Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
March-2024 Volume 27 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2024 Volume 27 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article Open Access

RNF125‑mediated ubiquitination of MCM6 regulates the proliferation of human liver hepatocellular carcinoma cells

  • Authors:
    • Xueyi Feng
    • Dongqiang Song
    • Xiaolan Liu
    • Yongkang Liang
    • Pin Jiang
    • Shenwei Wu
    • Fubao Liu
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230022, P.R. China, Liver Cancer Institute, Zhongshan Hospital of Fudan University, Shanghai 200032, P.R. China, Department of Gastroenterology, The Affiliated Hospital of Qingdao University, Qingdao, Shandong 266003, P.R. China, Department of General Surgery, Lu'an Affiliated Hospital of Anhui Medical University, Lu'an, Anhui 237005, P.R. China
    Copyright: © Feng et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 105
    |
    Published online on: January 17, 2024
       https://doi.org/10.3892/ol.2024.14238
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Hepatocellular carcinoma (HCC) is the third leading cause of cancer‑associated mortality worldwide. Minichromosome maintenance proteins (MCMs), particularly MCM2‑7, are upregulated in various cancers, including HCC. The aim of the present study was to investigate the role of MCM2‑7 in human liver HCC (LIHC) and the regulation of the protein homeostasis of MCM6 by a specific E3 ligase. Bioinformatics analyses demonstrated that MCM2‑7 were highly expressed in LIHC compared with corresponding normal tissues at the mRNA and protein levels, and patients with LIHC and high mRNA expression levels of MCM2, MCM3, MCM6 and MCM7 had poor overall survival rates. Cell Counting Kit‑8 and colony formation assays revealed that the knockdown of MCM2, MCM3, MCM6 or MCM7 in Huh7 and Hep3B HCC cells inhibited cell proliferation and colony formation. In addition, pull‑down, co‑immunoprecipitation and ubiquitination assays demonstrated that RNF125 interacts with MCM6 and mediates its ubiquitination. Furthermore, co‑transfection experiments indicated that RNF125 promoted the proliferation of HCC cells mainly through MCM6. In summary, the present study suggests that the RNF125‑MCM6 axis plays an important role in the regulation of HCC cell proliferation and is a promising therapeutic target for the treatment of LIHC.

Introduction

Hepatocellular carcinoma (HCC) is the third most frequent cause of cancer-associated death worldwide and represents a major global health challenge (1,2). Currently, the global five-year survival rate of metastatic HCC is <20% (3). Great progress has been made in the diagnosis and treatment of HCC, but the mortality rate remains unsatisfactory (3,4). According to the stage of the tumor and the condition of the patient, there are various treatment options for HCC. A number of curative treatment options exist for early-stage HCC, including surgical resection, radiofrequency ablation and liver transplantation. However, 80% of patients have unresectable HCC and can only be treated with locoregional therapies such as radiotherapy, transarterial chemoembolization or transarterial radioembolization (2). Due to high relapse rates and drug resistance, the prognosis for most HCC patients is less than ideal (5,6). It is therefore imperative to explore new therapeutic targets.

Dysregulated DNA replication in cells is a major contributor to tumor initiation and progression. Minichromosome maintenance proteins (MCMs) are essential for DNA replication and are the subject of considerable research interest (7). The aberrant expression of MCMs has been detected in numerous malignancies, which can lead to genomic instability and uncontrolled cell cycle progression (7,8). The MCM2-7 family is a class of nuclear proteins that contain a highly conserved nucleoside triphosphate binding motif, and are evolutionarily and functionally conserved in eukaryotes (9). Members of the MCM2-7 family have been reported to be upregulated in various cancer tissues and cancer cell lines, including brain tumors, lymphomas, and breast, lung and prostate cancers (10–14). For example, MCM2 has been shown to be associated with the malignant status of lung squamous cell carcinoma and to regulate the proliferation and cell cycle in this type of cancer (13).

MCM6 is an important component of the MCM2-7 complex and is upregulated in a number of tumors, including HCC (15–17). MCM6 promotes the metastasis of HCC via the MEK/ERK pathway and may serve as a serum biomarker for early recurrence (15). In addition, MCM6 expression is inversely correlated with methyl(R217) human antigen R and is a prognostic marker in non-small cell lung carcinoma (16).

In the present study the role of MCM2-7 in HCC was investigated and the effect of the knockdown of members of this family on the proliferation of human HCC cells was evaluated. The homeostasis of MCM2, MCM3, MCM6 and MCM7 was then investigated. Also, as only MCM6 was found to be mainly degraded by the proteasome pathway, it was selected for further study. Ring finger protein 125 (RNF125) was identified as an E3 ubiquitin ligase for MCM6 and the relationship of these two proteins in HCC was investigated.

Materials and methods

Data analysis using public databases
Gene expression profiling interactive analysis 2 (GEPIA2)

GEPIA2 (http://gepia2.cancer-pku.cn) is a tool for the gene expression analysis of sequencing data from The Cancer Genome Atlas and the Tissue Genotype Expression database (18). In the present study, GEPIA2 was used to evaluate the mRNA expression of MCM2-7 and RNF125 in human liver HCC (LIHC) and calculate P-values using Student's t-test; an absolute log2 fold change ≥0.5 and P<0.05 were considered to indicate a significant difference. GEPIA2 was also used to perform a prognostic value analysis by the calculation of overall survival and disease-free survival rates and survival graphs were directly generated by GEPIA2, with the log-rank test the only option for analysis. The associations between different MCMs and the clinical outcomes of LIHC, and the associations between the mRNA expression of certain MCMs and the pathological stage of LIHC were also assessed using GEPIA2.

University of alabama cancer database (UALCAN)

UALCAN (http://ualcan.path.uab.edu) is a comprehensive and interactive web resource for the analysis of cancer omics data (19). The protein levels of MCM2-7 in human LIHC were assessed using UALCAN, and Student's t-test was used to generate P-values.

Plasmid construction

Plasmids containing RNF125 and MCM2-7 were purchased from Shanghai Cell Researcher Biotech Co., Ltd. and inserted into empty vectors, which were purchased from Cell Researcher Biotech Co., Ltd.), such as pCDH, pCDNA3.0-Myc, pET22b or pGEX4T-1. Briefly, pCDH-MCM2/MCM3/MCM6/MCM7/RNF125, pCDNA3.0-RNF126-Myc, pET22b-MCM2/MCM3/MCM6/MCM7/RNF125/UBA1/UBCH5A/catalytic core of human ubiquitin specific peptidase 2 (Usp2cc) and pGEX4T-1-MCM6/RNF125 were generated. Mutations were generated in plasmids containing RNF125 or MCM6 by site-directed mutagenesis as previously described (20). Short hairpin RNAs (shRNAs) inserted into the Plko.1 vector targeting RNF125 and MCM2, MCM3, MCM6 and MCM7 were also purchased from Shanghai Cell Researcher Biotech Co., Ltd., and the specific sequences of these shRNAs are shown in Table I.

Table I.

Sequences of the shRNAs targeting MCM2-7 and RNF125.

Table I.

Sequences of the shRNAs targeting MCM2-7 and RNF125.

shRNATarget site sequence (5′-3′)
shNC GCGCGATAGCGCTAATAATTT
shMCM2-1 GCACAAGGTACGTGGTGATAT
shMCM2-2 CTATCAGAACTACCAGCGTAT
shMCM2-3 CGCATCCATCTGCGGGACTAT
shMCM2-4 CGAGGAGTGTGTCTCATTGAT
shMCM3-1 GCCTCCATTGATGCTACCTAT
shMCM3-2 GCCACAGATGATCCCAACTTT
shMCM3-3 CCAGGGAATTTATCAGAGCAA
shMCM3-4 CGGCAGGTATGACCAGTATAA
shMCM6-1 CCCGCAGTTTAGAAGTAATTT
shMCM6-2 CCTAACTACTTGCTCGAAGAT
shMCM6-3 CCTTTCTTATAGGCTGGTCTT
shMCM6-4 CCCGATTCGATCTCTTCTTTA
shMCM7-1 GCGCAGATTTGAGCTGTATTT
shMCM7-2 GCTAGTAAGGATGCCACCTAT
shMCM7-3 GTGGACTCAATTTGTGAGAAT
shMCM7-4 GTGGAGAAAGAAGATGTGAAT
shRNF125-1 CCGTTTAATACCCGATGAGAA
shRNF125-2 GAATCACTCGAACACCACATA
shRNF125-3 GCTTGCTGGATCATTGTATTA
shRNF125-4 CTGTCCACTTTGCCGTTTAAT

[i] sh, short hairpin; MCM, minichromosome maintenance protein; RNF125, ring finger protein 125; NC, negative control.

Cell culture, transfection and reagents

The human HCC cell lines Huh7 and Hep3B were purchased from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences. These cells were cultured in DMEM (high glucose) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and 100 µg/l penicillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.). The plasmids were transfected into the cells using Lipofectamine® 2000 (Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. The ratio of the mass of nucleic acid (plasmid) to the volume of Lipofectamine 2000 was 1:2 (2 µg:4 µl), which was mixed together at room temperature for 20 min, and then added to cells for continued culture at 37°C. Stably expressed cell lines were generated using puromycin selection (2 µg/ml; Beyotime Institute of Biotechnology) for ≥7 days after 48 h transfection. Cycloheximide (CHX; Selleck Chemicals) was dissolved in dimethyl sulfoxide (Sigma-Aldrich; Merck KGaA) at a concentration of 100 mM and stored at −40°C. Huh7 and Hep3B cells were treated with 100 µM CHX for 6 h, or at different time periods, at 37°C. For protein degradation pathway analysis, Huh7 cells were treated with 1 µM proteasomal inhibitor bortezomib (BTZ; Selleck Chemicals) or 20 nM autophagy inhibitor bafilomycin (BAF; Selleck Chemicals) for 6 h at 37°C prior to western blotting.

Cell proliferation assay

Huh7 and Hep3B cells stably expressing plasmids containing pCDH-MCMs, pCDH-RNF125 or pLKO.1-shMCMs, were seeded in 96-well plates at 5,000 cells/well. These cells were then incubated with Cell Counting Kit-8 (CCK-8) solution (Beyotime Institute of Biotechnology) for 4 h at different time points (0, 24, 48 or 72 h). The 0 h time point was 6 h after the cells were seeded in the plates. The product was then quantified by spectrophotometry at a wavelength of 450 nm using a microplate reader (Bio-Rad Laboratories, Inc.). These experiments were performed with six replicates and repeated three times.

Colony formation assay

Cells stably expressing plasmids containing pCDH-MCMs, pCDH-RNF125 or pLKO.1-shMCMs were seeded into 6-well plates (1,000 cells/well). After 7 days culturing at 37°C, the cells were fixed with 4% paraformaldehyde (Merck KGaA) for 10 min at room temperature and then stained with 0.2% crystal violet (Beyotime Institute of Biotechnology) at room temperature for 15 min. Images were captured using an iPhone 11 camera (Apple, Inc.) and the number of colonies (≥50 cells) was manually counted using a light-field microscope (CKX53; Olympus, Inc.).

Yeast two-hybrid screening

The yeast two-hybrid (Y2H) screen was performed as described previously (21). Briefly, human MCM6 was used as bait, and its potential E3 ligase was screened from a library containing ~400 open reading frames (ORFs) of human E3 ubiquitin ligases. The positive colony was able to survive in SD-4 medium (deficient in uracil, histidine, leucine and tryptophan) and could be stained with X-Gal (Sangon Biotech Co., Ltd.).

Recombinant protein purification

Hexahistidine (His6)- and glutathione S-transferase (GST)-tagged proteins were purified from the BL21 E. coli system as described previously (22). Briefly, after induction with isopropyl-β-d-mercapto-galactopyranoside (Sigma-Aldrich), the cells transfected with protein-encoding plasmids were centrifuged, lysed in PBS buffer (137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4 and 2 mM KH2PO4, pH 7.4), incubated with Ni2+ or glutathione affinity gels, and eluted with 500 mM imidazole or 25 mM reduced L-glutathione solution (pH 8.0). The eluate was then dialyzed in PBS buffer containing 10% glycerol for 6 h at 4°C and stored at −70°C.

GST pull-down assay

Purified GST-tagged protein (10 µg), His6-tagged protein (10 µg) and 25 µl Glutathione Sepharose 4B (Sangon Biotech Co., Ltd.) were incubated for 4 h at 4°C in 800 µl GST pull-down buffer [20 mM Tris-Cl, 5 mM MgCl2, 100 mM NaCl, 1 mM EDTA, 1% NP-40 and fresh 1 mM dithiothreitol (DTT), pH 7.6] supplemented with fresh 10 mg/ml BSA. The samples were pelleted via centrifugation at 500 × g for 3 min at 4°C and washed five times with GST pull-down buffer. The immunoprecipitates were then denatured in 50 µl of 2X SDS protein loading buffer at 100°C for 10 min before immunoblotting (IB).

In vitro ubiquitination assay

In vitro ubiquitination was performed as described previously (23). Briefly, 50 ng recombinant His6-UBA1 (an E1 or ubiquitin-activating enzyme), 100 ng His6-UBCH5A (an E2 or ubiquitin-conjugating enzyme), 200 ng GST-RNF125 (E3), 200 ng MCM6-His6 and 50 ng His6-ubiquitin were added to in vitro ubiquitination buffer (25 mM Tris-Cl, 100 mM NaCl, 5 mM MgCl2, pH 7.8, supplemented with 1 mM fresh ATP and 0.5 mM DTT) to a final volume of 50 µl, and incubated at 37°C for 1.5 h. Subsequently, 50 ng His6-tagged Usp2cc was added to the tube containing E1, E2, E3 and MCM6 and incubated at 37°C for a further 30 min. The level of MCM6 ubiquitination was detected by IB analysis using anti-MCM6 antibody.

Co-immunoprecipitation (Co-IP), immunoprecipitation (IP) and IB

For the Co-IP assay, transfected Huh7 and Hep3B cells were lysed in 800 µl Co-IP buffer (50 mM Tris-HCl, 1% NP-40, 150 mM NaCl and 5 mM EDTA, pH 7.6) supplemented with fresh protease inhibitor cocktail (Roche Diagnostics). The cell lysates were then incubated with anti-MCM6 antibody (1:100 dilution; 13347-2-AP; Wuhan Sanying Biotechnology) and 25 µl Protein G magnetic beads (L-1002; Biolinkedin) overnight at 4°C. For the IP assay, Huh7 and Hep3B cells were lysed in 800 µl RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 5 mM EDTA, 1% NP-40 and 0.1% SDS, pH 7.6) containing fresh protease inhibitor cocktail. Then, the cell lysates were incubated with the anti-MCM6 antibody (1:100 dilution) and 25 µl Protein G magnetic beads overnight at 4°C. The next day, the immunoprecipitates were pelleted via centrifugation at 500 × g for 3 min at 4°C and washed five times with Co-IP/IP buffer. Then, the immunoprecipitates were denaturated for 15 min at 100°C in 50 µl 2X SDS protein loading buffer. The immunoprecipitates, inputs and other lysates (10 µl) were subjected to 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes (MilliporeSigma). The membranes were blocked with 10% non-fat milk at room temperature for 45 min before incubation with the following antibodies: Anti-MCM2 (1:1,000 dilution; 10513-1-AP), anti-MCM3 (1:1,000 dilution; 15597-1-AP), anti-MCM6 (1:1,000 dilution), anti-MCM7 (1:1,000 dilution; 11225-1-AP), anti-GAPDH (1:6,000 dilution; 60004-1-Ig), anti-RNF125 (1:2,000 dilution; 13290-1-AP), anti-His (1:2,000 dilution; 66005-1-Ig), anti-GST (1:10,000 dilution; HRP-66001) or anti-ubiquitin (1:2,000, 10201-2-AP), all from Wuhan Sanying. The membranes were incubated with primary antibodies overnight at 4°C, and washed three times with TBST (50 mM Tris-HCl, 150 mM NaCl and 0.2% Tween-20; pH 8.0). Subsequently the membranes were incubated with the following horseradish peroxidase-labeled secondary antibodies: Goat anti-mouse IgG (1:10,000 dilution; SA00001-1) or goat anti-rabbit IgG (1:10,000 dilution; SA00001-2), both from Wuhan Sanying, at room temperature for 2 h and washed three times with TBST. The signals were visualized using high-signal ECL western blotting substrate (cat. no. 180-5001; Tanon Science and Technology Co., Ltd.) and a Tanon 5200 imaging system (Tanon Science and Technology Co., Ltd.).

Statistical analysis

Data are expressed as the mean ± SD and were analyzed by Student's t-test or one-way ANOVA with Tukey's post hoc test using GraphPad Prism 5 (GraphPad Software; Dotmatics). P<0.05 was considered to indicate a statistically significant difference.

Results

High expression levels of MCM2-7 in patients with LIHC predict poor overall survival rates

The mRNA and protein expression levels of genes encoding the MCM2-7 complex in human LIHC were analyzed using the GEPIA2 and UALCAN databases, respectively, and found to be significantly upregulated in LIHC compared with the corresponding normal tissues at the mRNA and protein levels (Fig. 1A and B).

Figure 1.

Expression levels and prognostic values of MCM2-7 in human LIHC. (A) mRNA expression levels of MCM2-7 in human LIHC and corresponding normal tissues were analyzed using the GEPIA2 database. *P<0.05. (B) Protein expression levels of MCM2-7 in human hepatocellular carcinoma and corresponding normal tissues were analyzed using the UALCAN database. Z-values represent standard deviations from the median. Log2 spectral count ratio values from CPTAC were first normalized within each sample profile, and then normalized across samples. **P<0.01. (C) Association of overall survival with MCM2/3/6/7 in LIHC analyzed using the GEPIA2 database. (D) Overall survival rates in patients with LIHC according to the expression levels of MCMs were analyzed using the GEPIA2 database. MCM, minichromosome maintenance protein; LIHC, liver hepatocellular carcinoma; CPTAC, Clinical Proteomic Tumor Analysis Consortium; HR, hazard ratio; p(HR), P-value for the HR; TPM, transcript per million.

The associations between different MCMs and the clinical outcomes of LIHC were analyzed using GEPIA2 (Fig. 1C). Stronger associations were observed for MCM2, MCM3, MCM6 and MCM7 than for MCM4 and 5. The associations between the mRNA expression of certain MCMs and the pathological stage of LIHC were also assessed using GEPIA2. The mRNA expression levels in the MCM2, MCM3, MCM6 and MCM7 groups were highly variable, and gradually increased with the progression of LIHC in the first three stages, but then markedly decreased in stage IV (Fig. S1A). In addition, patients with LIHC who had high mRNA expression levels of MCM2, MCM3, MCM6 and MCM7 showed poor overall and disease-free survival rates (Figs. 1D and S1B). Therefore, these four genes were selected for further study.

Knockdown of MCMs inhibits the proliferation of HCC cells

shRNAs targeting MCM2, MCM3, MCM6 and MCM7 were constructed and stably transfected into human Huh7 and Hep3B cells. The knockdown efficiencies were detected by IB analysis (Fig. 2A). On the basis of these results, shMCM2-1 and shMCM2-4 for MCM2, shMCM3-2 and shMCM3-4 for MCM3, shMCM6-1 and shMCM6-2 for MCM6, and shMCM7-1 and shMCM7-2 for MCM7 were selected for further study. The viability of Huh7 and Hep3B cells was determined by CCK-8 assay at different time points (0, 24, 48 and 72 h), and cell growth inhibition was observed in the MCM2/3/6/7-knockdown cells compared with that of the negative control (scramble) groups (Fig. 2B). Colony formation assays were also performed, the results of which were highly consistent with those of the CCK-8 assay (Fig. 2C). In addition, wound healing assays were performed and MCM2/3/6/7-knockdown exhibited no evident effect on the migration of Huh7 cells (data not shown).

Figure 2.

Knockdown of MCMs inhibits the proliferation of HCC cells. (A) Knockdown efficiency of shRNAs targeting MCM2, MCM3, MCM6 and MCM7 as revealed by the IB analysis of Huh7 and Hep3B HCC cells. (B) Knockdown of MCM2, MCM3, MCM6 or MCM7 inhibited the proliferation of HCC cells, as revealed by the cell viability detected using a Cell Counting Kit-8 assay at different time points. The 0 h time point was defined as 6 h after cell seeding. This experiment was repeated three times with six replicates. *P<0.05, **P<0.01. (C) Knockdown of MCM2, MCM3, MCM6 or MCM7 inhibited the colony formation of HCC cells. Three samples were tested per group. **P<0.01. MCM, minichromosome maintenance protein; HCC, hepatocellular carcinoma; sh, short hairpin; IB, immunoblotting; scramble, negative control shRNA.

MCMs promote the proliferation of HCC cells

Huh7 and Hep3B cells were stably transfected with pCDH or pCDH-MCM2/3/6/7 and the expression of the MDMs was detected by IB analysis (Fig. 3A). The viability of the transfected Huh7 and Hep3B cells was then determined by CCK-8 assay at various time points, and cell growth promotion was observed in the pCDH-MCM groups compared with the pCDH control groups (Fig. 3B). The results of colony formation assays were consistent with the results of the CCK-8 assay (Fig. 3C).

Figure 3.

MCMs promote the proliferation of HCC cells. (A) Overexpression efficiency of MCM2, MCM3, MCM6 and MCM7 vectors in Huh7 and Hep3B cells as determined by IB. (B) Overexpression of MCM2, MCM3, MCM6 or MCM7 promoted the proliferation of Huh7 and Hep3B cells as revealed by the cell viability detected using a Cell Counting Kit-8 assay at different time points. The 0 h time point was defined as 6 h after cell seeding. This experiment was repeated three times with six replicates. *P<0.05. (C) Overexpression of MCM2, MCM3, MCM6 or MCM7 promoted the colony formation of HCC cells. Three samples were tested per group. *P<0.05. MCM, minichromosome maintenance protein; HCC, hepatocellular carcinoma; IB, immunoblotting.

RNF125 interacts with MCM6

The pathways of MCM2, MCM3, MCM6 and MCM7 protein degradation were explored. Huh7 cells were treated with the proteasomal inhibitor BTZ or the autophagy inhibitor BAF for 6 h before being subjected to IB analysis. The results shown in Fig. 4A indicate that endogenous MCM6 protein is degraded mainly by the proteasome pathway, and that neither of these degradation pathways affect the other three MCMs. To investigate the regulation of MCM6 protein homeostasis, MCM6 was used as a bait to screen for its interacting partners using the Y2H prey library which contains ~400 ORFs of human E3 ubiquitin ligases. The E3 ligase RNF125 was identified as an interacting partner for MCM6 and verified in yeast cells (Fig. 4B). A direct interaction between RNF125 and MCM6 was detected by GST pull-down assay (Fig. 4C), whereas no interaction of RNF125 with MCM2, MCM3 or MCM7 was found (Fig. 4D). Protein-protein interaction domain analysis revealed that the MCM domain of MCM6 directly interacted with the N-terminal region (1–135 amino acids) of RNF125 containing the RING domain (Fig. 4E). Further Co-IP assays showed that endogenous MCM6 formed a complex with RNF125 in both Huh7 and Hep3B cells (Fig. 4F). These data indicate that RNF125 does indeed interact with MCM6.

Figure 4.

RNF125 interacts with MCM6. (A) Treatment of Huh7 cells with proteasome inhibitor BTZ (1 µmol/l) or autophagy inhibitor BAF (20 nmol/) for 6 h prior to IB analysis indicates that endogenously expressed MCM6 primarily undergoes proteasome-dependent degradation. (B) RNF125 is shown to be an interacting partner for MCM6 using the yeast two-hybrid method, where SD-2 is deficient in leucine and tryptophan, and SD-4 is deficient in uracil, histidine, leucine and tryptophan. (C) Direct interaction between RNF125 and MCM6 was detected by GST PD assay using recombinant GST-RNF125 and MCM6-His6; the GST PD assay was evaluated using IB analysis. (D) No interaction of RNF125 with MCM2, MCM3, and MCM7 was detected by GST pull-down assay with IB analysis. (E) The N-terminal region (1–76 amino acids) containing the RING domain of RNF125 directly interacted with the MCM domain of MCM6. (F) GST PD assays and IB analysis showed that endogenously expressed MCM6 forms a complex with RNF125. The lysates of Huh7 and Hep3B cells were immunoprecipitated with IgG or anti-MCM6 antibody and subjected to IB analysis. RNF125, ring finger protein 125; MCM, minichromosome maintenance; BTZ, bortezomib; BAF, bafilomycin; IB, immunoblotting; GST, glutathione S-transferase; PD, pull-down; Co-IP, co-immunoprecipitation.

RNF125 promotes the ubiquitination and degradation of MCM6

To investigate whether RNF125 affects the stability of the MCM6 protein, Huh7 and Hep3B cells were transfected to express different amounts of RNF125, and the protein levels of MCM6 were detected by IB analysis. The results shown in Fig. 5A show that RNF125 reduced the protein levels of MCM6 in a dose-dependent manner. An in vitro ubiquitination assay was carried out, as shown in Fig. 5B. In the presence of E1 (UBA1), E2 (UBCH5A) and E3 (RNF125), the ubiquitination of MCM6 was detectable by IB analysis, and this modification was efficiently attenuated by Usp2cc. Huh7 and Hep3B cells were stably transfected with empty vector (pCDH) or pCDH-RNF125 and the upregulation of RNF125 by pCDH-RNF125 was confirmed by IB analysis (Fig. 5C). The lysates of the transfected Huh7 and Hep3B cells were immunoprecipitated with anti-MCM6 antibody, and the results revealed that the ubiquitination of MCM6 was markedly increased in cells stably expressing pCDH-RNF125 compared with the control cells (Fig. 5D). Three shRNAs targeting RNF125 were designed and tested in human Huh7 and Hep3B cells. shRNF125-2 and shRNF125-3 performed well in the knockdown of RNF125 and were selected for further study (Fig. 5E). The protein levels of endogenous MCM6 were increased in the RNF125-knockdown cells compared with the control cells in the presence of the protein synthesis inhibitor CHX (Fig. 5F). In addition, RNF125 knockdown reduced the ubiquitination of MCM6 and concurrently increased MCM6 protein levels in Huh7 and Hep3B cells (Fig. 5G). These data suggest that RNF125 is an E3 ligase for MCM6 and promotes its degradation.

Figure 5.

RNF125 promotes the ubiquitination and degradation of MCM6. (A) RNF125 promotes the degradation of MCM6 in a dose-dependent manner, as revealed in Huh7 and Hep3B cells transiently transfected with different amounts of pCDNA3.0-RNF125-Myc or empty vectors and subjected to IB analysis. (B) An in vitro ubiquitination assay was performed, and the ubiquitination of MCM6 using different ubiquitination enzymes was detected by IB analysis. The results indicates that RNF125 mediates the ubiquitination of MCM6 in vitro. (C) Detection of the protein levels of RNF125 in the lysates of Huh7 and Hep3B cells stably expressing pCDH or pCDH-RNF125. (D) RNF125 promotes the ubiquitination of endogenous MCM6, as revealed by immunoprecipitation of the transfected cells with anti-MCM6 antibody followed by IB analysis. (E) Knockdown efficiency of shRNAs targeting RNF125 in Huh7 and Hep3B cells detected by IB analysis. (F) RNF125 knockdown stabilizes MCM6 in Huh7 and Hep3B cells treated with CHX for different time periods prior to IB analysis. (G) RNF125 knockdown reduces the ubiquitination of endogenous MCM6, as demonstrated by the IP of Huh7 and Hep3B cells stably expressing RNF125 shRNAs with anti-MCM6 antibody prior to IB analysis. RNF125, ring finger protein 125; MCM, minichromosome maintenance protein; IB, immunoblotting; sh, short hairpin; CHX, cycloheximide; IP, immunoprecipitation; Usp2cc, catalytic core of human ubiquitin specific peptidase 2; scramble, negative control.

RNF125 promotes the proliferation of HCC cells mainly through MCM6

pCDH-RNF125 or empty vector (pCDH) was stably transfected into Huh7 and Hep3B cells that also stably expressed scramble shRNA, shMCM6-1 or shMCM6-2, and the protein levels of RNF125 and MCM6 were detected by IB analysis (Fig. 6A). The results of CCK-8 and colony formation assays performed using these cells revealed that RNF125 inhibited the proliferation and colony formation of Huh7 and Hep3B cells with intact MCM6, but not of MCM6 knockdown cells (Fig. 6B and C). These data suggest that RNF125 promotes the proliferation of HCC cells mainly through MCM6. The expression of RNF125 in human LIHC was analyzed using the GEPIA2 database. As shown in Fig. 6D, the expression of RNF125 was downregulated in LIHC compared with normal tissues at the mRNA level. The association between RNF125 and the clinical outcome of LIHC was also analyzed, and the results showed that patients with LIHC and high mRNA expression of RNF125 had a higher overall survival rate (Fig. 6E). These findings suggest that RNF125 is a potential therapeutic target for human HCC.

Figure 6.

RNF125 promotes the proliferation of HCC cells mainly though MCM6. (A) Detection of the protein expression levels of RNF125 and MCM6 in Huh7 and Hep3B cells stably expressing scramble or MCM6 shRNAs with or without transfection with plasmids containing RNF125 using IB analysis. (B) RNF125 promotes the proliferation of HCC cells via MCM6. The viability of Huh7 and Hep3B cells co-transfected with plasmids expressing RNF125 and shRNAs targeting MCM6 was detected by Cell Counting Kit-8 assay. The experiment was repeated three times with six replicates. *P<0.05, **P<0.01. (C) RNF125 promotes the colony formation of HCC cells though MCM6 in Huh7 and Hep3B cells. Three samples were tested per group. **P<0.01. (D) RNF125 mRNA expression in human LIHC and corresponding normal tissues as analyzed using the GEPIA2 database. *P<0.05. (E) Overall survival rates in patients with LIHC according to the expression level of RNF125 were analyzed using the GEPIA2 database. RNF125, ring finger protein 125; HCC, hepatocellular carcinoma; MCM, minichromosome maintenance protein; scramble, negative control; sh, short hairpin; IB, immunoblotting; HR, hazard ratio; p(HR), P-value for the HR; TPM, transcript per million.

Discussion

In the present study, the expression levels and prognostic values of MCM2-7 in human HCC were first analyzed using a public database, and the results suggested that MCM2, MCM3, MCM6 and MCM7 may serve as prognostic markers. The proliferation of human HCC cells was hindered by the knockdown of any of the four MCMs, while the promotion of HCC cell proliferation through the overexpression of these MCMs was shown to have limited effect. It is hypothesized that this may be due to the fact that the MCM complexes function as a complete unit (9); thus, increasing only one type has minimal effects. The homeostasis of these four MCMs was then investigated using a proteasomal or autophagy inhibitor, and the results indicated that only MCM6 was degraded by the proteasome pathway. In addition, RNF125 was identified as an E3 ligase for MCM6, which promoted its ubiquitination and degradation. Further experiments showed that RNF125 promoted the proliferation of HCC cells mainly through MCM6.

The ubiquitin-proteasome pathway is a highly selective protein degradation pathway, which efficiently degrades intracellular proteins and plays an important role in cell proliferation, metabolism and differentiation (24,25). Dysfunction of ubiquitination has been indicated to lead to numerous issues, including cancers and neurodegenerative diseases (22,26,27). RNF125 is a RING-type E3 ubiquitin ligase that features an N-terminal RING domain. Various substrates for RNF125 have been reported, including programmed death-ligand 1 and tripartite motif containing 14 (28,29). The present study has identified MCM6 as a novel substrate for RNF125. Furthermore, it has established that RNF125 primarily impedes the proliferation of HCC cells through MCM6. In addition, analysis using publicly available databases revealed that the expression of RNF125 was lower in LIHC compared with corresponding normal tissues. Moreover, a higher expression level of RNF125 was found to be associated with improved overall survival in patients with LIHC. These findings are consistent with those reported in a previous study (30).

To the best of our knowledge, RNF125 is the first E3 ligase identified for MCM6. Various studies have shown that MCM6 can interact with the E3 ligase UBE3A/E6AP (31,32). However, UBE3A/E6AP is incapable of mediating the ubiquitination of MCM6 (32). Notably, the present study demonstrated that RNF125 does not interact with other MCM family members such as MCM3, MCM2 and MCM7. With the exception of MCM7 (33), no E3 ligases have been reported for other MCM family proteins. The knockdown of MCM2, MCM3 or MCM7 also inhibited the proliferation of HCC cells, indicating that the balance of these proteins is also critical.

The present research has certain limitations. Firstly, the mechanism by which RNF126-MCM6 ubiquitin signaling controls the growth of HCC cells was not examined. Secondly, the findings were not validated in animal models and clinical specimens. Furthermore, the survival analyses were performed using GEPIA2 with the log-rank test the only option for analysis; therefore, it was not possible to exclude the late-stage crossover from the analysis, which may affect the results of the analysis. Therefore, endeavors to test the functions of RNF125-MCM6 axis in animal models and patient samples of LIHC are ongoing. In conclusion, RNF125 and MCM6 are two promising targets for the treatment of LIHC.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

The study was financially supported by the Department of Education of Anhui Province (grant no. 2022AH050774) and the Foundation of Lu'an People's Hospital (grant no. 2022kykt30).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

XF, DS, XL, YL and PJ performed experiments and data analysis. XF, SW and FL designed and supervised the study. XF and FL wrote the manuscript and provided financial support. XF and FL confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Siegel RL, Miller KD, Wagle NS and Jemal A: Cancer statistics, 2023. CA Cancer J Clin. 73:17–48. 2023. View Article : Google Scholar : PubMed/NCBI

2 

Cho SH, You GR, Park C, Cho SG, Lee JE, Choi SK, Cho SB and Yoon JH: Acute respiratory distress syndrome and severe pneumonitis after atezolizumab plus bevacizumab for hepatocellular carcinoma treatment: A case report. World J Gastrointest Oncol. 15:892–901. 2023. View Article : Google Scholar : PubMed/NCBI

3 

Ferrante ND, Pillai A and Singal AG: Update on the diagnosis and treatment of hepatocellular carcinoma. Gastroenterol Hepatol (NY). 16:506–516. 2020.PubMed/NCBI

4 

Le DC, Nguyen TM, Nguyen DH, Nguyen DT and Nguyen LTM: Survival outcome and prognostic factors among patients with hepatocellular carcinoma: A hospital-based study. Clin Med Insights Oncol. 17:117955492311781712023. View Article : Google Scholar : PubMed/NCBI

5 

Marin JJG, Macias RIR, Monte MJ, Romero MR, Asensio M, Sanchez-Martin A, Cives-Losada C, Temprano AG, Espinosa-Escudero R, Reviejo M, et al: Molecular bases of drug resistance in hepatocellular carcinoma. Cancers (Basel). 12:16632020. View Article : Google Scholar : PubMed/NCBI

6 

Saito A, Toyoda H, Kobayashi M, Koiwa Y, Fujii H, Fujita K, Maeda A, Kaneoka Y, Hazama S, Nagano H, et al: Prediction of early recurrence of hepatocellular carcinoma after resection using digital pathology images assessed by machine learning. Mod Pathol. 34:417–425. 2021. View Article : Google Scholar : PubMed/NCBI

7 

Wang Y, Chen H, Zhang J, Cheng ASL, Yu J, To KF and Kang W: MCM family in gastrointestinal cancer and other malignancies: From functional characterization to clinical implication. Biochim Biophys Acta Rev Cancer. 1874:1884152020. View Article : Google Scholar : PubMed/NCBI

8 

Zhou J, Wang M, Zhou Z, Wang W, Duan J and Wu G: Expression and prognostic value of MCM family genes in osteosarcoma. Front Mol Biosci. 8:6684022021. View Article : Google Scholar : PubMed/NCBI

9 

Tye BK: MCM proteins in DNA replication. Annu Rev Biochem. 68:649–686. 1999. View Article : Google Scholar : PubMed/NCBI

10 

Cai HQ, Cheng ZJ, Zhang HP, Wang PF, Zhang Y, Hao JJ, Wang MR and Wan JH: Overexpression of MCM6 predicts poor survival in patients with glioma. Hum Pathol. 78:182–187. 2018. View Article : Google Scholar : PubMed/NCBI

11 

Marnerides A, Vassilakopoulos TP, Boltetsou E, Levidou G, Angelopoulou MK, Thymara I, Kyrtsonis MC, Pappi V, Tsopra O, Panayiotidis P, et al: Immunohistochemical expression and prognostic significance of CCND3, MCM2 and MCM7 in Hodgkin lymhoma. Anticancer Res. 31:3585–3594. 2011.PubMed/NCBI

12 

Wojnar A, Pula B, Piotrowska A, Jethon A, Kujawa K, Kobierzycki C, Rys J, Podhorska-Okolow M and Dziegiel P: Correlation of intensity of MT-I/II expression with Ki-67 and MCM-2 proteins in invasive ductal breast carcinoma. Anticancer Res. 31:3027–3033. 2011.PubMed/NCBI

13 

Wu W, Wang X, Shan C, Li Y and Li F: Minichromosome maintenance protein 2 correlates with the malignant status and regulates proliferation and cell cycle in lung squamous cell carcinoma. Onco Targets Ther. 11:5025–5034. 2018. View Article : Google Scholar : PubMed/NCBI

14 

Stewart PA, Khamis ZI, Zhau HE, Duan P, Li Q, Chung LWK and Sang QA: Upregulation of minichromosome maintenance complex component 3 during epithelial-to-mesenchymal transition in human prostate cancer. Oncotarget. 8:39209–39217. 2017. View Article : Google Scholar : PubMed/NCBI

15 

Liu M, Hu Q, Tu M, Wang X, Yang Z, Yang G and Luo R: MCM6 promotes metastasis of hepatocellular carcinoma via MEK/ERK pathway and serves as a novel serum biomarker for early recurrence. J Exp Clin Cancer Res. 37:102018. View Article : Google Scholar : PubMed/NCBI

16 

Vigouroux C, Casse JM, Battaglia-Hsu SF, Brochin L, Luc A, Paris C, Lacomme S, Gueant JL, Vignaud JM and Gauchotte G: Methyl(R217)HuR and MCM6 are inversely correlated and are prognostic markers in non small cell lung carcinoma. Lung Cancer. 89:189–196. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Zheng T, Chen M, Han S, Zhang L, Bai Y, Fang X, Ding SZ and Yang Y: Plasma minichromosome maintenance complex component 6 is a novel biomarker for hepatocellular carcinoma patients. Hepatol Res. 44:1347–1356. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Tang Z, Li C, Kang B, Gao G, Li C and Zhang Z: GEPIA: A web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 45:W98–W102. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Chandrashekar DS, Bashel B, Balasubramanya SAH, Creighton CJ, Ponce-Rodriguez I, Chakravarthi BVSK and Varambally S: UALCAN: A portal for facilitating tumor subgroup gene expression and survival analyses. Neoplasia. 19:649–658. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Li C, Lu W, Yang L, Li Z, Zhou X, Guo R, Wang J, Wu Z, Dong Z, Ning G, et al: MKRN3 regulates the epigenetic switch of mammalian puberty via ubiquitination of MBD3. Natl Sci Rev. 7:671–685. 2020. View Article : Google Scholar : PubMed/NCBI

21 

Wang CC, Peng H, Wang Z, Yang J, Hu RG, Li CY and Geng WJ: TRIM72-mediated degradation of the short form of p62/SQSTM1 rheostatically controls selective autophagy in human cells. Mil Med Res. 9:352022.PubMed/NCBI

22 

Yang Y, Luo Y, Yang C, Hu R, Qin X and Li C: TRIM25-mediated ubiquitination of G3BP1 regulates the proliferation and migration of human neuroblastoma cells. Biochim Biophys Acta Gene Regul Mech. 1866:1949542023. View Article : Google Scholar : PubMed/NCBI

23 

Li C, Han T, Li Q, Zhang M, Guo R, Yang Y, Lu W, Li Z, Peng C, Wu P, et al: MKRN3-mediated ubiquitination of Poly(A)-binding proteins modulates the stability and translation of GNRH1 mRNA in mammalian puberty. Nucleic Acids Res. 49:3796–3813. 2021. View Article : Google Scholar : PubMed/NCBI

24 

Mansour MA: Ubiquitination: Friend and foe in cancer. Int J Biochem Cell Biol. 101:80–93. 2018. View Article : Google Scholar : PubMed/NCBI

25 

Sheng X, Xia Z, Yang H and Hu R: The ubiquitin codes in cellular stress responses. Protein Cell. pwad0452023.(Epub ahead of print). View Article : Google Scholar : PubMed/NCBI

26 

Liu Z, Chen P, Gao H, Gu Y, Yang J, Peng H, Xu X, Wang H, Yang M, Liu X, et al: Ubiquitylation of autophagy receptor Optineurin by HACE1 activates selective autophagy for tumor suppression. Cancer Cell. 26:106–120. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Xu X, Li C, Gao X, Xia K, Guo H, Li Y, Hao Z, Zhang L, Gao D, Xu C, et al: Excessive UBE3A dosage impairs retinoic acid signaling and synaptic plasticity in autism spectrum disorders. Cell Res. 28:48–68. 2018. View Article : Google Scholar : PubMed/NCBI

28 

Jiang C, He L, Xiao S, Wu W, Zhao Q and Liu F: E3 ubiquitin ligase RNF125 suppresses immune escape in head and neck squamous cell carcinoma by regulating PD-L1 expression. Mol Biotechnol. 65:891–903. 2023. View Article : Google Scholar : PubMed/NCBI

29 

Jia X, Zhou H, Wu C, Wu Q, Ma S, Wei C, Cao Y, Song J, Zhong H, Zhou Z and Wang J: The ubiquitin ligase RNF125 targets innate immune adaptor protein TRIM14 for ubiquitination and degradation. J Immunol. 198:4652–4658. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Feng Z, Ke S, Wang C, Lu S, Xu Y, Yu H, Li Z, Yin B, Li X, Hua Y, et al: RNF125 attenuates hepatocellular carcinoma progression by downregulating SRSF1-ERK pathway. Oncogene. 42:2017–2030. 2023. View Article : Google Scholar : PubMed/NCBI

31 

Martínez-Noël G, Luck K, Kühnle S, Desbuleux A, Szajner P, Galligan JT, Rodriguez D, Zheng L, Boyland K, Leclere F, et al: Network analysis of UBE3A/E6AP-associated proteins provides connections to several distinct cellular processes. J Mol Biol. 430:1024–1050. 2018. View Article : Google Scholar : PubMed/NCBI

32 

Li C, Han T, Guo R, Chen P, Peng C, Prag G and Hu R: An integrative synthetic biology approach to interrogating cellular ubiquitin and ufm signaling. Int J Mol Sci. 21:42312020. View Article : Google Scholar : PubMed/NCBI

33 

Kühne C and Banks L: E3-ubiquitin ligase/E6-AP links multicopy maintenance protein 7 to the ubiquitination pathway by a novel motif, the L2G box. J Biol Chem. 273:34302–34309. 1998. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Feng X, Song D, Liu X, Liang Y, Jiang P, Wu S and Liu F: RNF125‑mediated ubiquitination of MCM6 regulates the proliferation of human liver hepatocellular carcinoma cells. Oncol Lett 27: 105, 2024.
APA
Feng, X., Song, D., Liu, X., Liang, Y., Jiang, P., Wu, S., & Liu, F. (2024). RNF125‑mediated ubiquitination of MCM6 regulates the proliferation of human liver hepatocellular carcinoma cells. Oncology Letters, 27, 105. https://doi.org/10.3892/ol.2024.14238
MLA
Feng, X., Song, D., Liu, X., Liang, Y., Jiang, P., Wu, S., Liu, F."RNF125‑mediated ubiquitination of MCM6 regulates the proliferation of human liver hepatocellular carcinoma cells". Oncology Letters 27.3 (2024): 105.
Chicago
Feng, X., Song, D., Liu, X., Liang, Y., Jiang, P., Wu, S., Liu, F."RNF125‑mediated ubiquitination of MCM6 regulates the proliferation of human liver hepatocellular carcinoma cells". Oncology Letters 27, no. 3 (2024): 105. https://doi.org/10.3892/ol.2024.14238
Copy and paste a formatted citation
x
Spandidos Publications style
Feng X, Song D, Liu X, Liang Y, Jiang P, Wu S and Liu F: RNF125‑mediated ubiquitination of MCM6 regulates the proliferation of human liver hepatocellular carcinoma cells. Oncol Lett 27: 105, 2024.
APA
Feng, X., Song, D., Liu, X., Liang, Y., Jiang, P., Wu, S., & Liu, F. (2024). RNF125‑mediated ubiquitination of MCM6 regulates the proliferation of human liver hepatocellular carcinoma cells. Oncology Letters, 27, 105. https://doi.org/10.3892/ol.2024.14238
MLA
Feng, X., Song, D., Liu, X., Liang, Y., Jiang, P., Wu, S., Liu, F."RNF125‑mediated ubiquitination of MCM6 regulates the proliferation of human liver hepatocellular carcinoma cells". Oncology Letters 27.3 (2024): 105.
Chicago
Feng, X., Song, D., Liu, X., Liang, Y., Jiang, P., Wu, S., Liu, F."RNF125‑mediated ubiquitination of MCM6 regulates the proliferation of human liver hepatocellular carcinoma cells". Oncology Letters 27, no. 3 (2024): 105. https://doi.org/10.3892/ol.2024.14238
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team