Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
May-2026 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2026 Volume 31 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Schisandrin B suppresses cholangiocarcinoma by targeting the ROS/p38 MAPK/NF‑κB axis

  • Authors:
    • Junhao Yang
    • Wenying Long
    • Xiaoxiao Wu
    • Xiaohui Yang
    • Qiang Hong
    • Shuai Wang
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, The Fourth Affiliated Hospital of School of Medicine, and International School of Medicine, International Institutes of Medicine, Zhejiang University, Yiwu, Zhejiang 322000, P.R. China, Department of Medical Research Center, Fourth Affiliated Hospital, Zhejiang University School of Medicine, Yiwu, Zhejiang 322000, P.R. China, Department of Endocrinology, Yiwu Central Hospital, Yiwu, Zhejiang 322000, P.R. China
    Copyright: © Yang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 196
    |
    Published online on: March 26, 2026
       https://doi.org/10.3892/ol.2026.15551
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Schisandrin B (Sch B), a bioactive component isolated from the traditional Chinese medicine Schisandra chinensis, exhibits anti‑tumor activity against cholangiocarcinoma (CCA), though its complete molecular mechanism remains to be fully elucidated. The present study employed an integrated strategy combining network pharmacology for target prediction, molecular docking for binding affinity validation and comprehensive in vitro experiments to investigate the regulation of the reactive oxygen species (ROS)/p38MAPK/NF‑κB signaling axis by Sch B. Computational analyses revealed significant enrichment of Sch B targets in cancer‑related pathways and MAPK signaling, while molecular docking confirmed strong binding to core targets including MAPK1. Experimental validation demonstrated that Sch B dose‑dependently elevated intracellular ROS levels, resulting in suppressed proliferation and induced apoptosis in CCA cells, effects reversible by the ROS scavenger N‑acetyl‑L‑cysteine. Mechanistic studies further identified that Sch B concurrently inhibits p38 MAPK signaling through reduced phosphorylated‑p38 and AP‑1 expression, and suppresses NF‑κB pathway activation by impeding p65 nuclear translocation, leading to diminished release of pro‑inflammatory cytokines IL‑6, IL‑8 and TNF‑α. These findings collectively establish that Sch B exerts its anti‑CCA effects through ROS‑mediated coordinated regulation of both p38MAPK and NF‑κB pathways, underscoring its potential as a multi‑target natural therapeutic agent for CCA treatment and providing a solid foundation for further development.

Introduction

Cholangiocarcinoma (CCA), the second most prevalent primary hepatic malignancy originating from bile duct epithelial cells, accounts for ~15% of all primary liver tumors, with a rising global incidence and mortality (1,2). It is characterized by pronounced pro-fibroplasia, a complex tumor microenvironment, and considerable genetic heterogeneity, all contributing to heightened drug resistance. Non-specific clinical manifestations often lead to delayed diagnoses, precluding timely surgical interventions and resulting in an unfavorable prognosis. Epidemiological data highlight an increasing incidence and mortality, with CCA accounting for 15% of liver malignancies (3–5). Consequently, there is an urgent need to elucidate novel strategies and pharmacological interventions to counteract CCA tumor metastasis and combat chemotherapy resistance.

Schisandrin B (Sch B), derived from the fruit of Schisandra chinensis Baill and used in traditional Chinese medicine, has demonstrated therapeutic efficacy across various malignant tumors, including glioma (6,7), gallbladder cancer (8), breast cancer (9), prostate cancer (10) and hepatic cancer (11), by eliciting anti-proliferative and pro-apoptotic effects. Previous research has indicated mitochondria-mediated intrinsic apoptotic pathways as one of its validated biological mechanisms.

Reactive oxygen species (ROS), byproducts of aerobic metabolism, play a key role in physiological processes and REDOX balance maintenance (12–14). ROS act as initiators and mediators of multiple signal transduction pathways, exerting inhibitory effects on tumor cell proliferation. They are involved in mediating various anti-tumorigenic signaling pathways inducing DNA damage, genetic instability and oxidative stress-associated tumor cell apoptosis (15). Mounting evidence has established that the ROS-activated mitochondria-mediated intrinsic apoptosis pathway represents a central mechanism underlying these effects (16–18). Mitochondria, the main site of oxygen-free radical production, undergo alterations in permeability with increased ROS leading to decreased mitochondrial transmembrane potential (ΔΨm). The resulting decrease in ΔΨm facilitates the release of cytochrome c into the cytoplasm, initiating apoptosis via the caspase pathway (19).

Network pharmacology enables comprehensive target-based functional analysis and prediction of drug components and diseases, thus providing a robust framework for elucidating the complex mechanisms of drug action and disease pathology (20–22). The present study was designed to investigate the anti-CCA mechanism of Sch B using an integrated strategy combining network pharmacology, molecular docking and in vitro experiments, with a focus on the ROS/p38 MAPK/NF-κB signaling pathway. This multi-faceted approach may provide a foundation for understanding the therapeutic potential of Sch B as a natural-derived agent against CCA.

Materials and methods

Network pharmacology

Potential targets of Sch B were predicted using the PharmMapper database (http://www.lilab-ecust.cn/pharmmapper/), followed by standardization via the UniProt database (https://www.uniprot.org/) to obtain relevant target information. Disease-related targets for CCA were retrieved from the GeneCards (https://www.genecards.org/) and DisGeNET databases (https://www.disgenet.org/) using the keyword ‘Cholangiocarcinoma’. After merging datasets, non-human genes and duplicate entries were removed to generate a standardized target list. An EVenn online tool (http://www.ehbio.com/test/venn) was employed to construct a Venn diagram illustrating overlapping targets between Sch B and CCA.

The shared targets were imported into the STRING database (https://string-db.org/) to construct a protein-protein interaction (PPI) network under the ‘Homo sapiens’ setting. Disconnected nodes were hidden, and a high confidence interaction score of ≥0.900 was applied. The resulting network was exported in Tab-Separated Values format and visualized using Cytoscape 3.8.0 (https://cytoscape.org/). Core targets are identified based on three topological parameters: Degree centrality (DC), betweenness centrality (BC) and closeness centrality (CC).

The drug-disease intersection targets were uploaded to the Metascape platform (http://metascape.org/) for gene ontology (GO) (https://geneontology.org/) enrichment analysis, including biological process (BP), cellular component and molecular function (MF) categories. Analysis parameters included a minimum overlap of 3, a P-value cut-off of 0.01 and an enrichment of ≥1.5. The top 10 enriched terms from each GO category were selected based on ascending log P-values. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was performed using the ClueGO plugin in Cytoscape, with thresholds set to include pathways containing ≥16 genes and a κ score >0.6. A total of 11 key pathways were identified as significantly enriched.

Molecular docking analysis

Molecular docking was performed with the selected core targets. The structure of Sch B in .mol2 format was obtained from the TCMSP database (http://tcmsp-e.com/) and prepared using AutoDock Tools-1.5.6 by removing water molecules, adding hydrogen atoms and assigning atom types. Rotatable bonds were defined, and the file was saved in .pdbqt format, which can be opened and used for molecular docking with AutoDock Vina (version 1.1.2; The Scripps Research Institute).

Crystal structures of MAPK1, EGFR, ESR1, HSP90AA1, AKT1, GRB2, SRC, and HRAS in PDB format were retrieved from the PDB database (https://www.wwpdb.org/). Using PyMOL 3.7.1, non-essential small molecules were removed from the protein structures. The proteins were then processed in AutoDock Tools-1.5.6 to remove water molecules, add hydrogens and assign atom types, and these were saved as .pdbqt files.

The prepared Sch B ligand and the eight core protein receptors were subjected to molecular docking using AutoDock Vina with a batch processing script. The binding site and grid parameters were appropriately defined for each target. The resulting binding modes were visualized and analyzed using PyMOL 3.7.1.

Cell lines and culture

Human CCA HuccT1 cell line was sourced from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences. Cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), 100 µg/ml streptomycin and 100 U/ml penicillin (HyClone™; Cytiva) and maintained in a CO2 incubator at 37°C. Upon reaching 80–90% confluency as observed under a microscope, cells were digested with 1 ml of trypsin containing 0.25% EDTA at 37°C for 1–3 min. Digestion was monitored microscopically and terminated immediately when cells became rounded and detached from the culture surface.

Drugs and antibodies

Sch B was purchased from Merck KGaA and dissolved in DMSO (Merk KGaA) to create a 100 mmol/l stock solution. This stock solution was further diluted with culture media to obtain the desired concentrations. The control groups received treatment with equivalent volumes of DMSO. N-acetyl-L-cysteine (NAC) was acquired from BD Biosciences, 2′,7′-dichlorofluorescein diacetate (DCFH-DA) was purchased from Merck KGaA and Bay 11–7082 was purchased from Merck KGaA. Detailed information for all primary and secondary antibodies used in this study, including antibody names, catalog numbers, dilutions and suppliers, is provided in Table I.

Table I.

Details of antibodies.

Table I.

Details of antibodies.

Antibody nameCat. no.DilutionSupplier
Primary antibodies
  BIP31831:1,000Cell Signaling Technology, Inc.
  CHOP28951:1,000Cell Signaling Technology, Inc.
  XBP1s127821:1,000Cell Signaling Technology, Inc.
  Bax50231:1,000Cell Signaling Technology, Inc.
  p-p38 MAPK (Thr180/Tyr182)45111:1,000Cell Signaling Technology, Inc.
  p38 MAPK86901:1,000Cell Signaling Technology, Inc.
  p-p65 NF-κB (Ser536)30331:1,000Cell Signaling Technology, Inc.
  p65 NF-κB82421:1,000Cell Signaling Technology, Inc.
  p-IκBα (Ser32)28591:1,000Cell Signaling Technology, Inc.
  IκBα48141:1,000Cell Signaling Technology, Inc.
  IL-6121531:1,000Cell Signaling Technology, Inc.
  IL-8944071:1,000Cell Signaling Technology, Inc.
  TNF-α69451:1,000Cell Signaling Technology, Inc.
  GAPDH51741:5,000Cell Signaling Technology, Inc.
Secondary antibodies
  Anti-rabbit IgG, HRP-linked70741:3,000Cell Signaling Technology, Inc.
  Anti-mouse IgG, HRP-linked70761:3,000Cell Signaling Technology, Inc.
  AP-labeled Anti-rabbit IgGWB01201:5,00Vigorous Biotechnology Beijing Co., Ltd.

[i] P, phosphorylated; HRP, horse radish peroxidase.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from treated HuccT1 cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Subsequently, 1 µg of RNA from each sample was used for complementary DNA synthesis using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara Bio, Inc.), according to the manufacturer's protocol. For RT-qPCR, TB Green® Premix Ex Taq™ (Takara Bio, Inc.) was used on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.). The thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 45 cycles of denaturation at 95°C for 5 sec and combined annealing/extension at 58°C for 30 sec. All reactions were performed in triplicate. The relative expression levels of target genes were normalized to GAPDH and calculated using the 2−ΔΔCq method (23). The primer sequences are listed in Table II.

Table II.

Primer sequences.

Table II.

Primer sequences.

Target genePrimer sequence (5′ to 3′)
GAPDH-FP GAAGGTGAAGGTCGGAGTC
GAPDH-RP GAAGATGGTGATGGGATTTC
XBP1s-FP AGGAGTTAAGACAGCGCTTGGGG
XBP1s-RP AATACCTGCACCTGCTGCGGACTCAGCAGA
BIP-FP TGACATTGAAGACTTCAAAGCT
BIP-RP CTGCTGTATCCTCTTCACCAGT
CHOP-FP CAACTGCAGAGATGGCAGCTGA
CHOP-RPCTGATGCTCCCAATT GTTCAT
IL6-FP TCAGGGATGCAATGCCACTT
IL6-RP TGCAGAAGAGAGCCAACCAA
IL8-FP ACAAGCTTCTAGGACAAGAGCC
IL8-RP ACTTCTCCACAACCCTCTGC
TNFα-FP CGAGTGACAAGCCTGTAGC
TNFα-RP CCTTCTCCAGCTGGAAGAC

[i] FP, forward primer; RP, reverse primer.

Western blot analysis

HuccT1 cells were treated with various concentrations of Sch B (0, 40, 80 and 160 µM) for 48 h at 37°C. After treatment, cells were harvested and lysed on ice using RIPA buffer (Beyotime Biotechnology) supplemented with a protease inhibitor cocktail (Roche Applied Science) for 15 min. The lysates were centrifuged at 13,500 × g for 30 min at 4°C to collect the supernatant. Protein concentration was determined using the BCA assay. Subsequently, 60 µg of total protein per sample was separated by SDS-PAGE on 10% polyacrylamide gels and electrophoretically transferred onto PVDF membranes (MilliporeSigma). Following transfer, the membranes were blocked with 5% skim milk prepared in Tris-buffered saline with Tween-20 (TBST) for 2 h at room temperature. The membranes were then incubated overnight at 4°C with the indicated primary antibodies (Table I). After incubation, the membranes were washed three times for 10 min each with TBST. A total of two distinct detection systems were employed: Horseradish Peroxidase (HRP)-chemiluminescence detection: For HRP-based detection, the membranes were incubated with appropriate HRP-conjugated secondary antibodies for 1 h at room temperature. After washing with TBST, protein bands were visualized using an enhanced chemiluminescence substrate and imaged with a Gel Doc 2000 system (Bio-Rad Laboratories, Inc.). Alkaline Phosphatase (AP)-colorimetric detection: For AP-based colorimetric detection, an AP western detection kit (Vigorous Biotechnology Beijing Co., Ltd.) was used. After primary antibody incubation and washing, the membranes were probed with AP-conjugated secondary antibodies for 30 to 120 min at room temperature. The membranes were then thoroughly washed 3–5 times with TBST to remove any phosphate residues. A color development solution was freshly prepared immediately before use by adding 0.1 ml of 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 0.1 ml of nitroblue tetrazolium (NBT) per 10 ml of reaction buffer (Vigorous Biotechnology, Beijing Co., Ltd.). After removing the wash buffer, sufficient development solution was added to completely cover the membrane, followed by incubation at room temperature for 5 to 15 min in the dark, with close monitoring of band intensity. The reaction was stopped by rinsing the membrane with distilled water once the target bands were clearly visible with minimal background. The membrane was air-dried and imaged directly.

Measurement of ROS production

HuccT1 cells were prepared as single cell suspensions and then seeded in 6-well plates at a density of 1×106 cells per well in 100 µl of culture medium. Subsequently, the cells were treated with various concentrations of Sch B (0, 40 and 160 µM) for 24 h at 37°C in a CO2 incubator. DCFH-DA was diluted with serum-free medium at a ratio of 1:1,000 to reach a final concentration of 10 µmol/l. The CCA cells were incubated with DCFH-DA at 37°C for 20 min. Following three washes with PBS, the cells were stimulated using a positive control for ROS. Finally, the excitation and emission wavelengths for the fluorescence enzyme were adjusted to 488 and 525 nm, respectively.

Lactate dehydrogenase (LDH) release assay

An LDH release assay was performed according to the manufacturer's protocol (Beyotime Biotechnology). The amount of color formed is proportional to the number of lysed cells. Cells treated with DMSO or 160 µmol/l Sch B + different concentrations of NAC (0, 0.5, 1, 3, 6 µmol/l) were seeded in a 96-well plate. After 24 h, LDH levels were determined by analyzing the amount of LDH released into the cell culture supernatant. Absorbance signals at 490 nm were obtained using a microplate reader. To determine the percentage of LDH release, the experimental LDH release quantities were calculated relative to the control LDH release quantities, as stated in the provided instructions.

Cell viability assay by calcein AM-PI

HuccT1 cells were treated with Sch B (0 and 160 µM) in the presence or absence of various concentrations of NAC (0, 0.5, 1, 3 and 6 µM) for 24 h at 37°C. After treatment, cells were incubated with 2 µM calcein-AM (CAS 148504-34-1; MedChemExpress) for 20 min at 37°C, followed by a 5 min co-incubation with 4 µM propidium iodide (PI; CAS 25535-16-4; MedChemExpress) at 37°C. Fluorescence images were captured using a Cytation 3 Cell Imaging Multi-Mode Reader (Agilent Technologies, Inc.) with excitation at 488 nm and emission recorded at 525 nm for calcein-AM.

Dual luciferase reporter gene experiment

HuccT1 cells were seeded in 24-well plates and cultured for 24 h at 37°C in a 5% CO2 atmosphere prior to transfection. Cells were co-transfected with 100 ng of reporter plasmid (pGL4.2–3×AP-1-Luc or pGL4.2-NF-κB-Luc, both from Promega Corporation) and 1 ng of internal control plasmid (pRL-TK, Promega Corporation), corresponding to a mass ratio of 100:1 (reporter:internal control), using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). Transfection was performed at 37°C, and the medium was replaced with fresh culture medium 4 h post-transfection. At 24 h post-transfection, cells were treated with various concentrations of Sch B (0, 10, 20, 40, 80 and 160 µM) for an additional 24 h at 37°C. After treatment, the culture medium was removed, and cells were lysed with Reporter Gene Cell Lysis Buffer (Beyotime Biotechnology). A 20 µl aliquot of cell lysate was used to measure firefly and Renilla luciferase activities sequentially using the Dual Luciferase Reporter Gene Assay Kit II (cat. no. RG029; Beyotime Biotechnology) on a luminometer. Relative luciferase activity was calculated as the ratio of firefly luminescence to Renilla luminescence.

Colony formation assay

After cell counting, the HuccT1 cells were diluted to 1×105 cells/ml, then 1×104 cells/ml was inoculated on a 6-well plate (100 µl/well). After inoculation, complete medium was added (2 ml/well). After 1 week of culture at 37°C in 5% CO2, the medium was removed and cells were rinsed twice with PBS or normal saline for 10 sec each, fixed with 4% paraformaldehyde for 15 min at room temperature, and washed twice with PBS twice for 10 sec each. Subsequently, 200 µl of crystal violet staining solution was added to cover the bottom of each well and incubation for 20 min at room temperature. The 6-well plate was then rinsed under running water for 10 sec, air-dried, and the number of colonies (containing >50 cells) was counted manually.

Immunofluorescent staining

HuccT1 cells were cultured on circular coverslips in 6-well plates, fixed with 4% paraformaldehyde for 30 min at room temperature, and then permeabilized with 0.3% Triton X-100 (Merck KGaA) for 15 min at room temperature. Following permeabilization, cells were incubated in a solution containing 5% bovine serum albumin (Merck KGaA) for 40–60 min at room temperature. After washing three times with PBS, the cells were incubated overnight at 4°C with the corresponding primary antibodies (dilution 1:100; Table I). The next day, cells were washed three times with PBS and incubated with fluorescence-labeled secondary antibodies (dilution 1:200; Table I) for 1 h at room temperature in the dark. Subsequently, cells were stained with Hoechst 33342 (cat. no. HY-D0983; MedChemExpress) for 15 min at room temperature in the dark. The coverslips were then mounted onto glass slides, and fluorescence images were captured using a Nikon fluorescence microscope (Nikon Corporation).

Statistical analysis

The data are presented as mean ± SD from at least three independent experiments. Statistical analyses were performed using SPSS 23.0 (IBM Corp.). All datasets were confirmed to follow a normal distribution by the Shapiro-Wilk test. For comparisons among multiple experimental groups with a single control group, homogeneity of variances was assessed using Brown-Forsythe test. When the assumption of homogeneity of variances was met, ANOVA followed by Dunnett's post hoc test was applied to compare each experimental group with the control group. In cases where variances were heterogeneous, Welch's ANOVA followed by Dunnett T3 post hoc test was employed. The specific statistical test used for each dataset is indicated in the corresponding figure legend. A value of *P<0.05, **P<0.01 and ***P<0.001 was considered to indicate a statistically significant difference.

Results

Identification of core targets and validation by molecular docking

Potential targets of Sch B and CCA were retrieved from relevant databases. A Venn diagram revealed 120 overlapping targets between Sch B and CCA (Fig. 1A). A PPI network was constructed, comprising 68 nodes and 158 edges, with node size proportional to the degree value (Fig. 1B). Using a DC threshold >6, a subnetwork with 20 nodes and 60 edges was obtained. Further applying criteria of DC >10, BC >147 and CC >0.35, a core network of 8 nodes and 21 edges was identified. A total of eight core targets were ultimately selected: MAPK1, EGFR, ESR1, HSP90AA1, AKT1, GRB2, SRC and HRAS (Fig. 1C).

Identification of core targets and
functional enrichment via network pharmacology. (A) Venn diagram
showing the overlapping targets between Schisandrin B and CCA. (B)
Protein-protein interaction network of the common targets between
Sch B and CCA. Node size is proportional to the Degree value in the
network. (C) Screening process of the PI network topology. A total
of eight core targets were identified from 120 common targets based
on DC, BC and CC. (D) Gene Ontology enrichment analysis bubble
chart displaying the top 10 enriched terms in biological process,
cellular component and molecular function. The y-axis and x-axis
represent the term description and gene ratio, respectively. Bubble
color and size reflect the-log10 (P-value) and the number of genes
involved, respectively. CCA, cholangiocarcinoma; DC, degree
centrality; BC, betweenness centrality; CC, closeness
centrality.

Figure 1.

Identification of core targets and functional enrichment via network pharmacology. (A) Venn diagram showing the overlapping targets between Schisandrin B and CCA. (B) Protein-protein interaction network of the common targets between Sch B and CCA. Node size is proportional to the Degree value in the network. (C) Screening process of the PI network topology. A total of eight core targets were identified from 120 common targets based on DC, BC and CC. (D) Gene Ontology enrichment analysis bubble chart displaying the top 10 enriched terms in biological process, cellular component and molecular function. The y-axis and x-axis represent the term description and gene ratio, respectively. Bubble color and size reflect the-log10 (P-value) and the number of genes involved, respectively. CCA, cholangiocarcinoma; DC, degree centrality; BC, betweenness centrality; CC, closeness centrality.

GO enrichment analysis of the 120 overlapping targets was performed, covering BP, cellular component and MF categories. The top 10 enriched terms from each category are displayed in a bubble chart (Fig. 1D), suggesting that Sch B may regulate the migration and motility of CCA cells.

KEGG pathway analysis was conducted using the ClueGO plugin in Cytoscape 3.8.0, with thresholds set to include pathways containing ≥16 genes and a κ score >0.6. A total of 11 significantly enriched pathways were identified, primarily associated with ‘Pathways in cancer’ and the ‘MAPK signaling pathway’ (Fig. 2A). Molecular docking was performed between Sch B and the top 8 core target proteins (MAPK1, EGFR, ESR1, HSP90AA1, AKT1, GRB2, SRC and HRAS) identified from the PPI network. The lowest binding energies for all ligand-receptor complexes were below-5 kcal/mol, indicating spontaneous binding and stable conformations (Table III). Among them, MAPK1 exhibited the strongest binding affinity with Sch B. The binding modes of Sch B with MAPK1, HRAS, EGFR and HSP90AA1 were visualized using PyMOL 3.7.1 (Fig. 2B and C).

KEGG enrichment analysis and
molecular docking validation of core targets. (A) Visualization of
KEGG pathway enrichment analysis for the core targets. (B) Heatmap
depicting the molecular docking binding energies between Sch B and
the eight candidate core targets. (C) Representative molecular
docking poses illustrating the binding modes of Sch B with four key
targets. KEGG, Kyoto Encyclopedia of Genes and Genomes; Sch B,
Schisandrin B.

Figure 2.

KEGG enrichment analysis and molecular docking validation of core targets. (A) Visualization of KEGG pathway enrichment analysis for the core targets. (B) Heatmap depicting the molecular docking binding energies between Sch B and the eight candidate core targets. (C) Representative molecular docking poses illustrating the binding modes of Sch B with four key targets. KEGG, Kyoto Encyclopedia of Genes and Genomes; Sch B, Schisandrin B.

Table III.

Molecular docking binding affinity of Sch B with core targets.

Table III.

Molecular docking binding affinity of Sch B with core targets.

CompoundLowest binding energy (kcal/mol)
MAPK1−8.1
EGFR−7
HRAS−7.3
HSP90AA1−6.8
AKT1−6.4
GRB2−5.5
SRC−6.8
ESR1−6.3
Sch B induced a dose-dependent increase in ROS levels in CCA cells

Based on the KEGG pathway enrichment analysis, which indicated strong associations between the predicted MAPK signaling pathway and key BPs such as chemical carcinogenesis, and supported by established literature evidence highlighting the pivotal role of oxidative stress as a key mediator in these pathways, the present study was guided to investigate the involvement of ROS in the mechanism of Sch B. Guided by these predictions, the biological effects were subsequently validated through a series of in vitro experiments. CCA cells were exposed to various concentrations of Sch B, ranging from 0 to 160 µmol/l, to assess the mRNA expression levels of BIP, CHOP and XBP1s. The results showed an increasing trend, indicative of a dose-dependent effect (Fig. 3A-C). Western blot analysis further confirmed the elevated expression levels of BIP, CHOP and XBP1s, showing an upward trend (Fig. 3D).

Sch B induced a dose-dependent
increase in ROS levels in CCA cells. (A) BIP, (B) CHOP and (C)
XBP1s expressions were determined by reverse-transcription
quantitative PCR in CCA cells treated with different concentrations
of Sch B (0, 10, 20, 40, 80, 160 µmol/l), (D) BIP, CHOP and XBP1s
expression levels were determined by western blotting in CCA cells
treated with different concentrations of Sch B (0, 40, 80, 160
µmol/l). (E) ROS levels in CCA cells treated with different
concentrations of Sch B (0, 40, 80, 160 µmol/l) were measured using
the ROS probe DCFH-DA. (F) Flow cytometry analysis of ROS levels in
CCA cells following treatment with various Sch B concentrations (0,
40, 160 µmol/l). Statistical analysis was performed using ANOVA and
Dunnett's post hoc test. *P<0.05, **P<0.01, ***P<0.001.
CCA, cholangiocarcinoma; Sch B, Schisandrin B; Ctrl, control; ROS,
reactive oxygen species.

Figure 3.

Sch B induced a dose-dependent increase in ROS levels in CCA cells. (A) BIP, (B) CHOP and (C) XBP1s expressions were determined by reverse-transcription quantitative PCR in CCA cells treated with different concentrations of Sch B (0, 10, 20, 40, 80, 160 µmol/l), (D) BIP, CHOP and XBP1s expression levels were determined by western blotting in CCA cells treated with different concentrations of Sch B (0, 40, 80, 160 µmol/l). (E) ROS levels in CCA cells treated with different concentrations of Sch B (0, 40, 80, 160 µmol/l) were measured using the ROS probe DCFH-DA. (F) Flow cytometry analysis of ROS levels in CCA cells following treatment with various Sch B concentrations (0, 40, 160 µmol/l). Statistical analysis was performed using ANOVA and Dunnett's post hoc test. *P<0.05, **P<0.01, ***P<0.001. CCA, cholangiocarcinoma; Sch B, Schisandrin B; Ctrl, control; ROS, reactive oxygen species.

To support these findings, a ROS probe, DCFH-DA and flow cytometry were used to measure ROS levels in CCA cells. The results demonstrated a dose-dependent increase in ROS levels (Fig. 3E and F). Collectively, these results suggest that Sch B induces a dose-dependent increase in ROS levels within CCA cells, offering valuable insights into its molecular impact on cellular responses.

NAC counteracted the upregulatory effect of Sch B on ROS expression

Treatment with 160 µmol/l Sch B led to a notable increase in the expression levels of BIP, CHOP and XBP1s in CCA cells. The addition of NAC showed a dose-dependent reduction in the expression levels of BIP, CHOP and XBP1s in the experimental group (Fig. 4A and B).

NAC counteracted the upregulatory
effect of Sch B on ROS expression. After treatment with 160 µmol/l
Sch B + different concentrations of NAC (0, 0.5, 1, 3, 6 µmol/l).
BIP, CHOP and XBP1s expression determined by (A) western blotting
and (B) reverse transcription-quantitative PCR in CCA cells. (C)
LDH activity in cell culture medium. (D) Cell activity levels
detected by the Calcein AM-PI live cell staining. (E) Western blot
analysis of the expression levels of Bax in CCA cells. Statistical
analysis was performed using ANOVA and Dunnett's post hoc test.
**P<0.01, ***P<0.001. ROS, reactive oxygen species; CCA,
cholangiocarcinoma; NAC, N-acetyl-L-cysteine; ctrl, control; Sch B,
Schisandrin B; LDH, lactate dehydrogenase.

Figure 4.

NAC counteracted the upregulatory effect of Sch B on ROS expression. After treatment with 160 µmol/l Sch B + different concentrations of NAC (0, 0.5, 1, 3, 6 µmol/l). BIP, CHOP and XBP1s expression determined by (A) western blotting and (B) reverse transcription-quantitative PCR in CCA cells. (C) LDH activity in cell culture medium. (D) Cell activity levels detected by the Calcein AM-PI live cell staining. (E) Western blot analysis of the expression levels of Bax in CCA cells. Statistical analysis was performed using ANOVA and Dunnett's post hoc test. **P<0.01, ***P<0.001. ROS, reactive oxygen species; CCA, cholangiocarcinoma; NAC, N-acetyl-L-cysteine; ctrl, control; Sch B, Schisandrin B; LDH, lactate dehydrogenase.

It is well known that NAC, as an antioxidant, can reduce ROS levels and protect cell membrane integrity (24,25), thereby lowering LDH release from cells. With increasing concentrations of NAC, the activity of LDH in the culture medium decreases (Fig. 4C), A reduction in Bax expression was observed only at the highest concentration of NAC (6 µM). Western blotting results in Fig. 4E are representative images and were not subjected to densitometric quantification. In parallel, Calcein-AM/PI staining showed that Sch B-induced cytotoxicity was alleviated by NAC co-treatment, as evidenced by increased green fluorescence intensity (Fig. 4D). Consequently, these results show that NAC may counter the inhibitory effects of Sch B on CCA cells proliferation and facilitate apoptosis by mitigating ROS upregulation.

MAPK signaling pathway inhibition by Sch B

CCA cells treated with different concentrations of Sch B ranging from 0 to 160 µmol/l showed a dose-dependent decrease in AP-1 expression, a key regulatory component of the MAPK signaling pathway, as measured by a double luciferase reporter assay (Fig. 5A). Additionally, western blot analysis indicated a decreasing trend in p-p38 expression with higher Sch B concentrations, further demonstrating inhibition of the MAPK signaling pathway (Fig. 5C).

MAPK signaling pathway inhibition by
Sch B. (A) A double luciferase assay analysis of the expression of
AP-1 in CCA cells treated with different concentrations of Sch B
(from 0 to 160 µmol/l). (B) To evaluate the activity of CCA cells,
they were separately treated with Sch B and the MAPK-specific
inhibitor SB203580. (C) Western blot analysis of the expression
levels of p-p38 and p38. (D) Colony formation assay of CCA cells
treated with 160 µmol/l Sch B and 0.5 µmol/l SB203580. Statistical
analysis was performed using ANOVA and Dunnett's post hoc test.
***P<0.001. Sch B, Schisandrin B; P, phosphorylated.

Figure 5.

MAPK signaling pathway inhibition by Sch B. (A) A double luciferase assay analysis of the expression of AP-1 in CCA cells treated with different concentrations of Sch B (from 0 to 160 µmol/l). (B) To evaluate the activity of CCA cells, they were separately treated with Sch B and the MAPK-specific inhibitor SB203580. (C) Western blot analysis of the expression levels of p-p38 and p38. (D) Colony formation assay of CCA cells treated with 160 µmol/l Sch B and 0.5 µmol/l SB203580. Statistical analysis was performed using ANOVA and Dunnett's post hoc test. ***P<0.001. Sch B, Schisandrin B; P, phosphorylated.

Treatment with 160 µmol/l Sch B led to significant inhibition of CCA cell activity (Fig. 5B). The subsequent addition of SB203580, a p38 MAPK inhibitor, at 0.2 and 0.5 µmol/l concentrations resulted in a notable decrease in CCA cell activity compared with the control group (Fig. 5B), reflecting the effects seen with Sch B.

Furthermore, the anti-proliferative effect of Sch B on CCA cells was evidenced by a trend of reduced colony formation at 160 µM, an effect qualitatively similar to that observed with 0.5 µM SB203580 (representative images shown in Fig. 5D). These findings together highlight the effectiveness of Sch B in impeding the MAPK signaling pathway and reducing CCA cell proliferation.

Sch B inhibits NF-κB signaling pathway expression

Sch B exhibited dose-dependent suppression of the NF-κB signaling pathway in CCA cell lines. Treatment with Sch B (0,40, 80, 160 µmol/l) led to a corresponding decrease in the expression levels of IL-6, IL-8 and TNF-α. Although the 40 µmol/l treatment group generally did not show statistically significant differences compared to the control group, a trend of reduction was observed with increasing concentrations (Fig. 6A-C). The suppressive effect on NF-κB expression was shown by a dose-dependent reduction in NF-κB levels, as shown by a double luciferase assay (Fig. 6D).

Sch B inhibits NF-κB signaling
pathway expression. mRNA expression levels of (A) IL-6, (B) IL-8
(C) and TNF-α were measured in CCA cells treated with different
concentrations of Sch B (0, 40, 80, 160 µmol/l). Statistical
analysis was performed using Welch's ANOVA followed by Dunnett's T3
post hoc test. (D) NF-κB expression in CCA cells was evaluated
using a double luciferase assay with different concentrations of
Sch B (0, 10, 20, 40, 80, 160 µmol/l). (E) Hoechst
immunofluorescence staining of p65 expression in CCA cells. (F) CCA
cell activity was assessed after treatment with Sch B and Bay
11–7082, a targeted NF-κB inhibitor. Statistical analysis was
performed using ANOVA and Dunnett's post hoc test. *P<0.05,
**P<0.01, ***P<0.001. Sch B, Schisandrin B; CCA,
cholangiocarcinoma.

Figure 6.

Sch B inhibits NF-κB signaling pathway expression. mRNA expression levels of (A) IL-6, (B) IL-8 (C) and TNF-α were measured in CCA cells treated with different concentrations of Sch B (0, 40, 80, 160 µmol/l). Statistical analysis was performed using Welch's ANOVA followed by Dunnett's T3 post hoc test. (D) NF-κB expression in CCA cells was evaluated using a double luciferase assay with different concentrations of Sch B (0, 10, 20, 40, 80, 160 µmol/l). (E) Hoechst immunofluorescence staining of p65 expression in CCA cells. (F) CCA cell activity was assessed after treatment with Sch B and Bay 11–7082, a targeted NF-κB inhibitor. Statistical analysis was performed using ANOVA and Dunnett's post hoc test. *P<0.05, **P<0.01, ***P<0.001. Sch B, Schisandrin B; CCA, cholangiocarcinoma.

In the experimental group, 160 µmol/l Sch B notably reduced CCA cell activity. To directly and visually assess the effect of Sch B on p65 translocation, the present study performed immunofluorescence staining for p65. The results demonstrate nuclear accumulation of p65 in control cells (without Sch B treatment), whereas in Sch B-treated cells, p65 was predominantly retained in the cytoplasm, with correspondingly lower nuclear levels (Fig. 6E). Bay 11–7082 is a selective NF-κB inhibitor that suppresses IκBα phosphorylation (26), thereby preventing IκBα degradation and NF-κB nuclear translocation, which ultimately inhibits downstream NF-κB-dependent gene transcription. Accordingly, CCA cell activity was significantly reduced following the addition of Bay 11–7082 in a dose-dependent manner, with both 2 and 5 µM concentrations showing significant decreases compared with the control group (Fig. 6F). These results highlight the effectiveness of Sch B in inhibiting the NF-κB signaling pathway, resulting in the suppression of CCA cell activity.

Discussion

According to reports, over the past few decades, the incidence of CCA, a rare but highly malignant disease, has rapidly increased (1,2). It has become the second most common primary liver cancer in humans, following hepatocellular carcinoma, and is emerging as a major global health issue (3). Currently, surgical resection remains the primary treatment for CCA. However, due to the insidious onset of the disease and tendency to metastasize, only 20–40% of patients with potentially resectable disease undergo surgery. Consequently, the majority of patients require systemic treatment, including systemic chemotherapy with drugs such as gemcitabine, cisplatin, 5-fluorouracil and capecitabine (27). However, the development of drug resistance to chemotherapy poses an additional challenge to the treatment of CCA. Therefore, it is important to find new and safe drugs for treating CCA.

Currently, an increasing number of researchers are focusing on traditional Chinese medicine extracts, which are considered to contain various active ingredients capable of acting on multiple molecular targets and signaling pathways simultaneously (28–30). These extracts have relatively low side effects and are suitable for long-term use. Among these compounds, Sch B has been demonstrated to exert therapeutic effects in various malignant tumors (7–10). One report indicates that Sch B may inhibit the viability and proliferation of gallbladder cancer cells and promote apoptosis, highlighting its potential as a therapeutic agent for gallbladder cancer (8).

The present study first employed network pharmacology to predict the potential targets of Sch B in CCA. Functional enrichment analysis revealed significant enrichment of these targets in cancer-related pathways and the MAPK signaling pathway. Molecular docking further confirmed the strong binding affinity between Sch B and core targets, including MAPK.

The present in vitro study demonstrated that Sch B exerts its anti-CCA effects, at least in part, by modulating ROS levels. ROS play a dual role in tumorigenesis, acting as signaling molecules at low to moderate concentrations to promote tumor survival via pathways such as MAPK/ERK1/2, p38MAPK, JNK and PI3K/Akt, leading to activation of downstream effectors including NF-κB, MMP and vascular endothelial growth factor. By contrast, high concentrations of ROS trigger apoptotic pathways (31–33). Results of the present study revealed that Sch B treatment dose-dependently upregulated the expression of endoplasmic reticulum stress-related molecules (BIP, CHOP and XBP1s) and significantly increased ROS levels in CCA cells, while also inhibiting proliferation and promoting the expression of the pro-apoptotic protein Bax. The ROS scavenger NAC reversed these effects, restoring cell viability and reducing apoptosis, confirming that Sch B primarily exerts its anti-CCA activity through ROS elevation.

Studies have established that ROS influence multiple signaling pathways, notably the MAPKs and NF-κB transduction cascades (34,35). ROS play a key role in activating the MAPK signaling pathway (34) and are involved in p38 activation (35). Upon activation by oxidative stress, the MAPK signaling pathway compromises cellular anti-apoptotic capacity, leading to caspase activation and apoptosis induction. Additionally, p38MAPK has been shown to modulate the transcriptional activity of NF-κB, enabling NF-κB p65 nuclear translocation and subsequent activation of downstream signaling pathways (36,37). The NF-κB signaling pathway promotes CCA cell proliferation, metastasis and invasion (38).

In the present study, increasing concentrations of Sch B led to decreased p-p38 expression and reduced AP-1 activity, accompanied by inhibited cell proliferation. Concurrently, expression of p-p65 and p-IκBα increased, while downstream inflammatory factors IL-6, IL-8 and TNF-α decreased. Immunofluorescence staining revealed reduced nuclear translocation of p65, indicating suppression of the NF-κB pathway. The use of the p38MAPK inhibitor SB203580 and the NF-κB inhibitor Bay 11–7082 further suppressed CCA cell viability, suggesting a role for these pathways in the mechanism of Sch B.

The in vitro findings of the present study provide valuable mechanistic insights, however, several important limitations must be acknowledged. Firstly, the inherent constraints of cell-based models cannot fully replicate the complex in vivo tumor microenvironment, including key factors such as cell-cell interactions, tissue architecture and pharmacokinetic processes such as drug metabolism, distribution and clearance, all of which may substantially influence therapeutic outcomes. Secondly, and more specifically to the present study, the mechanistic conclusions are derived primarily from experiments using a single human CCA cell line (HuccT1). This approach does not capture the known heterogeneity of CCA among patients and the absence of a parallel normal cholangiocyte control line precludes a definitive assessment of the selective toxicity of Sch B against cancer cells. Consequently, the generalizability of the present findings is currently limited. To address these points, future work will extend these investigations to other representative CCA cell lines (for example, RBE and TFK-1) and include normal human intrahepatic biliary epithelial cells (for example, HIBEC) for a thorough evaluation of broader applicability and selectivity. Ultimately, in vivo validation using appropriate animal models will be essential to confirm the anti-tumor efficacy and biosafety of Sch B and to pave the way for its potential clinical translation.

In conclusion, the present findings demonstrate that Sch B may suppress proliferation and induces apoptosis in CCA cells by elevating intracellular ROS levels, mechanistically associated with the modulation of the p38MAPK/NF-κB signaling pathway. As a natural compound, Sch B exhibits multi-target intervention characteristics, underscoring its potential for clinical translation. Future studies will focus on in vivo validation of its antitumor efficacy and biosafety, and explore combination strategies with conventional cytotoxic agents to elucidate synergistic mechanisms. These efforts will provide a stronger experimental foundation for developing Sch B as a promising therapeutic candidate against CCA.

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

All data generated in the present study may be requested from the corresponding author.

Authors' contributions

JY and SW confirmed the authenticity of all raw data. The conception and design of the study were carried out by JY, SW, WL and XW. Data acquisition was performed by JY, WL and XY. Data analysis and interpretation were conducted by WL, XY and QH. Manuscript writing and/or revision were undertaken by JY and WL. Administrative, technical or material support was provided by SW and XY. Study supervision was managed by SW. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Li X, Guan R and Zhang S: Factors contributing to the high malignancy level of cholangiocarcinoma and its epidemiology: Literature review and data. Biology (Basel). 14:3512025.PubMed/NCBI

2 

Ilyas SI, Khan SA, Hallemeier CL, Kelley RK and Gores GJ: Cholangiocarcinoma-evolving concepts and therapeutic strategies. Nat Rev Clin Oncol. 15:95–111. 2018. View Article : Google Scholar : PubMed/NCBI

3 

Bridgewater J, Galle PR, Khan SA, Llovet JM, Park JW, Patel T, Pawlik TM and Gores GJ: Guidelines for the diagnosis and management of intrahepatic cholangiocarcinoma. J Hepatol. 60:1268–1289. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Peery AF, Crockett SD, Murphy CC, Lund JL, Dellon ES, Williams JL, Jensen ET, Shaheen NJ, Barritt AS, Lieber SR, et al: Burden and cost of gastrointestinal, liver, and pancreatic diseases in the united states: Update 2018. Gastroenterology. 156:254–272.e11. 2019. View Article : Google Scholar : PubMed/NCBI

5 

Razumilava N and Gores GJ: Cholangiocarcinoma. Lancet. 383:2168–2179. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Qi L, Yu HQ, Li YQ, Jin H, Zhao DH and Xu Y: Schidandrin B kills tumor cells by initiating apoptosis in glioma SHG-44 cells. Chin J Integr Med. Aug 2–2016.doi: 10.1007/s11655-015-2406-9 (Epub ahead of print). View Article : Google Scholar

7 

Li Q, Lu XH, Wang CD, Cai L, Lu JL, Wu JS, Zhuge QC, Zheng WM and Su ZP: Antiproliferative and apoptosis-inducing activity of schisandrin B against human glioma cells. Cancer Cell Int. 15:122015. View Article : Google Scholar : PubMed/NCBI

8 

Xiang SS, Wang XA, Li HF, Shu YJ, Bao RF, Zhang F, Cao Y, Ye YY, Weng H, Wu WG, et al: RETRACTED: Schisandrin B induces apoptosis and cell cycle arrest of gallbladder cancer cells. Molecules. 19:13235–13250. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Dai X, Yin C, Guo G, Zhang Y, Zhao C, Qian J, Wang O, Zhang X and Liang G: Schisandrin B exhibits potent anticancer activity in triple negative breast cancer by inhibiting STAT3. Toxicol Appl Pharmacol. 358:110–119. 2018. View Article : Google Scholar : PubMed/NCBI

10 

Nasser MI, Han T, Adlat S, Tian Y and Jiang N: Inhibitory effects of Schisandrin B on human prostate cancer cells. Oncol Rep. 41:677–685. 2019.PubMed/NCBI

11 

Zhang H, Chen Q, Dahan A, Xue J, Wei L, Tan W and Zhang G: Transcriptomic analyses reveal the molecular mechanisms of schisandrin B alleviates CCl4-induced liver fibrosis in rats by RNA-sequencing. Chem Biol Interact. 309:1086752019. View Article : Google Scholar : PubMed/NCBI

12 

Sabharwal SS and Schumacker PT: Mitochondrial ROS in cancer: Initiators, amplifiers or an Achilles' heel? Nat Rev Cancer. 14:709–721. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Trinh VH, Nguyen Huu T, Sah DK, Choi JM, Yoon HJ, Park SC, Jung YS and Lee SR: Redox regulation of PTEN by reactive oxygen species: Its role in physiological processes. Antioxidants (Basel). 13:1992024. View Article : Google Scholar : PubMed/NCBI

14 

Caligiuri A, Becatti M, Porro N, Borghi S, Marra F, Pastore M, Taddei N, Fiorillo C and Gentilini A: Oxidative stress and Redox-dependent pathways in cholangiocarcinoma. Antioxidants (Basel). 13:282023. View Article : Google Scholar : PubMed/NCBI

15 

Srinivas US, Tan BWQ, Vellayappan BA and Jeyasekharan AD: ROS and the DNA damage response in cancer. Redox Biol. 25:1010842019. View Article : Google Scholar : PubMed/NCBI

16 

Marchi S, Guilbaud E, Tait SWG, Yamazaki T and Galluzzi L: Mitochondrial control of inflammation. Nat Rev Immunol. 23:159–173. 2023. View Article : Google Scholar : PubMed/NCBI

17 

Glover HL, Schreiner A, Dewson G and Tait SWG: Mitochondria and cell death. Nat Cell Biol. 26:1434–1446. 2024. View Article : Google Scholar : PubMed/NCBI

18 

Wandee J, Srinontong P, Prawan A, Senggunprai L, Kongpetch S, Yenjai C and Kukongviriyapan V: Derrischalcone suppresses cholangiocarcinoma cells through targeting ROS-mediated mitochondrial cell death, Akt/mTOR, and FAK pathways. Naunyn Schmiedebergs Arch Pharmacol. 394:1929–1940. 2021. View Article : Google Scholar : PubMed/NCBI

19 

Nazim UM, Yin H and Park SY: Autophagy flux inhibition mediated by celastrol sensitized lung cancer cells to TRAIL-induced apoptosis via regulation of mitochondrial transmembrane potential and reactive oxygen species. Mol Med Rep. 19:984–993. 2019.PubMed/NCBI

20 

Nogales C, Mamdouh ZM, List M, Kiel C, Casas AI and Schmidt H: Network pharmacology: Curing causal mechanisms instead of treating symptoms. Trends Pharmacol Sci. 43:136–150. 2022. View Article : Google Scholar : PubMed/NCBI

21 

Zhang P, Zhang D, Zhou W, Wang L, Wang B, Zhang T and Li S: Network pharmacology: Towards the artificial intelligence-based precision traditional Chinese medicine. Brief Bioinform. 25:bbad5182023. View Article : Google Scholar : PubMed/NCBI

22 

Zhao L, Zhang H, Li N, Chen J, Xu H, Wang Y and Liang Q: Network pharmacology, a promising approach to reveal the pharmacology mechanism of Chinese medicine formula. J Ethnopharmacol. 309:1163062023. View Article : Google Scholar : PubMed/NCBI

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Esmat A, El-Demerdash E, El-Mesallamy H and Abdel-Naim AB: Toxicity and oxidative stress of acrylonitrile in rat primary glial cells: Preventive effects of N-acetylcysteine. Toxicol Lett. 171:111–118. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Du L, Empey PE, Ji J, Chao H, Kochanek PM, Bayır H and Clark RS: Probenecid and N-Acetylcysteine prevent loss of intracellular glutathione and inhibit neuronal death after mechanical stretch injury in vitro. J Neurotrauma. 33:1913–1917. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Strickson S, Campbell DG, Emmerich CH, Knebel A, Plater L, Ritorto MS, Shpiro N and Cohen P: The anti-inflammatory drug BAY 11–7082 suppresses the MyD88-dependent signalling network by targeting the ubiquitin system. Biochem J. 451:427–437. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Wilbur HC, Soares HP and Azad NS: Neoadjuvant and adjuvant therapy for biliary tract cancer: Advances and limitations. Hepatology. 82:1287–1302. 2025. View Article : Google Scholar : PubMed/NCBI

28 

Wang JX, Zhang MX, Yu CH, Wang SJ and Zhang H: Targeting DNA damage: A natural product-based strategy for inhibiting cancer progression. J Ethnopharmacol. 355:1206432026. View Article : Google Scholar : PubMed/NCBI

29 

Ma J, Zhang Y, Du J, Chen J, Sun J, Ma X, Zeng J and Efferth T: High-fat Diet-associated digestive cancers: Mechanisms, natural Product-based therapies, and drug development. Phytomedicine. 150:1575742026. View Article : Google Scholar : PubMed/NCBI

30 

He Z, Wang Y, Han L, Hu Y and Cong X: The mechanism and application of traditional Chinese medicine extracts in the treatment of lung cancer and other lung-related diseases. Front Pharmacol. 14:13305182023. View Article : Google Scholar : PubMed/NCBI

31 

Ismail T, Kim Y, Lee H, Lee DS and Lee HS: Interplay between mitochondrial peroxiredoxins and ROS in cancer development and progression. Int J Mol Sci. 20:44072019. View Article : Google Scholar : PubMed/NCBI

32 

Li J, Lim JYS, Eu JQ, Chan AKMH, Goh BC, Wang L and Wong AL: Reactive oxygen species modulation in the current landscape of anticancer therapies. Antioxid Redox Signal. 41:322–341. 2024. View Article : Google Scholar : PubMed/NCBI

33 

Ebrahimi SO, Reiisi S and Shareef S: miRNAs, oxidative stress, and cancer: A comprehensive and updated review. J Cell Physiol. 235:8812–8825. 2020. View Article : Google Scholar : PubMed/NCBI

34 

Imran M, Saeed F, Gilani SA, Shariati MA, Imran A, Afzaal M, Atif M, Tufail T and Anjum FM: Fisetin: An anticancer perspective. Food Sci Nutr. 9:3–16. 2020. View Article : Google Scholar : PubMed/NCBI

35 

Huang M and Xin W: Matrine inhibiting pancreatic cells epithelial-mesenchymal transition and invasion through ROS/NF-κB/MMPs pathway. Life Sci. 192:55–61. 2018. View Article : Google Scholar : PubMed/NCBI

36 

Lin K, Zhang Y, Shen Y, Xu Y, Huang M and Liu X: Hydrogen sulfide can scavenge free radicals to improve spinal cord injury by inhibiting the p38MAPK/mTOR/NF-κB signaling pathway. Neuromolecular Med. 26:262024. View Article : Google Scholar : PubMed/NCBI

37 

Montal R, Sia D, Montironi C, Leow WQ, Esteban-Fabró R, Pinyol R, Torres-Martin M, Bassaganyas L, Moeini A, Peix J, et al: Molecular classification and therapeutic targets in extrahepatic cholangiocarcinoma. J Hepatol. 73:315–327. 2020. View Article : Google Scholar : PubMed/NCBI

38 

Pan S, Hu Y, Hu M, Xu Y, Chen M, Du C, Cui J, Zheng P, Lai J, Zhang Y, et al: S100A8 facilitates cholangiocarcinoma metastasis via upregulation of VEGF through TLR4/NF-κB pathway activation. Int J Oncol. 56:101–112. 2020.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yang J, Long W, Wu X, Yang X, Hong Q and Wang S: Schisandrin B suppresses cholangiocarcinoma by targeting the ROS/p38 MAPK/NF‑&kappa;B axis. Oncol Lett 31: 196, 2026.
APA
Yang, J., Long, W., Wu, X., Yang, X., Hong, Q., & Wang, S. (2026). Schisandrin B suppresses cholangiocarcinoma by targeting the ROS/p38 MAPK/NF‑&kappa;B axis. Oncology Letters, 31, 196. https://doi.org/10.3892/ol.2026.15551
MLA
Yang, J., Long, W., Wu, X., Yang, X., Hong, Q., Wang, S."Schisandrin B suppresses cholangiocarcinoma by targeting the ROS/p38 MAPK/NF‑&kappa;B axis". Oncology Letters 31.5 (2026): 196.
Chicago
Yang, J., Long, W., Wu, X., Yang, X., Hong, Q., Wang, S."Schisandrin B suppresses cholangiocarcinoma by targeting the ROS/p38 MAPK/NF‑&kappa;B axis". Oncology Letters 31, no. 5 (2026): 196. https://doi.org/10.3892/ol.2026.15551
Copy and paste a formatted citation
x
Spandidos Publications style
Yang J, Long W, Wu X, Yang X, Hong Q and Wang S: Schisandrin B suppresses cholangiocarcinoma by targeting the ROS/p38 MAPK/NF‑&kappa;B axis. Oncol Lett 31: 196, 2026.
APA
Yang, J., Long, W., Wu, X., Yang, X., Hong, Q., & Wang, S. (2026). Schisandrin B suppresses cholangiocarcinoma by targeting the ROS/p38 MAPK/NF‑&kappa;B axis. Oncology Letters, 31, 196. https://doi.org/10.3892/ol.2026.15551
MLA
Yang, J., Long, W., Wu, X., Yang, X., Hong, Q., Wang, S."Schisandrin B suppresses cholangiocarcinoma by targeting the ROS/p38 MAPK/NF‑&kappa;B axis". Oncology Letters 31.5 (2026): 196.
Chicago
Yang, J., Long, W., Wu, X., Yang, X., Hong, Q., Wang, S."Schisandrin B suppresses cholangiocarcinoma by targeting the ROS/p38 MAPK/NF‑&kappa;B axis". Oncology Letters 31, no. 5 (2026): 196. https://doi.org/10.3892/ol.2026.15551
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team