Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
August-2026 Volume 32 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2026 Volume 32 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Anti‑CD20 and ‑PD‑1 antibody effects on proliferation, apoptosis and cell cycle of endometrial cancer cells

  • Authors:
    • Jinqiu Su
    • Jiayuan Du
    • Yaojie Yu
    • Mei Feng
    • Qiuyue Huang
    • Bing Liu
    • He Wang
  • View Affiliations / Copyright

    Affiliations: Department of Gynecology, Guangxi Medical University Cancer Hospital, Nanning, Guangxi 530200, P.R. China
    Copyright: © Su et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 357
    |
    Published online on: June 17, 2026
       https://doi.org/10.3892/ol.2026.15712
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study aimed to systematically evaluate the functional effects of the anti‑CD20 antibody Rituximab and the programmed cell death 1 (PD‑1/PDCD1) antibody Pembrolizumab on endometrial cancer (EC) cells. The expression levels of membrane spanning 4‑domains A1 (MS4A1) and PDCD1 in EC tissues and cells were analyzed using the The Cancer Genome Atlas database with R programming language. The impacts of Rituximab and Pembrolizumab treatment on proliferation, apoptosis and cell cycle progression were assessed in Ishikawa and HEC‑1A EC cell lines by means of CCK‑8 assays and flow cytometry. Both MS4A1 and PDCD1 were significantly upregulated in EC tissues and cells compared with normal controls. Rituximab and Pembrolizumab demonstrated concentration‑dependent inhibitory effects on the proliferation of EC cells, induced cell apoptosis and arrested cell cycle progression. Furthermore, the combination of Rituximab and Pembrolizumab resulted in enhanced and more potent suppression of cancer cell growth than either monotherapy alone. In conclusion, the combination of anti‑CD20 antibody and PD‑1 antibody exerts synergistic antiproliferative effects on EC cells in vitro.

Introduction

Endometrial cancer (EC) is one of the most prevalent malignant tumors of the female reproductive system. Each year, EC develops in ~142,000 women worldwide, and an estimated 42,000 women die from this cancer. In recent years, its incidence has been on the rise globally, particularly in developed countries, and it is strongly associated with obesity, metabolic syndrome and elevated estrogen exposure (1). While patients with early-stage EC can achieve favorable prognoses through surgical intervention combined with adjuvant radiotherapy and chemotherapy, the management of advanced, recurrent and metastatic EC remains a significant challenge. Traditional therapies are prone to drug resistance and induce considerable toxicities and side effects, urgently calling for improvement in patient survival rates (2). Consequently, the development of novel targeted therapies and immunotherapeutic strategies has emerged as a critical focus of contemporary research.

Programmed cell death 1 (PD-1/PDCD1) signaling, as a fundamental immune checkpoint mechanism, downregulates inflammatory responses and maintains immune homeostasis (3). The PD-1/programmed cell death ligand 1 (PD-L1) signaling pathway not only serves as an important route for preventing autoimmune diseases but also exerts a significant impact on the delicate balance between tumor immune surveillance and immune tolerance (4). PD-1/PD-L1 inhibitors have emerged as a groundbreaking therapeutic approach, effectively reversing T-cell exhaustion by blocking negative regulatory signals (5). The U.S. Food and Drug Administration has approved anti-PD-1 antibodies as a second-line therapy for non-microsatellite instability-high and deficient mismatch repair advanced EC with a PD-L1 Combined Positive Score ≥1 (6). However, the response rates of other molecular subtypes to immune checkpoint inhibitors, particularly p53-mutated EC or special types of endometrioid carcinoma (e.g., serous papillary carcinoma, clear cell carcinoma, undifferentiated carcinoma, small cell carcinoma or mixed cell carcinoma), remain low. Consequently, exploring combination drug strategies to enhance therapeutic efficacy has become a key research focus.

Meanwhile, monoclonal antibodies targeting the CD20 antigen on the surface of B cells, (e.g., Rituximab) have been widely used in the treatment of B-cell lymphomas. Recent studies have demonstrated that CD20 is abnormally expressed in certain solid tumors, including breast cancer and ovarian cancer. High CD20 expression has also been detected in EC tissues, and anti-CD20 antibodies exert anti-tumor effects through multiple mechanisms, including antibody-dependent cellular cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC) and the induction of tumor cell apoptosis (7,8). A previous Mendelian randomization analysis by our group revealed a significant association between CD20 and EC, suggesting that anti-CD20 antibodies may exert protective effects against EC and reduce its risk (9). Furthermore, B-cell infiltration and abnormal activation are observed in the EC microenvironment, indicating that CD20 may play a role in regulating tumor progression. However, its expression patterns and biological functions in EC remain elusive, and its therapeutic potential has yet to be fully explored.

The occurrence and progression of EC are intricately associated with uncontrolled cell proliferation, impaired apoptosis and disrupted cell cycle regulation. Targeting these biological processes represents a central strategy in anti-tumor therapy (10). However, the synergistic mechanisms underlying the combination of anti-CD20 antibodies and PD-1 antibodies in EC have not been comprehensively investigated. Specifically, the effects of these agents on tumor cell proliferation, apoptosis and cell cycle regulation remain to be fully clarified. In light of this, the present study aims to investigate the biological impacts of anti-CD20 and PD-1 antibodies on EC cells. Through in vitro experiments, their effects on cell proliferation, apoptosis and cell cycle distribution were explored with the goal of providing a novel theoretical basis for combined immunotherapy in EC and promoting its translational research for clinical application.

Materials and methods

Bioinformatics

All raw and processed transcriptomic, genomic and clinical data for the Uterine Corpus Endometrial Carcinoma (UCEC) cohort were obtained from The Cancer Genome Atlas (TCGA) 1.0 release. The TCGA overall study accession number in the database of Genotypes and Phenotypes (https://www.ncbi.nlm.nih.gov/gap) is PHS000178, TCGA-UCEC dataset official identifier: TCGA-UCEC. Transcriptome data for patients with EC, initially including 537 tumor samples and 35 normal endometrial samples, were downloaded from the TCGA-UCEC database (https://portal.gdc.cancer.gov/projects/TCGA-UCEC). After exclusion of samples with zero expression values, the final analytic dataset comprised of 472 tumor samples and 35 normal endometrial samples.

Cell lines and culture conditions

EC cell lines [Ishikawa (99040201) and HEC-1A (HTB-112)] were obtained from the EC Cell Bank of the Chinese Academy of Sciences. Normal endometrial epithelial cells (hEEC) were purchased from Procell Life Science & Technology Co., Ltd. Ishikawa cells are estrogen receptor-positive, while HEC-1A cells show low expression of the estrogen receptor. Cells were cultured in corresponding media (McCoy's 5A for HEC-1A; Dulbecco's modified Eagle's medium for Ishikawa; both Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and incubated in a humidified incubator at 37°C with 5% CO2. Cells in the logarithmic growth phase were selected for use in subsequent experiments.

Reverse-transcription quantitative (RT-q)PCR analysis

Total RNA was isolated from tissue samples, cultured cells (hEEC, Ishikawa and HEC-1A cells) and exosomes using TRIzol reagent (Thermo Fisher Scientific, Inc.). The RNA was subsequently reverse-transcribed into complementary DNA (cDNA) using a reverse transcription kit (cat. no. RR036A; Takara Bio, Inc.) according to the manufacturer's instructions. Real-time quantitative PCR was carried out using SYBR Premix ExTaq™ II (cat. no. RR820A; Takara Bio, Inc.). According to the manufacturer's instructions, a 20-µl PCR mixture was used in a Q5 PCR instrument (Thermo Fisher Scientific, Inc.). The following thermocycling conditions were applied: Pre-denaturation at 95°C for 30 sec for 40 cycles; followed by 95°C for 5 sec and 60°C for 34 sec. The gene expression levels relative to β-actin were determined using the 2-∆∆Cq method. All the steps were carried out in accordance with the manufacturer's instructions. The primer sequences used in the analysis are provided in Table I.

Table I.

Primer sequences (5′-3′).

Table I.

Primer sequences (5′-3′).

Gene nameForwardReverse
MS4A1 TGATGCTGATCTTTGCCTTCTTCC TCGTCTCTGTTTCTTCTTCTTCCTC
PDCD1 GCTGCACTAATTGTCTATTGGG CACAGTAATTCGCTTGTAGTCG
β-actin CACTCTTCCAGCCTTCCTTC GTACAGGTCTTTGCGGATGT

[i] PDCD1, programmed cell death 1; MS4A1, membrane spanning 4-domains A1.

Antibody sources

Anti-CD20 antibodies (e.g., Rituximab; cat. no. HY-P9913) and immune checkpoint inhibitors (e.g., Pembrolizuma; cat. no. HY-P9902), with purity exceeding 95%, were procured from MedChemExpress.

Selection of drug working concentration and cell proliferation experiments

Ishikawa and HEC-1A cells in the logarithmic growth phase were seeded into 96-well plates at a density of 5×103 cells per well. After 24 h of cultivation, various drug concentrations were subsequently added (Rituximab: 0,10, 20, 30, 40, 50 µg/ml; Pembrolizumab: 0,0.001, 0.01, 0.1, 1, 10 nM). At different time-points post-treatment (24, 48 and 72 h), CCK-8 reagent (Tongren Institute of Chemistry) was added to each well, followed by a 2-h incubation period. The absorbance values were measured as the optical density (OD) at a wavelength of 490 nm using a microplate reader to assess the inhibitory effects of Rituximab and Pembrolizumab. Based on these results, the optimal inhibitory concentration was determined. Subsequently, the optimal inhibitory concentration [half-maximal inhibitory concentration (IC50)] for the combination treatment group was screened. The cell proliferation inhibition rate was calculated using the following formula: Inhibition Rate (%)=(1-OD value of experimental group/OD value of control group) ×100%. A drug concentration of 0 represents the negative control group.

Detection of apoptosis by phycoerythrin/7-amino-actinomycin D (PE/7-AAD) double staining

Ishikawa and HEC-1A cells in the logarithmic growth phase were seeded into 6-well plates. When the cells reached ~50% confluence, they were treated with drugs and divided into the following groups: Rituximab (10, 20, 30 µg/ml); Pembrolizumab (0.01, 0.1, 1 nM); Combination Groups (0.001, 0.01, 0.1 nM). After 48 h of incubation, the cells were harvested, digested with trypsin (Gibco; Thermo Fisher Scientific, Inc.), washed with PBS and resuspended in Binding Buffer. They were then stained with 5 µl PE and 10 µl 7-AAD (United Division) at 4°C and incubated in the dark for 15 min. Apoptosis was analyzed using a flow cytometer.

Cell cycle analysis [propidium (PI) staining]

Cells treated for 48 h were harvested, washed with prechilled PBS three times and fixed in 70% ethanol at 4°C overnight. Centrifugation was performed at 300 × g for 5 min at 4°C to remove the ethanol. The cells were resuspended in a staining solution containing 50 µg/ml PI and 100 µg/ml RNase A (Thermo Fisher Scientific, Inc.), and incubated at 37°C in the dark for 30 min. The cell cycle distribution (G0/G1 phase, S phase, G2/M phase) was analyzed by flow cytometry and the proportions of each phase were quantified using FlowJo software (v10.10.1; BD Biosciences).

Statistical analysis

The experimental data are presented as the mean ± standard deviation. Statistical analysis was performed using GraphPad Prism 8.0 software (Dotmatics). Intergroup differences were assessed using one-way ANOVA (Tamhane's T2 test) or unpaired t-tests, and P<0.05 was considered to indicate statistical significance. All experiments were independently repeated three times. In the CCK-8 assay, for the same conditions, 5 parallel wells were used. After eliminating the two wells with the greatest difference, a total of 3 parallel wells remained.

Results

Differential expression of MS4A1 and PDCD1

The differential expression analysis of MS4A1 and PDCD1 was conducted using the EC dataset from the TCGA database. MS4A1 encodes the CD20 protein, while PDCD1 encodes PD-1. R programming language was utilized to evaluate the expression levels of these two genes in EC tissues compared to normal endometrial tissues. The results showed that MS4A1 exhibited higher expression in EC tissues; however, this difference was not statistically significant (Fig. 1A). By contrast, PDCD1 demonstrated significantly higher expression in EC tissues compared to normal endometrial tissues (Fig. 1B). Meanwhile, RT-qPCR was used to assess the differential expression of MS4A1 and PDCD1 in EC cells. Compared with normal endometrial cells, the expression of MS4A1 and PDCD1 in EC cells was markedly upregulated (Fig. 1C and D).

Differential expression of MS4A1 and
PDCD1. (A) Statistical graph of MS4A1 mRNA expression in TCGA data,
including 472 tumor samples and 35 normal endometrial samples. (B)
Statistical graph of PDCD1 mRNA expression in TCGA data. (C)
Statistical graph of MS4A1 mRNA expression in EC cells and normal
cells. (D) Statistical graph of PDCD1 mRNA expression in EC cells.
*P<0.05; **P<0.01; ****P<0.0001; ns, no significance.
TCGA, The Cancer Genome Atlas; EC, endometrial cancer; PDCD1,
programmed cell death 1; MS4A1, membrane spanning 4-domains A1.

Figure 1.

Differential expression of MS4A1 and PDCD1. (A) Statistical graph of MS4A1 mRNA expression in TCGA data, including 472 tumor samples and 35 normal endometrial samples. (B) Statistical graph of PDCD1 mRNA expression in TCGA data. (C) Statistical graph of MS4A1 mRNA expression in EC cells and normal cells. (D) Statistical graph of PDCD1 mRNA expression in EC cells. *P<0.05; **P<0.01; ****P<0.0001; ns, no significance. TCGA, The Cancer Genome Atlas; EC, endometrial cancer; PDCD1, programmed cell death 1; MS4A1, membrane spanning 4-domains A1.

Effects of different concentrations of Rituximab and Pembrolizumab on the proliferation of Ishikawa and HEC-1A cells

Cell proliferation was assessed via the CCK-8 assay. The results showed that various concentrations of Rituximab and Pembrolizumab markedly inhibited the viability of Ishikawa and HEC-1A cells, with the inhibitory effect increasing as the drug concentration increased. Notably, Rituximab at a concentration of 30 µg/ml and Pembrolizumab at a concentration of 1 nM exhibited the most pronounced inhibitory effects after 48 h (P<0.05). Thus, 48 h was selected for subsequent experiments (Fig. 2 and Table II). The relatively weaker inhibitory effect of rituximab on HEC-1A cells at 48 h may be due to a plateau effect or mild compensatory cell proliferation after prolonged treatment. Additionally, the optimal concentration of Rituximab (30 µg/ml) and the concentration gradient of Pembrolizumab in the combination group were investigated (Table III). The concentration of Rituximab (30 µg/ml) was determined based on preliminary dose-response experiments in EC cells. This concentration produced a moderate but significant inhibitory effect on cell proliferation without excessive cytotoxicity, which was suitable for evaluating the synergistic effect in combination with pembrolizumab. The findings revealed that the optimal concentration of Pembrolizumab in the combination group was 0.1 nM, which was subsequently utilized for further experiments (Table IV).

Effects of Rituximab and Pembrolizumab
on EC-cell proliferation. (A) Inhibitory effect of Rituximab on
Ishikawa cell proliferation; (B) inhibitory effect of Pembrolizumab
on Ishikawa cell proliferation; (C) inhibitory effect of Rituximab
on HEC-1A cell proliferation; (D) inhibitory effect of
Pembrolizumab on HEC-1A cell proliferation. Data are presented as
the mean ± standard deviation.

Figure 2.

Effects of Rituximab and Pembrolizumab on EC-cell proliferation. (A) Inhibitory effect of Rituximab on Ishikawa cell proliferation; (B) inhibitory effect of Pembrolizumab on Ishikawa cell proliferation; (C) inhibitory effect of Rituximab on HEC-1A cell proliferation; (D) inhibitory effect of Pembrolizumab on HEC-1A cell proliferation. Data are presented as the mean ± standard deviation.

Table II.

Effects of Rituximab on endometrial cancer cell proliferation.

Table II.

Effects of Rituximab on endometrial cancer cell proliferation.

IshikawaHEC-1A


Concentration, µg/mlMean±SDP-valueMean±SDP-value
  00±1.58 0±0.56
102.44±0.790.141.93±1.980.37
202.93±0.150.084.88±3.910.04
309.20±1.67<0.0019.09±1.90<0.001
405.99±1.510.004.88±0.320.04
503.82±2.470.034.35±1.550.06

Table III.

Effects of Pembrolizumab on endometrial cancer cell proliferation.

Table III.

Effects of Pembrolizumab on endometrial cancer cell proliferation.

IshikawaHEC-1A


Concentration, nmMean±SDP-valueMean±SDP-value
00±3.47 0±0.75
0.0014.15±0.680.182.35±1.300.05
0.016.20±0.400.095.17±0.83<0.001
0.16.50±0.710.067.05±1.26<0.001
113.75±1.09<0.0019.72±1.50<0.001
107.98±0.290.014.63±0.21<0.001

Table IV.

Effects of combination treatment on endometrial cancer cell proliferation.

Table IV.

Effects of combination treatment on endometrial cancer cell proliferation.

IshikawaHEC-1A


Pembrolizumab concentration, nmMean±SDP-valueMean±SDP-value
00±3.76 0±2.46
0.0017.01±3.030.017.61±4.500.01
0.019.89±1.37<0.0016.31±1.770.04
0.115.45±1.04<0.00114.60±1.38<0.001
111.44±1.81<0.0013.70±2.500.19
107.61±0.710.015.02±2.310.09
Effects of Rituximab and Pembrolizumab on EC cell apoptosis

To explore the dose-dependent effect of the drugs and revalidate their optimal concentrations, apoptosis was assessed using PE/7-AAD double staining. The results demonstrated that varying concentrations of Rituximab and Pembrolizumab significantly suppressed the viability of Ishikawa and HEC-1A cells, with the inhibitory effect increasing as the drug concentration rose. Further analysis revealed that the proportion of apoptotic cells in the combination treatment group was significantly higher than in the single-drug groups, suggesting a synergistic effect of the two antibodies in inducing apoptosis (Fig. 3).

Effects of Rituximab and Pembrolizumab
on endometrial cancer cell apoptosis. (A) Apoptosis rate of
Ishikawa cells; (B) Apoptosis rate of HEC-1A cells. *P<0.05;
**P<0.01; ***P<0.001; ****P<0.0001; ns, no significance.
Q, quadrant; UL, upper left; LR, lower right; R+P, Rituximab +
Pembrolizumab.

Figure 3.

Effects of Rituximab and Pembrolizumab on endometrial cancer cell apoptosis. (A) Apoptosis rate of Ishikawa cells; (B) Apoptosis rate of HEC-1A cells. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001; ns, no significance. Q, quadrant; UL, upper left; LR, lower right; R+P, Rituximab + Pembrolizumab.

Effects of Rituximab and Pembrolizumab on EC cell cycle

The cell cycle distribution was analyzed using PI staining. The results demonstrated that gradients of Rituximab at different concentrations elevated the proportion of Ishikawa and HEC-1A cells in the G0/G1 phase, indicating that Rituximab inhibits cell proliferation by inducing G0/G1 phase arrest. Conversely, different concentrations of Pembrolizumab raised the proportion of Ishikawa and HEC-1A cells in the S phase, suggesting that Pembrolizumab suppresses cell proliferation by inducing S-phase arrest. The combination of the two antibodies further elevated the cell ratio in the S and G2/M phases, indicating that the two antibodies inhibit cell proliferation by inducing S- and G2/M phase arrest, with Pembrolizumab playing a predominant role (Fig. 4).

Effects of Rituximab and Pembrolizumab
on endometrial cancer cell cycle. (A) Cell cycle distribution of
Ishikawa cells; (B) cell cycle distribution of HEC-1A cells.
*P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. R+P,
Rituximab + Pembrolizumab.

Figure 4.

Effects of Rituximab and Pembrolizumab on endometrial cancer cell cycle. (A) Cell cycle distribution of Ishikawa cells; (B) cell cycle distribution of HEC-1A cells. *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001. R+P, Rituximab + Pembrolizumab.

Discussion

In recent years, immunotherapy has achieved remarkable breakthroughs in the treatment of malignant tumors, particularly with the widespread clinical application of immune checkpoint inhibitors and monoclonal antibodies. To date, the roles of anti-CD20 antibodies and immune checkpoint inhibitors (e.g., PD-1 antibodies) in EC have been confirmed. However, systematic explorations of the synergistic effects of these two therapeutic modalities remain relatively scarce. This study was the first, to the best of our knowledge, to comprehensively evaluate the individual and combined effects of the anti-CD20 antibody Rituximab and the PD-1 antibody Pembrolizumab on EC cells, thus offering novel insights into the clinical management of this prevalent gynecological malignancy.

Anti-CD20 antibodies can effectively inhibit tumor progression through diverse antitumor mechanisms. CD20 is a transmembrane cellular protein that has been validated as a therapeutic target for B-cell malignancies (11). Rituximab, the first CD20 monoclonal antibody approved for use in cancer patients, is a human/mouse chimeric anti-CD20 monoclonal antibody. Additionally, it exhibits an excellent safety profile in patients with various CD20+ lymphoid malignancies (12). Studies have shown that anti-CD20 antibodies exhibit effective therapeutic outcomes in patients with multiple sclerosis (13). Schlaak et al (14) demonstrated that although melanoma has low CD20 expression, anti-CD20 antibody treatment remains efficient. The anti-tumor mechanisms of anti-CD20 antibodies include: i) High-density CD20+ B cells may possess anti-tumor immunity potential; ii) certain tumor cell lines express CD20, and anti-CD20 antibodies can directly kill tumor cells through ADCC and CDC; iii) anti-CD20 antibodies may indirectly enhance T cell-mediated anti-tumor immune responses by depleting immunosuppressive B-cell subsets, such as regulatory B cells (15). Tertiary lymphoid structures (TLS) are ectopic lymphoid aggregates that occur in inflamed, infected or neoplastic tissues. These structures share features analogous to lymph node architecture, including the presence of large clusters of CD20-positive B lymphocytes, which are critical for mediating adaptive immune responses (16). Previous studies have demonstrated an association between TLS and favorable prognosis as well as enhanced immunotherapy responsiveness in patients with endometrial cancer (EC) (17,18). A high level of CD20+ B-cell infiltration has been observed in EC, with significant CD20 expression detected in EC tissues (19,20), corroborating the findings from a bioinformatics analysis performed as part of the present study regarding the elevated expression of MS4A1. However, the difference was not statistically significant, potentially attributable to the limited sample size. CD20 is highly expressed in EC tissues but it remains unknown whether CD20 is highly expressed on the tumor cells themselves or on the infiltrating B cells within the tumor microenvironment. Mendelian randomization analyses have revealed a strong correlation between CD20 and EC, suggesting that anti-CD20 antibodies may exert protective effects and reduce EC risk (9). Consistent with this hypothesis, the current study found that Rituximab inhibits EC-cell proliferation and promotes apoptosis by inducing G0/G1-phase arrest, with the inhibitory effect increasing in a concentration-dependent manner, thereby validating the protective role of anti-CD20 antibodies in EC cells.

PD-1 antibodies can effectively inhibit tumor progression through diverse anti-tumor mechanisms. PD-1 receptor and its ligand, PD-L1, constitute a critical immune checkpoint pathway responsible for regulating T-cell activation (21). PD-1 is primarily expressed on T cells and PD-L1 on tumor, immune and stromal cells. PD-L1 is upregulated on various cancer cells, facilitating tumor immune escape. Over the past decade, therapeutic antibodies targeting the PD-1/PD-L1 axis have been developed to alleviate the immunosuppression caused by these two proteins (22,23). Despite extensive research, the prognostic significance of PD-1 remains controversial and its functional role within the tumor microenvironment awaits further elucidation (24). Regarding the anti-tumor mechanism, the PD-1 antibody specifically binds to PD-1 on the surface of tumor cells or immune cells, thereby blocking its interaction with PD-L1. This action releases T cells from their inhibitory state, restoring their cytotoxic capabilities against tumors. Upon blockade of the PD-L1/PD-1 signaling pathway, T cells regain their capacity for proliferation, cytokine secretion (e.g., IFN-γ, TNF-α) and direct tumor cell killing. Additionally, the PD-1 antibody may indirectly activate dendritic cells and natural killer cells, enhancing antigen presentation and the overall anti-tumor immune response (25). In gastric cancer treatment, the use of PD-1 antibodies effectively prolongs progression-free survival (PFS) and overall survival (OS), while minimizing adverse reactions and improving clinical outcomes (26). PD-1 antibody therapy, either as monotherapy or in combination with chemotherapy, has shown significant improvements in OS and PFS in patients with lung cancer and high PD-1 expression (27). As adjuvant therapy for high-risk stage III melanoma, PD-1 antibodies have significantly prolonged recurrence-free survival when compared to placebo (28). In advanced or recurrent EC, the addition of Pembrolizumab to standard chemotherapy resulted in significantly longer PFS compared to chemotherapy alone (29). The bioinformatics analysis of the present study revealed that PDCD1 expression was significantly upregulated in EC tissues relative to normal endometrial tissues. Furthermore, cellular experiments indicated that Pembrolizumab could inhibit EC-cell proliferation by inducing S-phase arrest and promoting apoptosis, thereby clarifying the underlying mechanism of PD-1 antibody action on EC cells.

Combined anti-CD20 and PD-1 antibodies can effectively inhibit tumor progression through diverse anti-tumor mechanisms. Two Phase II studies demonstrated that the combination of Pembrolizumab and Rituximab effectively blocked PD-1 signaling in patients with relapsed or refractory follicular lymphoma, achieving an objective response rate of 67%. This finding suggests that the combination of anti-CD20 antibodies and PD-1 antibodies exhibits synergistic anticancer effects (30). Additionally, certain studies have indicated that incorporating PD-1 antibodies into anti-CD20 antibody regimens may counteract the poor prognosis associated with aberrant activation of the PD-1/PD-L1 pathway (31). Furthermore, the present study revealed that the proportion of apoptotic cells in the combination group was significantly higher than that in the single-agent group, accompanied by an increased proportion of cells in the S and G2/M phases, indicating a synergistic apoptosis-inducing effect of the two antibodies. However, the underlying mechanism of interaction remains elusive. It may be hypothesized that the anti-CD20 antibody improves the tumor immune microenvironment by regulating B cells, thereby enhancing the T-cell activating effect of the PD-1 antibody; further investigation is therefore warranted.

Regarding advantages and limitations, the present study reports the mRNA expression levels of MS4A1 and PDCD1; however, the protein expression levels have not yet been verified. The effects of anti-CD20 and PD-1 antibodies on the proliferation, apoptosis and cell cycle of EC cells were only demonstrated in vitro, but no in vivo experiments and no clinical experiments were performed. Meanwhile, the absence of immune cells in cell culture limits the interpretation of ADCC/CDC mechanisms; such mechanisms cannot be inferred without immune cells.

In conclusion, the present in vitro results demonstrate that combined treatment with anti-CD20 and PD-1 antibodies effectively suppresses EC-cell proliferation and markedly promotes apoptosis, providing preliminary experimental evidence supporting further mechanistic and in vivo validation.

Acknowledgements

Not applicable.

Funding

This project was supported by the National Natural Science Foundation of China (grant no. 82160443), the Guangxi Natural Science Foundation (grant no. 2020GXNSFAA159023), the independent research project of the Regional Key Laboratory of Early Prevention and Treatment of High-incidence Tumors in 2021 (grant no. GKE-ZZ 202147), the 18th batch of Guangxi ‘New Century Ten Hundred Thousand Talents Project’ second-level candidate special fund (grant no. 2015226) and the Guangxi Medical High-level Backbone Talent Training ‘139’ Plan special fund (grant no. G201903032).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

JS and HW designed the research. YY and JD collected and analyzed the data. MF, QH and BL collected and analyzed the data and supervised the study. JS drafted the article and HW edited it. JS and HW confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Sorosky JI: Endometrial cancer. Obstet Gynecol. 120:383–397. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Makker V, MacKay H, Ray-Coquard I, Levine DA, Westin SN, Aoki D and Oaknin A: Endometrial cancer. Nat Rev Dis Primers. 7:882021. View Article : Google Scholar : PubMed/NCBI

3 

Francisco LM, Sage PT and Sharpe AH: The PD-1 pathway in tolerance and autoimmunity. Immunol Rev. 236:219–242. 2010. View Article : Google Scholar : PubMed/NCBI

4 

He X and Xu C: Immune checkpoint signaling and cancer immunotherapy. Cell Res. 30:660–669. 2020. View Article : Google Scholar : PubMed/NCBI

5 

Kurachi M: CD8+ T cell exhaustion. Semin Immunopathol. 41:327–337. 2019. View Article : Google Scholar : PubMed/NCBI

6 

Mittica G, Ghisoni E, Giannone G, Aglietta M, Genta S and Valabrega G: Checkpoint inhibitors in endometrial cancer: Preclinical rationale and clinical activity. Oncotarget. 8:90532–90544. 2017. View Article : Google Scholar : PubMed/NCBI

7 

Casadesús AV, Cruz BM, Díaz W, González MÁ, Gómez T, Fernández B, González A, Ledón N, Sosa K, Castro K, et al: Potent immunomodulatory and antitumor effect of anti-CD20-IL2no-alpha tri-functional immunocytokine for cancer therapy. Front Immunol. 13:10218282022. View Article : Google Scholar : PubMed/NCBI

8 

Hamed MM, Gouida MS, Abd El-Aziz SR and El-Sokkary AMA: Evaluation PD-L1, CD8 and CD20 as early predictor and tracking markers for breast cancer (BC) in Egypt. Heliyon. 8:e094742022. View Article : Google Scholar : PubMed/NCBI

9 

Su J, Li Z, Wang J, Liu N, Bao L, Du J, Li Y, Yu Y and Wang H: The causal relationship between anti-CD20 antibodies and endometrial cancer: A Mendelian randomization study. Discov Oncol. 15:6132024. View Article : Google Scholar : PubMed/NCBI

10 

Markowska A, Pawałowska M, Lubin J and Markowska J: Signalling pathways in endometrial cancer. Contemp Oncol (Pozn). 18:143–148. 2014.PubMed/NCBI

11 

Cragg MS, Walshe CA, Ivanov AO and Glennie MJ: The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8:140–174. 2005. View Article : Google Scholar : PubMed/NCBI

12 

Kumar A, Planchais C, Fronzes R, Mouquet H and Reyes N: Binding mechanisms of therapeutic antibodies to human CD20. Science. 369:793–799. 2020. View Article : Google Scholar : PubMed/NCBI

13 

Moreno Torres I and García-Merino A: Anti-CD20 monoclonal antibodies in multiple sclerosis. Expert Rev Neurother. 17:359–371. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Schlaak M, Schmidt P and Bangard C, Schlaak M, Schmidt P and Bangard C: Regression of metastatic melanoma in a patient by antibody targeting of cancer stem cells. Oncotarget. 3:22–30. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Smith MR: Rituximab (monoclonal anti-CD20 antibody): Mechanisms of action and resistance. Oncogene. 22:7359–7368. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Dieu-Nosjean MC, Goc J, Giraldo NA, Sautès-Fridman C and Fridman WH: Tertiary lymphoid structures in cancer and beyond. Trends Immunol. 35:571–580. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Qin M, Hamanishi J, Ukita M, Yamanoi K, Takamatsu S, Abiko K, Murakami R, Miyamoto T, Suzuki H, Ueda A, et al: Tertiary lymphoid structures are associated with favorable survival outcomes in patients with endometrial cancer. Cancer Immunol Immunother. 71:1431–1442. 2022. View Article : Google Scholar : PubMed/NCBI

18 

Shimizu Y, Suzuki S, Ukai M, Hattori S, Yoshikawa N and Kajiyama H: The prognostic significance of peritumoral lymphocytes' Band-like structure in Type II endometrial cancer. Anticancer Res. 41:249–258. 2021. View Article : Google Scholar : PubMed/NCBI

19 

Jia HQ, Zhang SP, Chen Y, Qiao YH, Yao YF, Zhang XY, Wu SY, Song YL and Xing XM: Characteristics and significance of tertiary lymphoid structures based on molecular subtypes in endometrial cancer. Int J Gynecol Pathol. 43:595–604. 2024. View Article : Google Scholar : PubMed/NCBI

20 

Guo YE, Liu Y, Zhang W, Luo H, Shu P, Chen G and Li Y: The clinicopathological characteristics, prognosis and immune microenvironment mapping in MSI-H/MMR-D endometrial carcinomas. Discov Oncol. 13:122022. View Article : Google Scholar : PubMed/NCBI

21 

Rozali EN, Hato SV, Robinson BW, Lake RA and Lesterhuis WJ: Programmed death ligand 2 in cancer-induced immune suppression. Clin Dev Immunol. 2012:6563402012. View Article : Google Scholar : PubMed/NCBI

22 

Chen J, Jiang CC, Jin L and Zhang XD: Regulation of PD-L1: A novel role of pro-survival signalling in cancer. Ann Oncol. 27:409–416. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Liu CQ, Xu J, Zhou ZG, Jin LL, Yu XJ, Xiao G, Lin J, Zhuang SM, Zhang YJ and Zheng L: Expression patterns of programmed death ligand 1 correlate with different microenvironments and patient prognosis in hepatocellular carcinoma. Br J Cancer. 119:80–88. 2018. View Article : Google Scholar : PubMed/NCBI

24 

Drakes ML, Mehrotra S, Aldulescu M, Potkul RK, Liu Y, Grisoli A, Joyce C, O'Brien TE, Stack MS and Stiff PJ: Stratification of ovarian tumor pathology by expression of programmed cell death-1 (PD-1) and PD-ligand-1 (PD-L1) in ovarian cancer. J Ovarian Res. 11:432018. View Article : Google Scholar : PubMed/NCBI

25 

Lin X, Kang K, Chen P, Zeng Z, Li G, Xiong W, Yi M and Xiang B: Regulatory mechanisms of PD-1/PD-L1 in cancers. Mol Cancer. 23:1082024. View Article : Google Scholar : PubMed/NCBI

26 

Janjigian YY, Shitara K, Moehler M, Garrido M, Salman P, Shen L, Wyrwicz L, Yamaguchi K, Skoczylas T, Campos Bragagnoli A, et al: First-line nivolumab plus chemotherapy versus chemotherapy alone for advanced gastric, gastro-oesophageal junction, and oesophageal adenocarcinoma (CheckMate 649): A randomised, open-label, phase 3 trial. Lancet. 398:27–40. 2021. View Article : Google Scholar : PubMed/NCBI

27 

Gandhi L, Rodríguez-Abreu D, Gadgeel S, Esteban E, Felip E, De Angelis F, Domine M, Clingan P, Hochmair MJ, Powell SF, et al: Pembrolizumab plus chemotherapy in metastatic Non-Small-cell lung cancer. N Engl J Med. 378:2078–2092. 2018. View Article : Google Scholar : PubMed/NCBI

28 

Eggermont AMM, Blank CU, Mandala M, Long GV, Atkinson V, Dalle S, Haydon A, Lichinitser M, Khattak A, Carlino MS, et al: Adjuvant pembrolizumab versus placebo in resected stage III melanoma. N Engl J Med. 378:1789–1801. 2018. View Article : Google Scholar : PubMed/NCBI

29 

Eskander RN, Sill MW, Beffa L, Moore RG, Hope JM, Musa FB, Mannel R, Shahin MS, Cantuaria GH, Girda E, et al: Pembrolizumab plus chemotherapy in advanced endometrial cancer. N Engl J Med. 388:2159–2170. 2023. View Article : Google Scholar : PubMed/NCBI

30 

Zeng Z, Yang A, Yang J, Zhang S, Xing Z, Wang X, Mei W, Jiang C, Lin J, Wu X, et al: Sintilimab (anti-PD-1 antibody) combined with high-dose methotrexate, temozolomide, and rituximab (anti-CD20 antibody) in primary central nervous system lymphoma: A phase 2 study. Signal Transduct Target Ther. 9:2292024. View Article : Google Scholar : PubMed/NCBI

31 

Cho H, Kim SH, Kim SJ, Chang JH, Yang WI, Suh CO, Kim YR, Jang JE, Cheong JW, Min YH and Kim JS: Programmed cell death 1 expression is associated with inferior survival in patients with primary central nervous system lymphoma. Oncotarget. 8:87317–87328. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Su J, Du J, Yu Y, Feng M, Huang Q, Liu B and Wang H: Anti‑CD20 and ‑PD‑1 antibody effects on proliferation, apoptosis and cell cycle of endometrial cancer cells. Oncol Lett 32: 357, 2026.
APA
Su, J., Du, J., Yu, Y., Feng, M., Huang, Q., Liu, B., & Wang, H. (2026). Anti‑CD20 and ‑PD‑1 antibody effects on proliferation, apoptosis and cell cycle of endometrial cancer cells. Oncology Letters, 32, 357. https://doi.org/10.3892/ol.2026.15712
MLA
Su, J., Du, J., Yu, Y., Feng, M., Huang, Q., Liu, B., Wang, H."Anti‑CD20 and ‑PD‑1 antibody effects on proliferation, apoptosis and cell cycle of endometrial cancer cells". Oncology Letters 32.2 (2026): 357.
Chicago
Su, J., Du, J., Yu, Y., Feng, M., Huang, Q., Liu, B., Wang, H."Anti‑CD20 and ‑PD‑1 antibody effects on proliferation, apoptosis and cell cycle of endometrial cancer cells". Oncology Letters 32, no. 2 (2026): 357. https://doi.org/10.3892/ol.2026.15712
Copy and paste a formatted citation
x
Spandidos Publications style
Su J, Du J, Yu Y, Feng M, Huang Q, Liu B and Wang H: Anti‑CD20 and ‑PD‑1 antibody effects on proliferation, apoptosis and cell cycle of endometrial cancer cells. Oncol Lett 32: 357, 2026.
APA
Su, J., Du, J., Yu, Y., Feng, M., Huang, Q., Liu, B., & Wang, H. (2026). Anti‑CD20 and ‑PD‑1 antibody effects on proliferation, apoptosis and cell cycle of endometrial cancer cells. Oncology Letters, 32, 357. https://doi.org/10.3892/ol.2026.15712
MLA
Su, J., Du, J., Yu, Y., Feng, M., Huang, Q., Liu, B., Wang, H."Anti‑CD20 and ‑PD‑1 antibody effects on proliferation, apoptosis and cell cycle of endometrial cancer cells". Oncology Letters 32.2 (2026): 357.
Chicago
Su, J., Du, J., Yu, Y., Feng, M., Huang, Q., Liu, B., Wang, H."Anti‑CD20 and ‑PD‑1 antibody effects on proliferation, apoptosis and cell cycle of endometrial cancer cells". Oncology Letters 32, no. 2 (2026): 357. https://doi.org/10.3892/ol.2026.15712
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team