/K+-ATPase (Abcam) and GAPDH (Abcam); the antibodies were diluted [p-Cx43 (Tyr265), 5% skim milk, 1:500; p-Cx43 (Ser279), 5% skim milk, 1:500; p-Cx43 (Ser368), 5% skim milk, 1:500; p-Cx43 (Ser373), 5% skim milk, 1:500; Cx43, 5% skim milk, 1:3,000; ZO-1, 5% skim milk, 1:500; E-cadherin, 5% skim milk, 1:2,000; β-catenin, 5% skim milk, 1:1,000; vWF, 5% skim milk, 1:1,000; PAI-1, 5% skim milk, 1:1,000; Na+/K+-ATPase, 5% skim milk, 1:1,000; GAPDH, 5% skim milk, 1:10,000] for one night at 4°C and then incubated in the HRP-conjugated secondary antibody solution [HRP-Goat anti Rabbit (cat. no. AS1107; Wuhan Aspen Biotechnology Co., Ltd.; the antibody was diluted (5% skim milk, 1:10,000)] for 30 min at 37°C. An appropriate amount of ECL substrate solution (cat. no. AS1059; Aspen Biotechnology Co., Ltd.) was then added to each membrane, and the membrane was incubated for several minutes. After the bands appeared, filter paper was used to absorb the excess substrate solution. The membrane was then exposed to an X-ray film. The film was placed in the developer solution for development and fixing solution for fixing (scanner; Canon, Inc.). Densitometry was performed using AlphaEaseFC™ 4.0 software (ProteinSimple).

RT-qPCR

TRIpure Total RNA Extraction Reagent [cat. no. EP013; Elk (Wuhan) Biotechnology Co., Ltd.] was used to extract the total RNA of the cells from each group (normal control group, connexin 43 group, and small-interfering RNA group), and 3.75 µg of total RNA was used for reverse transcription of RNA to cDNA [EntiLink™ 1st Strand cDNA Synthesis Kit; cat. no. EQ003; Elk (Wuhan) Biotechnology Co., Ltd.], and the cDNA was subjected to PCR to detect the target gene. GAPDH was used as an reference gene. The conditions of the reverse transcription reaction were: 42°C for 60 min and 95°C for 5 min. The semi-quantitative reaction conditions were: 94°C for 4 min, 94°C for 30 sec, 56°C for 30 sec, and 72°C for 25 sec for 30 cycles. Real-time PCR was performed again, cDNA was diluted 10 times, and the reaction conditions were: 50°C for 2 min, 95°C for 10 min, 95°C for 30 sec, and 60°C for 30 sec for 40 cycles. The PCR products were analyzed by electrophoresis in agarose gels (1% gel) stained with ethidium bromide, and the gel was imaged using a gel imaging system and then scanned in grayscale. Integral optical density (IOD) was used to represent the expression level (real-time PCR system; Thermo Fisher Scientific, Inc.). 6-carboxyfluorescein (product code c1360; Invitrogen; Thermo Fisher Scientific, Inc.) was used as a fluorophore in the process. The ratio of the expression of target gene to that of GAPDH was analyzed, and the relative expression level of the target gene was calculated using 2−ΔΔCq method (26). The sequences of the primers are listed in Table I. The experiment was performed in triplicate.

Table I.

Sequences of the primers and lengths of the corresponding PCR products.

Table I.

Sequences of the primers and lengths of the corresponding PCR products.

GenePrimerBase sequence (5′-3′) TmGC (%)Product size (bp)
GAPDHNM_001256799.2Sense CATCATCCCTGCCTCTACTGG59.457.1259
Antisense GTGGGTGTCGCTGTTGAAGTC60.157.1
CX43NM_000165.5Sense AAGGTTCAAGCCTACTCAACTGC59.947.8188
Antisense ACATGAGAGATTGGGAAAGACTTG59.441.7
ZO-1NM_001301025.1Sense CAAGCCTGCAGAGTCCAAGC60.760139
Antisense TGAAGGTATCAGCGGAGGGA60.355
E-CADNM_001317184.1Sense TTCTTCGGAGGAGAGCGG58.361.1234
Antisense CAATTTCATCGGGATTGGC58.547.4
β-cateninNM_001098209.1Sense GCCAAGTGGGTGGTATAGAGG58.757.1192
Antisense GGGATGGTGGGTGTAAGAGC5960
vWFNM_000552.5Sense TGGAGAAACAGTGAAGATTGGC59.445.5168
Antisense ACCAGAACGTACTGGCACTCC5957.1
PAI-1NM_000602.4Sense ATTACTACGACATCCTGGAACTGC59.645.8106
Antisense AGAATGTTGGTGAGGGCAGAG59.152.4

[i] Tm, melting temperature, the melting temperature (Tm) by definition is the temperature at which one half of the oligo (primer) duplex will dissociate to become single stranded and indicates the duplex stability; GC (%), the GC content is the number of G's and C's in the primer as a percentage of the total bases; CX43, connexin 43; ZO-1, zonula occludens-1; vWF, von Willebrand factor; PAI-1, plasminogen activator inhibitor-1.

Statistical analysis

SPSS 22.0 (IBM Corp.) software was utilized for statistical analysis. The data are presented as the mean ± standard deviation. Experimental groups were compared using one-way analysis of variance followed by Student-Newman-Keuls post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of Cx43 and other angiogenesis-related mRNAs in HPMECs

Following transfection of pcDNA3.1-CX43-HA plasmid, the mRNA level of Cx43 in the Cx43 overexpression group (i.e, Cx43 group) increased by approximately two-fold, whereas following the transfection of Cx43-specific siRNA in the Cx43-knockdown group (i.e, Cx43 siRNA group), it decreased to 48.62±0.50% compared with that in the normal control group (i.e, NC group) (P<0.01) (Fig. 1). The mRNA levels of CX43, ZO-1, E-cadherin, β-catenin, PAI-1, and vWF were significantly increased in the Cx43 group and significantly decreased in the Cx43-siRNA group compared with those in the normal control group (P<0.01) (Fig. 1). These results suggested that overexpression of Cx43 stimulated the mRNA expression levels of ZO-1, E-cadherin, β-catenin, PAI-1, and vWF, while silencing of Cx43 suppressed their expression levels.

Figure 1.

Relative expression levels of various mRNAs in different groups determined using RT-qPCR (the resulting data are presented as the mean ± standard deviation; *P<0.01 vs. NC; n=3 in each group). RT-qPCR, reverse transcription-quantitative polymerase chain reaction; NC, normal control group; Cx43, connexin 43; ZO-1, zonula occludens-1; vWF, von Willebrand factor; PAI-1, plasminogen activator inhibitor-1; siRNA, small-interfering RNA.

Silencing of Cx43 suppresses and overexpression of Cx43 induces ZO-1, E-cadherin, β-catenin, vWF, and PAI-1 expression in HPMECs

The expression levels of Cx43, ZO-1, E-cadherin, β-catenin, vWF, and PAI-1 were significantly decreased in the Cx43 siRNA group and significantly increased in the Cx43 group compared with those in the normal control group (P≤0.01) (Fig. 2). These results suggested that overexpression of Cx43 stimulated the expression of ZO-1, E-cadherin, β-catenin, vWF, and PAI-1, whereas silencing of Cx43 suppressed the expression of these molecules compared with that in the normal control group.

Figure 2.

Relative expression levels (normalized with NC) of various proteins in different groups as determined through western blotting (the resulting data are presented as the mean ± standard deviation; *P<0.01 vs. NC; n=5 in each group). (A) Densitometric analysis and (B) representative western blots. Groups: a, NC; b, Cx43-siRNA; and c, Cx43. NC, normal control group; Cx43, connexin 43; ZO-1, zonula occludens-1; vWF, von Willebrand factor; PAI-1, plasminogen activator inhibitor-1; siRNA, small-interfering RNA.

Silencing of Cx43 suppresses and overexpression of Cx43 induces VEGF-associated Ser279 expression in HPMECs

The levels of Ser279 (Fig. 3) and intracellular and membranal levels of Cx43 were significantly decreased in the Cx43-knockdown group, particularly the membranal levels of Cx43 (Fig. 4), whereas the levels were significantly increased in the Cx43 group compared with those in the normal control group (P<0.01) (Figs. 3 and 4). Conversely, the levels of Tyr265, Ser368, and Ser373 in the Cx43-knockdown and overexpression groups were not significantly different from those in the normal control group (Fig. 3). These results suggested that the overexpression of Cx43 stimulated the levels of Ser279 and intracellular and membranal levels of Cx43, particularly the membranal levels of Cx43.

Figure 3.

Relative expression levels (normalized with NC) of various proteins in different groups as determined using western blotting (the resulting data are presented as the mean ± standard deviation; *P<0.01 vs. NC; ns, P>0.05 vs. NC; n=5 in each group). (A) Densitometric analysis and (B) representative western blots. Groups: a, NC; b, Cx43-siRNA; c, Cx43. NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA; ns, not significant.

Figure 4.

Relative intracellular and membranal expression levels of Cx43 in different groups as determined using western blotting (the resulting data are presented as the mean ± standard deviation; *P<0.05 vs. NC; **P<0.01 vs. NC; n=5 in each group). (A) Densitometric analysis and (B) representative western blots. Groups: a, NC; b, Cx43-siRNA; c, Cx43. NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA.

Average fluorescence intensity of different groups

Immunofluorescence results showed that the average fluorescence intensity for the Cx43 overexpression group was higher, whereas for the Cx43-knockdown group it was lower compared with that for the normal control group (×400; P<0.01). The average fluorescence intensity in the Cx43 overexpression group was increased by 1.4-fold, whereas in the Cx43-knockdown group it was decreased by approximately 0.6-fold compared with that in the normal control group (Figs. 5 and 6).

Figure 5.

Average fluorescence intensity of various groups following immunofluorescence assay (the resulting data are presented as the mean ± standard deviation; *P<0.01 vs. NC; n=5 in each group). NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA.

Figure 6.

Cell morphology among various groups following immunofluorescence assay (magnification, ×400; scale bar, 20 µm). NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA.

Cx43 overexpression improves angiogenic potential of HPMECs

Using tube formation assay, the angiogenic potential (number of segments) was analyzed. The angiogenic potential of HPMECs was increased in the Cx43 overexpression group, whereas it was decreased in the Cx43-knockdown group compared with that in the normal control group (P<0.01). The angiogenic potential in the Cx43 overexpression group was increased by two-fold, whereas that in the Cx43-knockdown group was decreased by approximately 75% compared with that in the normal control group (Figs. 7 and 8).

Figure 7.

Number of branches in different groups following tube formation assay (the resulting data are presented as the mean ± SD; *P<0.01 vs. NC; n=30 in each group). NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA.

Figure 8.

Cell morphology observed via tube formation assay (magnification, ×50; scale bar, 250 µm). NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA.

Cx43 promotes scrape loading dye transfer in HPMECs

Scrape loading/dye transfer assay revealed that the average dye transfer distance of the Cx43 overexpression group was the highest among all groups. It was approximately 1.5-fold higher than that of the normal control group. Conversely, the average dye transfer distance of the Cx43-knockdown group was lower than the other groups; it was approximately 60% lower than that of the normal control group (P<0.01) (Figs. 9 and 10).

Figure 9.

Comparison of the average dye transfer distance among different groups using scrape loading/dye transfer assay (the resulting data are presented as the mean ± SD; *P<0.01 vs. NC; n=8 in each group). Units are in µm. NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA.

Figure 10.

Fluorescence observed in various groups using scrape loading dye transfer assay (magnification, ×100; scale bar, 100 µm). NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA.

Cx43 stimulates proliferation of HPMECs

CCK-8 assay showed that the relative absorbance value (OD value) in the Cx43 overexpression group was increased by approximately 30% compared with that in the normal control group, whereas in the Cx43-knockdown group it was decreased by approximately 25% compared with that in the normal control group (P<0.01) (Fig. 11). These results indicated that overexpression of Cx43 significantly promoted the proliferation of HPMECs, whereas silencing of Cx43 significantly inhibited the proliferation of the cells.

Figure 11.

Comparison of the OD value among different groups via CCK-8 assay (the resulting data are presented as the mean ± SD; *P<0.01 vs. NC; n=3 in each group). OD, optical density; CCK-8, Cell Counting Kit-8; NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA.

Cx43 stimulates migration of HPMECs

Transwell migration assay revealed that the number of migrating cells in the Cx43 overexpression group was increased, whereas in the Cx43-knockdown group it was decreased compared with that in the normal control group (P<0.01) (Fig. 12). These results indicated that Cx43 overexpression significantly promoted the migration of HPMECs, while silencing of Cx43 significantly inhibited cell migration.

Figure 12.

Comparison of the number of migrating cells in the different groups with Transwell migration assay (the resulting data are presented as the mean ± SD; *P<0.01 vs. NC; n=5 in each group). (A) Representative images of migrating cells (magnification, ×100; scale bar, 25 μm) and (B) analysis of number of migrating cells. NC, normal control group; Cx43, connexin 43; siRNA, small-interfering RNA.

Discussion

Angiogenesis is the process through which blood vessels sprout from pre-existing blood vessels into avascular tissues, following which they undergo reconstruction such that the original irregular blood vessel network is developed into functional branch blood vessels with complex three-dimensional structures (27). It is jointly regulated by growth factors, pro-angiogenic cytokines, and neovascularization inhibitors (28,29). As an indispensable link in the vascularization process, angiogenesis involves proliferation, survival, migration, and differentiation of endothelial cells (30), which play a major role in tumor growth and metastasis (27,31). Moreover, angiogenesis is a major hurdle in the treatment of lung cancer. Therefore, preventing angiogenesis plays an important role in successfully controlling the progression of lung cancer. Consequently, exploring new methods of anti-angiogenesis therapy is essential for lung cancer treatment.

The phosphorylation site of Cx43 is located at the C-terminus of the cytoplasm, which contains multiple serine, threonine, and tyrosine residues, hence can be phosphorylated by various protein kinases, such as MAPK, PKA, PKC, p34 (Cdc2)/cyclin B kinase, CK1, and pp60 (src) kinase (7,12,22,23). Phosphorylation at specific sites may play a regulatory role in the internalization and degradation of Cx43 channels, thereby affecting gap junctions (10,32). In addition, during normal development and disease processes, protein-protein interactions and modification of the C-terminal of Cx43 are key determinants of gap junction function, size, distribution, and organization (33). Phosphorylation is the primary way to modify the carboxyl end of Cx43. Therefore, phosphorylation of Cx43 may become a new focus of future research.

In the present study it was determined that after mature HPMECs were transfected with the Cx43-overexpressed gene, the expression of adhesion marker proteins ZO-1, E-cadherin, and β-catenin, pro-thrombotic factor vWF, and coagulation factor PAI-1 increased, and the changes in the protein levels of these molecules were consistent with the changes in their mRNA levels. Following intracellular inhibition of Cx43 using a specific siRNA, the mRNA and protein levels of the aforementioned molecules were significantly reduced. Therefore, overexpression of Cx43 was capable of stimulating the downstream ZO-1, E-cadherin, β-catenin, vWF, and PAI-1 signaling proteins at the molecular and gene levels, which was associated with angiogenesis. Moreover, the proliferation and migration of cells in the overexpression group were significantly increased, whereas those in the silenced group were significantly reduced, suggesting that overexpression of Cx43 can promote the proliferation and migration of HPMECs, which is inconsistent with the results from a study by Koepple et al, in which the proliferation level was unchanged (21). It is therefore theorized that the reason for this inconsistency, is the diverse impact of Cx43 on different cell types. However, this hypothesis warrants further investigation. The tube formation experiments indicated that Cx43 can promote angiogenesis while silencing of the Cx43 gene can inhibit the process. This previous study by Koepple et al (21) found that using Cx43 mimetic peptide Gap27, after transfection of Cx43 cDNA to block Cx43-dependent gap junctional communication, did not affect angiogenic potential of endothelial cells compared to cells only transfected with Cx43 cDNA, and dye transfer was significantly attenuated in cells treated with Gap27 compared with the solvent control, which demonstrated that the expression of Cx43 stimulated endothelial angiogenesis independently of gap junctional communication in vitro. In the present study, it was also determined that the overexpression of Cx43 could improve the dye transfer, while the transfection of Cx43-specific siRNA reduced dye transfer distance distinctly, and these were consistent with their results (21). However, further experiments to verify the specific function of gap junction communication during angiogenesis should be performed. In addition, the expression of Ser279 was increased in the Cx43 overexpression group, and decreased in the silenced group, which demonstrated that Cx43 modulates angiogenesis depending on the activation of its C-terminal phosphate site-Ser279 and the downstream ZO-1, E-cadherin, β-catenin, vWF, and PAI-1 signaling proteins. Following overexpression of Cx43, the intracellular and membranal content of Cx43 was increased; in particular, Cx43 expression in the cell membrane was significantly increased. Conversely, after silencing of Cx43, the Cx43 protein level was significantly decreased, particularly in the cell membrane. These results suggest that the angiogenesis effect of Cx43 may rely on the membranal Cx43 expression level.

A siRNA targeting Cx43 and a recombinant vector that overexpressed the Cx43 gene were successfully designed and constructed. Following transfection of HPMECs, it was revealed that overexpression of the Cx43 gene could induce pulmonary angiogenesis in vitro. Cx43 overexpression induced angiogenesis by promoting cell proliferation and migration and may be associated with the activation of adhesion marker proteins ZO-1, E-cadherin, and β-catenin, thrombosis-related factor vWF, and coagulation factor PAI-1. A limitation of the present study is that it only identified proteins ZO-1, E-cadherin, β-catenin, vWF, and PAI-1 as participants in the process of Cx43-associated angiogenesis. However, if these proteins play direct roles or are affected by some other key intermediate proteins of the signaling pathway requires further research. This pro-angiogenesis process may be activated through activation of intracellular signaling site Ser279 on the C-terminal. In addition, the results demonstrated that silencing of the Cx43 gene using Cx43-siRNA mainly affected the integration of Cx43 and reduced the distribution of Cx43 in the cell membrane, while overexpression of Cx43 had the opposite effect. However, further research should be performed to confirm this finding. In subsequent research, the construction of a Cx43 mutant body (Ser279), protein-protein interactions and other molecular biotechnologies could be used to explore their specific effects.

In summary, the present study demonstrated that activation of the phosphorylation site Ser279 at the C-terminal of Cx43 was an important pathway for Cx43 to regulate angiogenesis in vitro. This also promoted angiogenesis by stimulating cell proliferation, migration, and distribution of Cx43 to the cell membrane, possibly via the activation of the downstream ZO-1, E-cadherin, β-catenin, vWF, and PAI-1 signaling proteins. The results indicated that Cx43 and its intracellular signaling site Ser279 on the C-terminal are potential new targets for regulating angiogenesis and exploring new treatment approaches for angiogenesis-associated diseases.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Natural Science Foundation of Shenzhen University General Hospital (grant no. SUGH2019QD007 to ZZ, and grant no. SUGH2019QD014 to XZ) and the Science and Technology Foundation of Nanshan District, Shenzhen (grant no. NS2021167 to ZZ).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

ZZ, WC, YiL, YaL, HP, QW and XZ contributed to the study concept, design, experiments, data collection, analysis, and interpretation. ZZ wrote the manuscript. XZ revised the manuscript and gave final approval of the version to be published. ZZ and XZ confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394–424. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Jiang X, Wang J, Deng X, Xiong F, Zhang S, Gong Z, Li X, Cao K, Deng H, He Y, et al: The role of microenvironment in tumor angiogenesis. J Exp Clin Cancer Res. 39:2042020. View Article : Google Scholar : PubMed/NCBI

3 

Saito T, Tanaka R, Wataba K, Kudo R and Yamasaki H: Overexpression of estrogen receptor-alpha gene suppresses gap junctional intercellular communication in endometrial carcinoma cells. Oncogene. 23:1109–1116. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Jiang JX and Gu S: Gap junction- and hemichannel-independent actions of connexins. Biochim Biophys Acta. 1711:208–214. 2005. View Article : Google Scholar : PubMed/NCBI

5 

Goodenough DA and Paul DL: Gap junctions. Cold Spring Harb Perspect Biol. 1:a0025762009. View Article : Google Scholar : PubMed/NCBI

6 

Nielsen MS, Axelsen LN, Sorgen PL, Verma V, Delmar M and Holstein-Rathlou NH: Gap junctions. Compr Physiol. 2:1981–2035. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Saez JC, Berthoud VM, Branes MC, Martinez AD and Beyer EC: Plasma membrane channels formed by connexins: Their regulation and functions. Physiol Rev. 83:1359–1400. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Lampe PD and Lau AF: The effects of connexin phosphorylation on gap junctional communication. Int J Biochem Cell Biol. 36:1171–1186. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Maeda S and Tsukihara T: Structure of the gap junction channel and its implications for its biological functions. Cell Mol Life Sci. 68:1115–1129. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Roy S, Jiang JX, Li AF and Kim D: Connexin channel and its role in diabetic retinopathy. Prog Retin Eye Res. 61:35–59. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Söhl G and Willecke K: Gap junctions and the connexin protein family. Cardiovasc Res. 62:228–232. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Solan JL and Lampe PD: Connexin phosphorylation as a regulatory event linked to gap junction channel assembly. Biochim Biophys Acta. 1711:154–163. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Meşe G, Richard G and White TW: Gap junctions: Basic structure and function. J Invest Dermatol. 127:2516–2524. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Laws MJ, Taylor RN, Sidell N, DeMayo FJ, Lydon JP, Gutstein DE, Bagchi MK and Bagchi IC: Gap junction communication between uterine stromal cells plays a critical role in pregnancy-associated neovascularization and embryo survival. Development. 135:2659–2668. 2008. View Article : Google Scholar : PubMed/NCBI

15 

Buschmann I, Pries A, Styp-Rekowska B, Hillmeister P, Loufrani L, Henrion D, Shi Y, Duelsner A, Hoefer I, Gatzke N, et al: Pulsatile shear and Gja5 modulate arterial identity and remodeling events during flow-driven arteriogenesis. Development. 137:2187–2196. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Walker DL, Vacha SJ, Kirby ML and Lo CW: Connexin43 deficiency causes dysregulation of coronary vasculogenesis. Dev Biol. 284:479–498. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Gärtner C, Ziegelhöffer B, Kostelka M, Stepan H, Mohr FW and Dhein S: Knock-down of endothelial connexins impairs angiogenesis. Pharmacol Res. 65:347–357. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Wang HH, Su CH, Wu YJ, Li JY, Tseng YM, Lin YC, Hsieh CL, Tsai CH and Yeh HI: Reduction of connexin43 in human endothelial progenitor cells impairs the angiogenic potential. Angiogenesis. 16:553–560. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Chou Y, Tsai CH, Ueng KC, Tian TY, Chen SC and Yeh HI: Endothelial gap junctions are down-regulated by arsenic trioxide. Eur J Pharmacol. 569:29–36. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Wang HH, Kung CI, Tseng YY, Lin YC, Chen CH, Tsai CH and Yeh HI: Activation of endothelial cells to pathological status by down-regulation of connexin43. Cardiovasc Res. 79:509–518. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Koepple C, Zhou Z, Huber L, Schulte M, Schmidt K, Gloe T, Kneser U, Schmidt VJ and de Wit C: Expression of Connexin43 stimulates endothelial angiogenesis independently of Gap junctional communication in vitro. Int J Mol Sci. 22:74002021. View Article : Google Scholar : PubMed/NCBI

22 

Jansen JA, van Veen TA, de Bakker JM and van Rijen HV: Cardiac connexins and impulse propagation. J Mol Cell Cardiol. 48:76–82. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Schulz R, Görge PM, Görbe A, Ferdinandy P, Lampe PD and Leybaert L: Connexin 43 is an emerging therapeutic target in ischemia/reperfusion injury, cardioprotection and neuroprotection. Pharmacol Ther. 153:90–106. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Omasits U, Ahrens CH, Müller S and Wollscheid B: Protter: Interactive protein feature visualization and integration with experimental proteomic data. Bioinformatics. 30:884–886. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Marsic D, Hughes RC, Byrne-Steele ML and Ng JD: PCR-based gene synthesis to produce recombinant proteins for crystallization. BMC Biotechnol. 8:442008. View Article : Google Scholar : PubMed/NCBI

26 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Distler O, Neidhart M, Gay RE and Gay S: The molecular control of angiogenesis. Int Rev Immunol. 21:33–49. 2002. View Article : Google Scholar : PubMed/NCBI

28 

Polverini PJ: The pathophysiology of angiogenesis. Crit Rev Oral Biol Med. 6:230–247. 1995. View Article : Google Scholar : PubMed/NCBI

29 

Goel S, Duda DG, Xu L, Munn LL, Boucher Y, Fukumura D and Jain RK: Normalization of the vasculature for treatment of cancer and other diseases. Physiol Rev. 91:1071–1121. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Bir SC, Xiong Y, Kevil CG and Luo J: Emerging role of PKA/eNOS pathway in therapeutic angiogenesis for ischaemic tissue diseases. Cardiovasc Res. 95:7–18. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Carmeliet P and Jain RK: Angiogenesis in cancer and other diseases. Nature. 407:249–257. 2000. View Article : Google Scholar : PubMed/NCBI

32 

Fernandes R, Girão H and Pereira P: High glucose down-regulates intercellular communication in retinal endothelial cells by enhancing degradation of connexin 43 by a proteasome-dependent mechanism. J Biol Chem. 279:27219–27224. 2004. View Article : Google Scholar : PubMed/NCBI

33 

Palatinus JA, Rhett JM and Gourdie RG: The connexin43 carboxyl terminus and cardiac gap junction organization. Biochim Biophys Acta. 1818:1831–1843. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhou Z, Chai W, Liu Y, Liu Y, Pan H, Wu Q and Zhang X: Connexin 43 overexpression induces lung cancer angiogenesis <em>in vitro</em> following phosphorylation at Ser279 in its C‑terminus. Oncol Lett 24: 293, 2022.
APA
Zhou, Z., Chai, W., Liu, Y., Liu, Y., Pan, H., Wu, Q., & Zhang, X. (2022). Connexin 43 overexpression induces lung cancer angiogenesis <em>in vitro</em> following phosphorylation at Ser279 in its C‑terminus. Oncology Letters, 24, 293. https://doi.org/10.3892/ol.2022.13413
MLA
Zhou, Z., Chai, W., Liu, Y., Liu, Y., Pan, H., Wu, Q., Zhang, X."Connexin 43 overexpression induces lung cancer angiogenesis <em>in vitro</em> following phosphorylation at Ser279 in its C‑terminus". Oncology Letters 24.3 (2022): 293.
Chicago
Zhou, Z., Chai, W., Liu, Y., Liu, Y., Pan, H., Wu, Q., Zhang, X."Connexin 43 overexpression induces lung cancer angiogenesis <em>in vitro</em> following phosphorylation at Ser279 in its C‑terminus". Oncology Letters 24, no. 3 (2022): 293. https://doi.org/10.3892/ol.2022.13413
Copy and paste a formatted citation
x
Spandidos Publications style
Zhou Z, Chai W, Liu Y, Liu Y, Pan H, Wu Q and Zhang X: Connexin 43 overexpression induces lung cancer angiogenesis <em>in vitro</em> following phosphorylation at Ser279 in its C‑terminus. Oncol Lett 24: 293, 2022.
APA
Zhou, Z., Chai, W., Liu, Y., Liu, Y., Pan, H., Wu, Q., & Zhang, X. (2022). Connexin 43 overexpression induces lung cancer angiogenesis <em>in vitro</em> following phosphorylation at Ser279 in its C‑terminus. Oncology Letters, 24, 293. https://doi.org/10.3892/ol.2022.13413
MLA
Zhou, Z., Chai, W., Liu, Y., Liu, Y., Pan, H., Wu, Q., Zhang, X."Connexin 43 overexpression induces lung cancer angiogenesis <em>in vitro</em> following phosphorylation at Ser279 in its C‑terminus". Oncology Letters 24.3 (2022): 293.
Chicago
Zhou, Z., Chai, W., Liu, Y., Liu, Y., Pan, H., Wu, Q., Zhang, X."Connexin 43 overexpression induces lung cancer angiogenesis <em>in vitro</em> following phosphorylation at Ser279 in its C‑terminus". Oncology Letters 24, no. 3 (2022): 293. https://doi.org/10.3892/ol.2022.13413
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team