Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
October-2026 Volume 32 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2026 Volume 32 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Colorectal cancer and tumor vaccines (Review)

  • Authors:
    • Jianshuang Ma
    • Congming Xiang
    • Dong Xia
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, Affiliated Hospital of Southwest Medical University, Luzhou, Sichuan 646000, P.R. China, Department of General Surgery, Affiliated Hospital of Southwest Medical University, Luzhou, Sichuan 646000, P.R. China
    Copyright: © Ma et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Article Number: 472
    |
    Published online on: August 21, 2026
       https://doi.org/10.3892/ol.2026.15827
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Colorectal cancer (CRC), one of the most common malignant tumors of the digestive system worldwide, shows an annual upward trend in its incidence and mortality, posing a serious threat to human health and life. In recent years, with the rapid development of immunotherapeutic drugs and the continuous optimization of CRC treatment strategies, breakthrough progress has been achieved in CRC treatment, which has improved patients' prognosis to a certain extent. As an emerging immunotherapy, tumor vaccines can stimulate the body to produce specific immune responses against tumor antigens, activate cellular immunity, eliminate tumor cells and inhibit tumor growth. The present study reviewed different categories of CRC vaccines and their clinical applications in CRC treatment, analyzed the current challenges in CRC vaccine development and suggested future research directions to promote the further development and clinical application of tumor vaccines.

Introduction

The Cancer Genome Atlas (TCGA) defines patients with World Health Organization (WHO) grade II or III glioma as low-grade glioma (LGG) (1), which accounts for 20–40% of all glioma cases (2). The cumulative risk of progression to glioblastoma (GBM) within a 10-year follow-up period is ~70% (3), posing a severe threat to the life and health of patients. Current treatment strategies are mainly based on surgical resection combined with neoadjuvant therapies such as radiotherapy and chemotherapy, yet the postoperative recurrence rate remains considerably high (4). With the advance of next-generation sequencing technology, a large number of tumor-associated molecular biomarkers have been identified and gradually applied in clinical practice, providing a novel direction for the precise diagnosis and treatment of tumors (5). Although GBM exhibits higher malignancy, genomic expression disorders frequently occur during tumorigenesis and progression, and the molecular mechanisms underlying such disorders often differ between GBM and LGG (6). Therefore, the present study focused on LGG to screen molecular biomarkers associated with disease progression, laying a theoretical foundation for subsequent combined therapy for LGG.

Family with sequence similarity 122 (FAM122) is a class of highly conserved proteins (7), whose members include FAM122A, FAM122B and FAM122C. FAM122A is the most extensively studied member of the family and has been identified as a key negative regulator of the protein phosphatase 2A (PP2A) holoenzyme (8). FAM122A can specifically bind to the interaction interface between the scaffold subunit Aα and the regulatory subunit B55α through its conserved domain, directly impairing the assembly stability of the PP2A/Aα-B55α-C holoenzyme, thereby inhibiting the phosphatase activity of PP2A (9). This inhibitory effect leads to hyperphosphorylation and stable expression of downstream oncoproteins (such as MYC), ultimately promoting abnormal cell cycle progression, inhibiting apoptosis and enhancing the invasive and proliferative capacities of tumor cells (10). For instance, FAM122A has been confirmed to promote the progression of acute myeloid leukemia by modulating the expression of PP2A and MYC (10). In addition, in hepatocellular carcinoma, FAM122A can regulate PP2A-dependent downstream pathways to facilitate cancer cell growth and increase chemoresistance to doxorubicin (11).

In contrast to the well-characterized FAM122A, the physiological functions and pathological mechanisms of FAM122B remain to be fully elucidated to date. As a homologous protein of FAM122A, FAM122B may also possess similar oncogenic potential. In the preliminary stage of the present study, differential analysis revealed that FAM122B is highly expressed in LGG, suggesting its potential correlation with the malignant phenotype of tumors. The present study aimed to clarify whether FAM122B is involved in regulating the proliferative capacity of LGG cells and its role in the malignant progression of the disease, thereby providing a reference for the subsequent development of diagnostic and therapeutic targets.

Materials and methods

Cell culture

All the cell lines used in the present study (HA1800, SHG44 and SW1088) were purchased from TongPai (Shanghai) Biotech Co., Ltd. The HA1800 cells (cat. no. HA1800; http://www.shtpbio.com/tongpai-Products/) used in the present study were immortalized human normal astrocytes. HA1800 and SHG44 cells were cultured in high-glucose DMEM medium (Cytiva; cat. no. SH30022), while SW1088 cells were maintained in Leibovitz L-15 medium (Cytiva; cat. no. SH30525). All media were supplemented with 10% fetal bovine serum (HySigen Biosciences; cat. no. FBP-S005) and 1% penicillin-streptomycin solution (Beijing Solarbio Science & Technology Co, Ltd.; cat. no. P1400) to sustain cell growth and inhibit microbial contamination. The cells were incubated in a constant-temperature cell incubator at 37°C with 5% CO2 and saturated humidity. Cell density was observed daily. When the cell confluence reached ~90%, the cells were rinsed twice with phosphate-buffered saline (Beijing Solarbio Science & Technology Co, Ltd.; cat. no. P1020), followed by digestion into single-cell suspension using 0.25% trypsin-EDTA (Beijing Solarbio Science & Technology Co, Ltd.; cat. no. T1300). The digestion was terminated with complete medium prior to subsequent treatments.

Cell transfection

SHG44 and SW1088 cells were seeded at a density of 5×105 cells/well into 6-well cell culture plates (Wuhan Servicebio Technology Co., Ltd.; cat. no. CCP-6H) and cultured at 37°C overnight until cell confluence reached 50–60%. After which, cells were treated with the transfection reagent, Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.; cat. no. L3000075), and the transfection medium, Opti-MEM™ I Reduced Serum Medium (Thermo Fisher Scientific, Inc.; cat. no. 31985070). Small interfering RNA (siRNA) targeting FAM122B was purchased from Shanghai GenePharma Co., Ltd. The sequences of FAM122B siRNA were sense strand: 5′-CGGAGGAATAGTACAACAATTdTdT-3′, antisense strand: 5′-AATTGTTGTACTATTCCTCCGdTdT-3′ (RefSeq accession number: NM_145284). The sequences of negative control siRNA were sense strand: 5′-UUCUCCGAACGUGUCACGUdTdT-3′, antisense strand: 5′-ACGUGACACGUUCGGAGAAdTdT-3′. The final working concentration of siRNA for cell transfection was 50 nM. For transfection, FAM122B siRNA and Lipofectamine® 3000 reagent were separately diluted in Opti-MEM Reduced Serum Medium, allowed to stand for 5 min, gently mixed and incubated at room temperature for 20 min to form stable transfection complexes. Subsequently, the transfection complexes were slowly added dropwise into 6-well plates containing reduced serum medium. After 6–8 h of transfection, the medium was replaced with complete medium and cell culture was continued.

Reverse transcription-quantitative (RT-q)PCR

The cells were seeded at a confluency of 60–70%. At 24–48 h post-transfection, total RNA was extracted from LGG cells using an RNA extraction kit (Omega Bio-Tek, Inc.; cat. no. R6834). The concentration and purity of RNA were measured by Thermo Fisher NanoDrop micro-spectrophotometer (Thermo Fisher Scientific, Inc.). After which, the extracted RNA was reverse-transcribed into cDNA using a reverse transcription kit (Novoprotein Scientific Co., Ltd.; cat. no. E047) under the following conditions: 25°C for 5 min, 50°C for 15 min and 85°C for 5 min, with final storage at 4°C. qPCR was performed using a qPCR kit (Novoprotein Scientific Co., Ltd.; cat. no. E096) to verify transfection efficiency with the following conditions: Pre-denaturation at 95°C for 5 min for 1 cycle; 95°C for 10 sec and 60°C for 30 sec for a total of 40 cycles. Primer sequences were as follows: FAM122B (alias PABIR2) forward primer, AAGGGAAATGCAAACGGCAAT and reverse primer, TCTCCGGCTTGTCAAAATCAC; 18S forward primer, CACCAGACTTGCCCTCCAAT and reverse primer, CCTGAGAAACGGCTACCACAT. All primers were obtained from Zhengzhou Shangzhiya Biotechnology Co., Ltd. RNA extraction, cDNA synthesis and qPCR were performed strictly in accordance with the manufacturer's protocols. The 2−ΔΔCq method was used to calculate relative gene expression levels (12), and all aforementioned experiments were repeated in triplicate. Under the experimental conditions used in this study, 18S was stably expressed, with no significant differences in Cq values between the NC and siRNA groups.

CCK-8 cell proliferation assay

Transfected SHG44 and SW1088 cells were seeded in 96-well plates at a density of 2×103 cells/well, with 6 replicate wells set for each group to reduce experimental errors. Assays were performed at the following five time points: 0, 24, 48, 72 and 96 h post-seeding. Specifically, 10 µl CCK-8 reagent (Shanghai Saint-Bio Biotechnology Co., Ltd.; cat. no. ST1008) was added to each well, and the plate was gently shaken to ensure thorough mixing of the reagent with the medium. The plate was then incubated at 37°C for 1 h in the dark. After incubation, a microplate reader was used to measure the absorbance (OD value) of each well at a wavelength of 450 nm, with the OD value serving as an indicator of cell proliferation activity.

Colony formation assay

Transfected SHG44 and SW1088 cells were digested into a single-cell suspension, counted and uniformly seeded in 6-well plates at a density of 1,000 cells/well, with three replicate wells set up for each group. The cells were cultured for 10–15 days, with the medium replaced every three days. After visible cell clones formed, the medium was discarded, and the cells were fixed with 4% paraformaldehyde at room temperature for 30 min, followed by staining with 0.1% crystal violet solution at room temperature for a further 30 min. Excess dye was rinsed off with running water, and the plates were air-dried. Cell colonies were defined as cell clusters with a size of >100 pixel2 and analyzed using ImageJ software (version 1.54i; National Institutes of Health).

Wound healing assay

Transfected SHG44 and SW1088 cells were seeded in 6-well plates and cultured until >90% confluence. A horizontal line was drawn on the back of each 6-well plate as an anchor point to ensure consistent imaging fields at all time points. A straight scratch wound was made vertically across the horizontal line at the center of each well using a sterile 1,000 µl pipette tip, with effort made to maintain uniform wound width across all wells. The cells were rinsed twice with PBS to remove floating cells, and the medium was replaced with serum-free medium. Images of the wound areas were captured under an inverted microscope at 0, 24 and 48 h post-scratching, respectively. The wound healing rate was calculated using Image software (version 1.54i, National Institutes of Health) according to the following formula: Wound healing rate=[(wound width at 0 h-wound width at 24/48 h)/wound width at 0 h] ×100%. This index was used to evaluate the migratory ability of the cells.

Transwell assay

Cell migration ability was assessed using uncoated Transwell chambers (Wuhan Servicebio Technology Co., Ltd.; cat. no. WG3415). Transfected SHG44 and SW1088 cells were digested into a single-cell suspension, resuspended in serum-free medium and adjusted to a density of 1×105 cells/ml. A 200 µl aliquot of the cell suspension was added to the upper chamber, while 600 µl complete medium was placed in the lower chamber as a chemoattractant. After incubation at 37°C for 24 h, non-migratory cells on the upper surface of the chamber membrane were gently wiped off with cotton swabs. Migratory cells on the lower surface were fixed with 4% paraformaldehyde (Wuhan Servicebio Technology Co., Ltd.; cat. no. P1110) at room temperature for 30 min and stained with 0.1% crystal violet solution (Wuhan Servicebio Technology Co., Ltd.; cat. no. C8470) at room temperature for a further 30 min. Excess dye on the membrane surface was rinsed away slowly with running water, followed by air-drying at room temperature. Images were captured under an inverted microscope for cell counting, and the average number of migratory cells was calculated to evaluate cell migration ability.

Data collection

Several public databases and datasets were employed for bioinformatics analyses. Firstly, gene expression profiles were retrieved from five publicly available Gene Expression Omnibus (GEO) datasets (https://www.ncbi.nlm.nih.gov/geo/) (dataset nos. GSE35493, GSE43378, GSE50025, GSE74187 and GSE83300), with detailed characteristics of these datasets presented in Table SI. TCGA (https://portal.gdc.cancer.gov/) database provided mRNA sequencing data and corresponding clinical information of 503 LGG cases, and the Chinese Glioma Genome Atlas (CGGA) database (http://www.cgga.org.cn/) included 403 cases of mRNA sequencing data, 142 cases of microarray data and matched clinical characteristics of LGG. In addition, the Human Protein Atlas (HPA) database (https://www.proteinatlas.org/), contained immunohistochemistry (IHC) data of FAM122B in three normal cerebral cortex samples and five LGG tissue samples. Finally, the TIMER database (TIMER2.0; http://cistrome.shinyapps.io/timer/) supplied immune cell infiltration data of LGG tissues. All data were downloaded from the official websites of the corresponding databases. The inclusion criteria were complete mRNA expression data and available clinical follow-up information.

Gene set enrichment analysis (GSEA)

To explore the potential molecular pathways through which high FAM122B expression regulates LGG progression, GSEA was performed using GSEA software (version 4.3.3; http://www.gsea-msigdb.org/gsea/index.jsp). The gene set employed for analysis was c2.cp.v7.5.symbols.gmt (pathway-associated gene set), which was used to assess the enrichment levels of pathways between the FAM122B high-expression group and low-expression group. Pathways with a false discovery rate (FDR) <0.25 and P<0.05 were defined as markedly enriched pathways.

Meta-analysis

For retrospective studies, meta-analysis can integrate and pool multiple datasets from different sources, thereby improving the generalizability and extrapolation of research conclusions. Previous findings of the present study indicated that high expression of FAM122B serves as an adverse prognostic risk factor in LGG. To further expand the sample size and verify whether the negative effect of FAM122B expression on the prognosis of patients with LGG is universally applicable, the following seven independently sourced datasets were included in the present study: i) TCGA RNA-Seq (https://portal.gdc.cancer.gov/); ii) CGGA mRNA-array (http://www.cgga.org.cn/); iii) CGGA RNA-Seq; iv) GSE43378 (13); v) GSE50025 (14); vi) GSE74187 (15); and vii) GSE83300 (16) (https://www.ncbi.nlm.nih.gov/geo/). The aforementioned datasets cover cohorts from different countries and ethnic populations, and adopt multiple molecular detection platforms. Prior to conducting the meta-analysis, a separate prognostic analysis was performed for each dataset. The Cox regression model was used to obtain the prognostic effect sizes of each cohort, followed by meta-analysis to pool and synthesize these prognostic effect sizes across all studies. The present study used the I2 statistic to assess the heterogeneity among datasets. Statistical analyses were conducted using R software (version 4.5.0; R Foundation for Statistical Computing; http://www.r-project.org/) and the ‘meta’ (https://CRAN.R-project.org/package=meta) package. Significant statistical heterogeneity was defined as I2>50% accompanied by P<0.05 for the heterogeneity test. A random-effects model was used for pooled analyses to account for potential between-study heterogeneity.

Statistical analysis

Statistical analyses and visualizations were performed using R software (version 4.5.0) with the ‘survival’ (https://CRAN.R-project.org/package=survival), ‘survminer’ (https://CRAN.R-project.org/package=survminer), ‘corrplot’ (https://CRAN.R-project.org/package=corrplot), ‘ggplot2’ (https://CRAN.R-project.org/package=ggplot2), ‘dplyr’ (https://CRAN.R-project.org/package=dplyr), ‘pROC’ (https://CRAN.R-project.org/package=pROC) and ‘forestplot’ (https://CRAN.R-project.org/package=forestplot) packages. A two-tailed significance level was set at α=0.05, with P<0.05 considered to indicate a statistically significant difference. First, data on target gene expression, clinicopathological characteristics and survival outcomes (endpoint events, follow-up time and censoring status) of the study samples were collated. After quality control, samples were divided into high and low expression groups based on the median value of gene expression. For clinical correlation analysis, Pearson/Spearman correlation analyses were used for continuous variables, and χ2 test was applied for categorical variables. Kaplan-Meier curves were plotted to visualize survival distributions, and the Log-rank test was used to compare survival differences between the high and low gene expression groups. Univariate and multivariate Cox proportional hazards regression analyses were sequentially conducted. After verifying the proportional hazards assumption via the Schoenfeld residual method, independent risk factors for survival outcomes were identified, with hazard ratio (HR) and 95% confidence interval (CI) calculated, and forest plots generated to present the results. The ‘ROC’ package was used to plot receiver operating characteristic (ROC) curves and calculate the area under the curve (AUC) for evaluating the predictive value of target gene expression for clinical outcomes of the subjects. All experimental data were statistically analyzed using GraphPad Prism 10.0 software (Dotmatics). Student's t-test was used for comparisons between two groups, while one-way ANOVA followed by Dunnett's multiple comparisons test was applied for datasets with three or more groups. Quantitative data were expressed as mean ± standard deviation. Survival data were displayed via Kaplan-Meier survival curves. Correlation results were presented in correlation heatmaps. HR results were visualized by forest plots. Diagnostic efficacy was shown by ROC curves. Enumeration data were presented as case numbers and percentages.

Results

Expression analysis of FAM122B in LGG

Malignant progression of gliomas is often accompanied by disorders of genomic expression profiles (17). To clarify the expression characteristics of FAM122B in gliomas, the present study first performed bioinformatics analysis using the GSE35493 dataset from the GEO database. The results showed that the mRNA level of FAM122B was markedly higher in tumor tissues than in normal brain tissues (normal group, n=9; tumor group, n=12; Fig. 1A). To verify the aforementioned bioinformatics analysis results, the mRNA expression level of FAM122B in LGG cell lines and normal astrocytes was detected using the RT-qPCR assay. The human normal astrocyte cell line HA1800 was selected as the control, and the LGG cell lines SW1088 and SHG44 were used as the research objects. The results confirmed that the mRNA of FAM122B was markedly higher in LGG cell lines than in normal HA1800 glial cells (Fig. 1B), which was consistent with the database analysis results. Furthermore, the expression difference of FAM122B was verified at the protein level. The IHC data for FAM122B were retrieved from the HPA database, and downloaded and analyzed the IHC results of three cases of normal cerebral cortex tissues and five cases of LGG tumor tissues (Figs. 1D and E; S1 and S2). The results showed that compared with normal cerebral cortex tissues, the protein expression level of FAM122B in LGG tumor tissues was markedly increased (Fig. 1C). The results of the present study demonstrated that FAM122B is highly expressed at both the mRNA and protein levels in LGG tissues and cell lines, which lays an experimental foundation for the subsequent in-depth exploration of the correlation between the high expression of FAM122B and the poor prognosis of patients with LGG.

FAM122B is highly expressed in
LGG tissues and cell lines. (A) mRNA expression levels of
FAM122B in normal brain tissues (n=9) and LGG tumor tissues
(n=12) from the GSE35493 dataset. (B) RT-qPCR results showing the
relative mRNA expression of FAM122B in the human normal
astrocyte cell line HA1800 and LGG cell lines SW1088 and SHG44. (C)
Quantification of the IHC staining results in panels (D) and (E),
showing the average optical density of FAM122B protein
expression in normal cerebral cortex tissues (n=3) and LGG tumor
tissues (n=5). Representative IHC staining image of FAM122B
in (D) normal cerebral cortex tissues and (E) in LGG tumor tissues
from the HPA database. All original magnification, ×4.3.
*P<0.05, **P<0.01. FAM122B, Family with sequence
similarity 122, member B; LGG, low-grade glioma; RT-qPCR, reverse
transcription-quantitative PCR; IHC, immunohistochemistry; HPA,
Human Protein Atlas.

Figure 1.

FAM122B is highly expressed in LGG tissues and cell lines. (A) mRNA expression levels of FAM122B in normal brain tissues (n=9) and LGG tumor tissues (n=12) from the GSE35493 dataset. (B) RT-qPCR results showing the relative mRNA expression of FAM122B in the human normal astrocyte cell line HA1800 and LGG cell lines SW1088 and SHG44. (C) Quantification of the IHC staining results in panels (D) and (E), showing the average optical density of FAM122B protein expression in normal cerebral cortex tissues (n=3) and LGG tumor tissues (n=5). Representative IHC staining image of FAM122B in (D) normal cerebral cortex tissues and (E) in LGG tumor tissues from the HPA database. All original magnification, ×4.3. *P<0.05, **P<0.01. FAM122B, Family with sequence similarity 122, member B; LGG, low-grade glioma; RT-qPCR, reverse transcription-quantitative PCR; IHC, immunohistochemistry; HPA, Human Protein Atlas.

Analysis of the correlation between FAM122B expression and clinical characteristics of patients with LGG

To explore the correlation between FAM122B expression and the clinical characteristics of patients with LGG, mRNA expression data and corresponding clinical characteristic information from patients with LGG were downloaded from three databases, namely TCGA-seq, CGGA-seq and CGGA microarray, and an integrated analysis was performed. Firstly, in terms of clinical grading, the prognosis of patients with WHO grade III LGG was markedly worse than that of patients with WHO grade II (18). Meanwhile, in all three aforementioned databases, it was observed that the mRNA expression level of FAM122B was markedly upregulated with increasing WHO grade of gliomas (Fig. 2A-C), suggesting a positive correlation between its expression and the malignant degree of tumors. Second, compared with primary LGG, recurrent LGG tumor cells possess stronger invasiveness and lead to worse prognosis (19). Data from three databases indicated that the mRNA expression level of FAM122B was higher in samples from recurrent patients than in those from primary patients (Fig. 2D-F). Finally, analysis of key molecular markers based on glioma grading showed that IDH mutation and 1p19q chromosome co-deletion are important indicators of favorable prognosis in patients with LGG (20). Meanwhile, the mRNA expression level of FAM122B in tumor tissues was correspondingly decreased in patients with LGG with IDH mutation (Fig. 2G and H) and 1p19q co-deletion (Fig. 2I) phenotypes, which further confirmed that FAM122B expression is correlated with the prognostic characteristics of patients. In summary, the results of multi-database and multi-clinical dimension analyses all indicate that high FAM122B expression is closely correlated with malignant clinical phenotypes of patients with LGG (high grade, recurrence, absence of IDH mutation and non-co-deletion of 1p19q), suggesting that its high expression may drive the deterioration of clinical prognosis in patients with LGG. Based on these results, the direct correlation between FAM122B expression level and the prognosis of patients with LGG will be further explored in subsequent studies.

Correlation analysis between
FAM122B expression level and clinicopathological
characteristics of patients with LGG. (A) Comparison of
FAM122B mRNA expression levels in LGG tissues with different
WHO grades (grade II vs. grade III) based on TCGA RNA-seq dataset.
(B) Comparison of FAM122B mRNA expression levels in LGG
tissues with different WHO grades (grade II vs. grade III) based on
CGGA RNA-seq dataset. (C) Comparison of FAM122B mRNA
expression levels in LGG tissues with different WHO grades (grade
II vs. grade III) based on CGGA microarray dataset. (D) Comparison
of FAM122B mRNA expression levels between primary and
recurrent LGG tissues in the TCGA RNA-seq dataset. (E) Comparison
of FAM122B mRNA expression levels between primary and
recurrent LGG tissues in the CGGA RNA-seq dataset. (F) Comparison
of FAM122B mRNA expression levels between primary and
recurrent LGG tissues in the CGGA microarray dataset. (G)
Comparison of FAM122B mRNA expression levels in LGG tissues
with different IDH mutation statuses based on TCGA RNA-seq dataset.
(H) Comparison of FAM122B mRNA expression levels in LGG
tissues with different IDH mutation statuses based on CGGA RNA-seq
dataset. (I) Comparison of FAM122B mRNA expression levels in
LGG tissues with different 1p19q co-deletion statuses based on the
CGGA RNA-seq dataset. FAM122B, Family with sequence
similarity 122, member B; LGG, low-grade glioma; WHO, World Health
Organization; TCGA, The Cancer Genome Atlas; CGGA, Chinese Glioma
Genome Atlas.

Figure 2.

Correlation analysis between FAM122B expression level and clinicopathological characteristics of patients with LGG. (A) Comparison of FAM122B mRNA expression levels in LGG tissues with different WHO grades (grade II vs. grade III) based on TCGA RNA-seq dataset. (B) Comparison of FAM122B mRNA expression levels in LGG tissues with different WHO grades (grade II vs. grade III) based on CGGA RNA-seq dataset. (C) Comparison of FAM122B mRNA expression levels in LGG tissues with different WHO grades (grade II vs. grade III) based on CGGA microarray dataset. (D) Comparison of FAM122B mRNA expression levels between primary and recurrent LGG tissues in the TCGA RNA-seq dataset. (E) Comparison of FAM122B mRNA expression levels between primary and recurrent LGG tissues in the CGGA RNA-seq dataset. (F) Comparison of FAM122B mRNA expression levels between primary and recurrent LGG tissues in the CGGA microarray dataset. (G) Comparison of FAM122B mRNA expression levels in LGG tissues with different IDH mutation statuses based on TCGA RNA-seq dataset. (H) Comparison of FAM122B mRNA expression levels in LGG tissues with different IDH mutation statuses based on CGGA RNA-seq dataset. (I) Comparison of FAM122B mRNA expression levels in LGG tissues with different 1p19q co-deletion statuses based on the CGGA RNA-seq dataset. FAM122B, Family with sequence similarity 122, member B; LGG, low-grade glioma; WHO, World Health Organization; TCGA, The Cancer Genome Atlas; CGGA, Chinese Glioma Genome Atlas.

FAM122B is a potential prognostic marker for LGG

Survival time is one of the core direct indicators for evaluating the prognosis of patients with tumors. To clarify the direct correlation between FAM122B expression level and the prognosis of patients with LGG, the survival time and survival status information of all patients with LGG were extracted from the three aforementioned databases, the patients were divided into high-expression and low-expression groups according to the mRNA expression level of FAM122B, and survival prognosis analysis was conducted. First, KM survival curve analysis was performed. The results showed that in the three databases of TCGA-seq, CGGA-seq and CGGA microarray, with the extension of follow-up time, the survival rate of patients in the FAM122B high-expression group was consistently lower than that in the low-expression group (Fig. 3A-C), and the differences between the groups were statistically significant (all P<0.05). Subsequently, the predictive value of FAM122B for the survival outcomes of patients with LGG was evaluated by ROC curve analysis. The results showed that in the three databases, the AUC of FAM122B for predicting the 1-, 3- and 5-year survival outcomes of patients was stably ~0.7 (Fig. 3D-F), suggesting that the short-term and medium-term survival prognosis of patients with LGG can be moderately predicted based solely on the expression level of FAM122B. Combined with the previous results on the correlation between high FAM122B expression and malignant clinical phenotypes of LGG, the survival analysis in this section further confirms that FAM122B is expected to serve as a molecular marker for evaluating the prognosis of patients with LGG.

Prognostic value of FAM122B
expression level in patients with LGG. (A) Kaplan-Meier survival
curves of patients with LGG stratified by FAM122B expression
levels based on TCGA RNA-seq dataset. (B) Kaplan-Meier survival
curves of patients with LGG stratified by FAM122B expression
levels based on CGGA RNA-seq dataset. (C) Kaplan-Meier survival
curves of patients with LGG stratified by FAM122B expression
levels based on CGGA microarray dataset. (D) ROC curves and AUC
values of FAM122B for predicting 1-, 3- and 5-year survival
outcomes of patients with LGG based on the TCGA RNA-seq dataset.
(E) ROC curves and AUC values of FAM122B for predicting 1-,
3- and 5-year survival outcomes of patients with LGG based on the
CGGA RNA-seq dataset. (F) ROC curves and AUC values of
FAM122B for predicting 1-, 3- and 5-year survival outcomes
of patients with LGG based on the CGGA microarray dataset.
FAM122B, Family with sequence similarity 122, member B; LGG,
low-grade glioma; TCGA, The Cancer Genome Atlas; CGGA, Chinese
Glioma Genome Atlas; ROC, plot receiver operating characteristic;
AUC, area under the curve.

Figure 3.

Prognostic value of FAM122B expression level in patients with LGG. (A) Kaplan-Meier survival curves of patients with LGG stratified by FAM122B expression levels based on TCGA RNA-seq dataset. (B) Kaplan-Meier survival curves of patients with LGG stratified by FAM122B expression levels based on CGGA RNA-seq dataset. (C) Kaplan-Meier survival curves of patients with LGG stratified by FAM122B expression levels based on CGGA microarray dataset. (D) ROC curves and AUC values of FAM122B for predicting 1-, 3- and 5-year survival outcomes of patients with LGG based on the TCGA RNA-seq dataset. (E) ROC curves and AUC values of FAM122B for predicting 1-, 3- and 5-year survival outcomes of patients with LGG based on the CGGA RNA-seq dataset. (F) ROC curves and AUC values of FAM122B for predicting 1-, 3- and 5-year survival outcomes of patients with LGG based on the CGGA microarray dataset. FAM122B, Family with sequence similarity 122, member B; LGG, low-grade glioma; TCGA, The Cancer Genome Atlas; CGGA, Chinese Glioma Genome Atlas; ROC, plot receiver operating characteristic; AUC, area under the curve.

FAM122B is an independent poor prognostic factor for patients with LGG

Although the aforementioned ROC curve analysis clarified the predictive ability of FAM122B expression for the survival outcomes of patients with LGG, this analysis failed to exclude the potential confounding interference of clinical indicators such as age, pathological features and tumor stage, making it difficult to confirm its independent prognostic value. Therefore, the present study further adopted univariate and multivariate Cox proportional hazards regression models to clarify whether high FAM122B expression remains an independent risk factor for poor prognosis in patients with LGG after adjusting for the aforementioned confounding factors. Firstly, univariate Cox proportional hazards regression analysis was performed on samples from the three databases separately to rapidly screen for indicators with significant impacts on patient survival. The results showed that FAM122B expression level, age, WHO grade and tumor recurrence status were all significant factors affecting the prognosis of patients with LGG (all HR>1; P<0.05; Fig. 4A, C and E). Subsequently, these factors were incorporated into a multivariate Cox proportional hazards regression analysis to adjust for the mutual interference among the various indicators. The results showed that across all three databases, only high FAM122B expression and elevated WHO grade were independent prognostic factors for poor prognosis in patients with LGG (Fig. 4B, D and F). Finally, the results of the meta-analysis across multiple datasets (HR, 1.56; 95% CI, 1.17–2.08) also indicated that FAM122B is a risk factor for poor prognosis in patients with LGG (Fig. 4G). In conclusion, the independent prognostic value of FAM122B in LGG was clarified, which lays an important theoretical foundation for subsequent in-depth exploration of the molecular regulatory mechanisms of FAM122B, and also provides a potential target for LGG prognosis evaluation and targeted therapy.

Validation of FAM122B as an
independent poor prognostic factor in patients with LGG. (A) Forest
plots of univariate Cox proportional hazards regression analysis
based on TCGA RNA-seq dataset. (B) Forest plots of multivariate Cox
proportional hazards regression analysis based on the TCGA RNA-seq
dataset. (C) Forest plots of univariate Cox proportional hazards
regression analysis based on CGGA RNA-seq dataset. (D) Forest plots
of multivariate Cox proportional hazards regression analysis based
on the CGGA RNA-seq dataset. (E) Forest plots of univariate Cox
proportional hazards regression analysis based on CGGA microarray
dataset. (F) Forest plots of multivariate Cox proportional hazards
regression analysis based on the CGGA microarray dataset. (G)
Forest plot of meta-analysis across multiple datasets,
comprehensively evaluating the prognostic HR and 95% CI of
FAM122B in patients with LGG. FAM122B, Family with
sequence similarity 122, member B; LGG, low-grade glioma; TCGA, The
Cancer Genome Atlas; CGGA, Chinese Glioma Genome Atlas; HR, hazard
ratio; CI, confidence interval.

Figure 4.

Validation of FAM122B as an independent poor prognostic factor in patients with LGG. (A) Forest plots of univariate Cox proportional hazards regression analysis based on TCGA RNA-seq dataset. (B) Forest plots of multivariate Cox proportional hazards regression analysis based on the TCGA RNA-seq dataset. (C) Forest plots of univariate Cox proportional hazards regression analysis based on CGGA RNA-seq dataset. (D) Forest plots of multivariate Cox proportional hazards regression analysis based on the CGGA RNA-seq dataset. (E) Forest plots of univariate Cox proportional hazards regression analysis based on CGGA microarray dataset. (F) Forest plots of multivariate Cox proportional hazards regression analysis based on the CGGA microarray dataset. (G) Forest plot of meta-analysis across multiple datasets, comprehensively evaluating the prognostic HR and 95% CI of FAM122B in patients with LGG. FAM122B, Family with sequence similarity 122, member B; LGG, low-grade glioma; TCGA, The Cancer Genome Atlas; CGGA, Chinese Glioma Genome Atlas; HR, hazard ratio; CI, confidence interval.

Co-expression analysis and GSEA of FAM122B

The occurrence and development of tumors typically involve multi-gene synergistic regulatory networks (21). To further clarify the mechanism underlying the role of FAM122B in the pathological progression of LGG, the present study performed co-expressed gene screening and analysis of FAM122B based on TCGA database. The top five genes with the strongest positive correlation with FAM122B were identified as BRCC3, RPAP3, SLF1, MSH2 and PHTF1, while the top five genes with the strongest negative correlation were MSRB2, MRPS28, APOE, LAMTOR1 and PEA15 (Fig. 5A and B). Combined with information from the literature review, it was found that among the positively correlated genes, BRCC3, SLF1 and MSH2 have all been reported as oncogenes involved in tumorigenesis and progression (22–24). By contrast, LAMTOR1 and PEA15 are among the negatively correlated genes which have been confirmed to exert tumor-suppressive functions (25,26). The correlation between the aforementioned co-expression analysis results and genes with established functions further corroborates the potential oncogenic properties of FAM122B in LGG.

Co-expression gene analysis and GSEA
of FAM122B. (A) Chord diagram of FAM122B co-expressed
genes, where red indicates positive correlation and green indicates
negative correlation; color intensity reflects the magnitude of the
correlation coefficient. (B) The top five positively and top five
negatively correlated genes with FAM122B, along with their
correlation coefficients and P-values. (C) GSEA enrichment plots
showing the enrichment of extracellular matrix receptor interaction
pathway in FAM122B high-expression samples. (D) GSEA
enrichment plots showing the enrichment of Toll-like receptor
signaling pathway in FAM122B high-expression samples. (E)
GSEA enrichment plots showing the enrichment of focal adhesion
pathway in FAM122B high-expression samples. (F) Statistical
results of FDR q-values and P-values for each enriched pathway.
GSEA, gene set enrichment analysis; FAM122B, Family with
sequence similarity 122, member B; FDR, false discovery rate.

Figure 5.

Co-expression gene analysis and GSEA of FAM122B. (A) Chord diagram of FAM122B co-expressed genes, where red indicates positive correlation and green indicates negative correlation; color intensity reflects the magnitude of the correlation coefficient. (B) The top five positively and top five negatively correlated genes with FAM122B, along with their correlation coefficients and P-values. (C) GSEA enrichment plots showing the enrichment of extracellular matrix receptor interaction pathway in FAM122B high-expression samples. (D) GSEA enrichment plots showing the enrichment of Toll-like receptor signaling pathway in FAM122B high-expression samples. (E) GSEA enrichment plots showing the enrichment of focal adhesion pathway in FAM122B high-expression samples. (F) Statistical results of FDR q-values and P-values for each enriched pathway. GSEA, gene set enrichment analysis; FAM122B, Family with sequence similarity 122, member B; FDR, false discovery rate.

To clarify the specific molecular pathways through which FAM122B regulates the malignant progression of LGG, GSEA was performed. The results showed that the samples in the FAM122B high-expression group were markedly enriched in the extracellular matrix (ECM)-receptor interaction pathway, Toll-like receptor pathway and focal adhesion (Fig. 5C-E). Moreover, FDR <0.25 and P<0.05 was noted for all enriched pathways (Fig. 5F). Previous studies have confirmed that the aforementioned pathways are closely associated with tumor cell proliferation, invasion and metastasis, as well as the remodeling of the tumor immune microenvironment (27–29). Accordingly, it was suggested that FAM122B may regulate the activity of these key pathways either positively or negatively, thereby affecting the malignant biological behaviors of LGG, which provides an important direction for further elucidating its molecular regulatory mechanisms.

Regulatory effect of FAM122B high expression on the immune microenvironment of LGG

To elucidate the specific mechanism through which high FAM122B expression modulates the malignant biological behaviors of LGG, first, the ESTIMATE algorithm was employed to calculate the TME scores of patients with LGG stratified into high and low FAM122B expression groups. The results demonstrated that a statistically significant difference existed exclusively in the immune score between the two groups (Fig. 6A). This finding suggested that FAM122B may participate in the remodeling of the LGG immune microenvironment by regulating immune cell infiltration. Second, analysis of immune cell subset scatter plots revealed that the expression level of FAM122B may correlate with the infiltration levels of memory CD4+ T cells, M2-type macrophages, activated natural killer cells and monocytes (Fig. 6B). It was therefore hypothesized that FAM122B may reshape the immune microenvironment by regulating changes in the distribution of these immune cell subsets, thereby promoting the malignant progression of LGG. Subsequently, the correlation between FAM122B expression and immune cell infiltration was explored using the TIMER database. The results showed that only CD8+ T cells were positively correlated with FAM122B expression (Fig. S3A). Moreover, survival analysis indicated that high expression of both CD8+ T cells and FAM122B markedly shortened the overall survival of patients with LGG (Fig. S3B), suggesting that the two may synergistically affect patient prognosis. Immune checkpoints play a pivotal role in tumor immune escape and immunotherapy (30). Based on TCGA database, Spearman correlation analysis was performed to investigate the expression correlation between FAM122B and classical immune checkpoint molecules (CD274, CTLA4, HAVCR2, CD96, KLRB1 and IDO1). The results showed that FAM122B was positively correlated with most of these immune checkpoint molecules, among which the correlation coefficient with CD274 was the highest (Table SII). As the primary ligand for programmed cell death protein 1 (PD-1), CD274 can mediate tumor cells to escape immune system attacks (31). Collectively, these bioinformatics analyses suggest that FAM122B may regulate the progression of LGG via participating in the remodeling of tumor immune microenvironment, which indicates that it may serve as a promising candidate target for immunotherapy of LGG.

FAM122B affects LGG immune
microenvironment and malignant cell behaviors. (A) TME scores of
patients with LGG in FAM122B high- and low-expression
groups, calculated by the ESTIMATE algorithm. (B) Correlation
analysis between FAM122B expression level and infiltration
levels. (C) Colony formation assay to detect the proliferation
capacity of SHG44 and SW1088 cells after FAM122B knockdown.
(D) CCK-8 assay to detect the proliferation viability of SHG44 and
SW1088 cells after FAM122B knockdown. (E) Transwell assay to
detect the invasion capacity of SHG44 and SW1088 cells after
FAM122B knockdown. Scale bar, 100 µm. (F) Wound healing
assay to detect the migration capacity of SHG44 and SW1088 cells
after FAM122B knockdown. Scale bar, 100 µm. *P<0.05,
**P<0.01, ***P<0.001, ****P<0.0001. FAM122B, Family
with sequence similarity 122, member B; LGG, low-grade glioma; TME,
tumor microenvironment; ns, no significance; si, short interfering;
LGG, low-grade glioma.

Figure 6.

FAM122B affects LGG immune microenvironment and malignant cell behaviors. (A) TME scores of patients with LGG in FAM122B high- and low-expression groups, calculated by the ESTIMATE algorithm. (B) Correlation analysis between FAM122B expression level and infiltration levels. (C) Colony formation assay to detect the proliferation capacity of SHG44 and SW1088 cells after FAM122B knockdown. (D) CCK-8 assay to detect the proliferation viability of SHG44 and SW1088 cells after FAM122B knockdown. (E) Transwell assay to detect the invasion capacity of SHG44 and SW1088 cells after FAM122B knockdown. Scale bar, 100 µm. (F) Wound healing assay to detect the migration capacity of SHG44 and SW1088 cells after FAM122B knockdown. Scale bar, 100 µm. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. FAM122B, Family with sequence similarity 122, member B; LGG, low-grade glioma; TME, tumor microenvironment; ns, no significance; si, short interfering; LGG, low-grade glioma.

In vitro experimental verification of the biological effects of FAM122B on LGG cells

Following the aforementioned comprehensive analyses, it was found that FAM122B can affect multiple biological processes of glioma. However, bioinformatics analysis alone cannot completely avoid potential false-positive results. To ensure the rigor of the present research, in vitro cell experiments were performed to explore the effects of FAM122B expression on the proliferation and migration abilities of the LGG cell lines, SHG44 and SW1088. siRNA was used to specifically knockdown FAM122B expression in cell lines SHG44 and SW1088 (Fig. S3C). As shown in Fig. 6C, silencing FAM122B markedly inhibited the colony-forming ability of LGG cell lines SHG44 and SW1088. In addition, the CCK-8 assay results showed that knocking down FAM122B markedly reduced the cell proliferation rate, with the difference gradually widening over time (Fig. 6D). Furthermore, the Transwell migration assay demonstrated that silencing FAM122B markedly decreased the number of cells migrating through the chamber (Fig. 6E). Finally, the wound healing assay further confirmed that the relative healing rate in the siFAM122B group was markedly lower than that in the control group at 48 h (Fig. 6F). Collectively, these results suggest that silencing FAM122B markedly inhibits the proliferation and migration abilities of LGG cells, further corroborating the database analysis indicating that FAM122B functions as an oncogene.

Discussion

Glioma is the most common malignant tumor in the central nervous system (32). As an important subtype of glioma, LGG carries a lower degree of malignancy than GBM, yet it exhibits a high risk of malignant progression and recurrence (33), posing a notable threat to the lives, health and quality of life of patients. Exploring tumor-specific biomarkers and their regulatory mechanisms is the key to breaking through the therapeutic bottleneck of LGG. In the present study, the expression pattern, clinical importance and biological functions of FAM122B in LGG were systematically investigated through a combination of bioinformatics analysis and in vitro experiments.

The FAM122 is a group of highly conserved endogenous inhibitors of PP2A, whose members are involved in diverse physiological and pathological processes by regulating PP2A activity (9). As a core member of this family, the oncogenic role of FAM122A has been validated by numerous studies (10,11,34). FAM122A can regulate biological behaviors of tumor cells including proliferation, apoptosis and invasion in various malignant tumors such as acute myeloid leukemia and hepatocellular carcinoma by inhibiting PP2A activity (9), thus exerting a key oncogenic role. However, the biological function and regulatory mechanisms of FAM122B, another member of the FAM122 family, in tumors remain unclear, and its role in glioma in particular has not been systematically investigated.

In the present study, the expression characteristics of FAM122B in LGG were first clarified through multi-dimensional verification. Based on the GEO database and LGG cell lines, it was verified that the mRNA level of FAM122B was markedly upregulated. In addition, IHC data of cerebral cortex and LGG tissues from the HPA database demonstrated that FAM122B protein expression was also markedly increased, indicating that high expression of FAM122B in LGG is a consistent feature at both transcriptional and translational levels, laying a foundation for the subsequent investigation of its biological functions.

To clarify the correlation between high FAM122B expression and the clinical characteristics as well as prognosis of LGG, the present study integrated mRNA expression data and clinical information from three databases (TCGA-seq, CGGA-seq and CGGA microarray) for comprehensive analysis. The results revealed that FAM122B expression was closely associated with multiple clinical phenotypes of LGG. Specifically, the expression of FAM122B was markedly upregulated with the elevation of WHO grade and the expression level of FAM122B was higher in recurrent LGG than in primary LGG. At the level of key molecular markers, FAM122B expression was markedly decreased in patients with LGG with an IDH mutation and 1p19q chromosomal codeletion, both of which are well-recognized favorable prognostic indicators for LGG (35). Therefore, high expression of FAM122B is associated with a poor prognostic phenotype, preliminarily suggesting that it may be involved in driving the malignant progression of LGG.

The ability to serve as a tumor prognostic marker largely depends on its prognostic predictive power. In the present study, Kaplan-Meier survival analysis showed that patients with high FAM122B expression exhibited markedly shorter survival across three independent databases, confirming the negative correlation between FAM122B expression and patient prognosis. ROC curve analysis further demonstrated that FAM122B exhibited moderate predictive value for 1-, 3- and 5-year survival in patients with LGG. The AUC remained at ~0.7, suggesting that the expression level of FAM122B alone has fair predictive potential for the short- to medium-term prognosis of patients with LGG. However, univariate survival analysis alone cannot exclude the interference of confounding factors such as age, pathological grade and recurrence status. Therefore, the present study further performed univariate and multivariate Cox regression analyses. The results demonstrated that after adjusting for other clinical factors, high expression of FAM122B and elevated WHO grade were independent adverse risk factors for patients with LGG. Based on the aforementioned analyses, it was hypothesized that FAM122B may mediate the malignant biological behaviors of glioma.

In the present study, three independent datasets were analyzed separately rather than being merged and integrated, which effectively avoided the difficulty of normalization among multiple datasets. This approach not only maintained the independence of each analytical dataset, but also enabled mutual verification among the three datasets, fully demonstrating the reliability of the findings. On this basis, four additional datasets from different sources were further incorporated to perform a meta-analysis together with the original core data, thereby improving the reliability and general applicability of the research conclusions.

Although multiple independent datasets and analytical methods were included in the present study, and the corresponding results were well mutually validated, the overall analysis remains based on retrospective bioinformatic data. Retrospective research inevitably has inherent limitations and relevant biases cannot be completely avoided (36). Therefore, in vitro experiments were performed by selecting two LGG cell lines to explore the effects of FAM122B knockdown on the biological behaviors of tumor cells. The results showed that knocking down FAM122B markedly inhibited the proliferation and migration of both LGG cell lines, which further indicated that FAM122B is involved in regulating tumor malignant phenotypes and verified the reliability of the conclusions.

As overexpression experiments were not carried out in the present study, follow-up studies should add such experiments to further validate the functional role of FAM122B. Malignant tumor progression is a complex process involving the coordinated regulation of multiple genes and pathway disorders (37). To further explore the potential oncogenic role of FAM122B in LGG, the present study first performed co-expressed gene screening and analysis for FAM122B based on TCGA database. The results showed that the top five genes with the strongest positive correlation with FAM122B were BRCC3, RPAP3, SLF1, MSH2 and PHTF1. According to the literature review, several of these genes have been confirmed to possess distinct pro-tumor functions. Specifically, BRCC3 markedly promotes the proliferation, migration and invasion of cancer cells in various tumors, including bladder cancer (22), breast cancer (38), cervical cancer (39), pancreatic cancer (40) and colon cancer (41). In addition, as a mismatch repair protein, MSH2 plays a crucial role in the drug resistance mechanisms of multiple cancers such as bladder cancer (24) and lung cancer (42). Furthermore, serving as a predictive indicator, SLF1 can reflect the sensitivity of patients with colon cancer to oxaliplatin chemotherapy (23). By contrast, among the genes negatively correlated with FAM122B, deficiency of LAMTOR1 can markedly suppress the malignant progression of bladder cancer (43) and colon cancer (44). Finally, PEA15, another negatively correlated gene, inhibits the epithelial-mesenchymal transition process in triple-negative breast cancer and exerts a tumor-suppressive effect. The consistent association of FAM122B with these established oncogenic or tumor-suppressive genes further corroborates its oncogenic potential in LGG, suggesting that FAM122B may form a synergistic regulatory network with these genes to jointly drive the progression of LGG.

The present study adopted GSEA to explore the potential regulatory mechanisms of FAM122B in LGG. This method is particularly suitable for investigating gene functional mechanisms, as it does not rely on artificially set thresholds for screening differentially expressed genes and thus avoids missing key regulatory genes. Moreover, it can accurately identify signaling pathways enriched with FAM122B at the pathway level, thereby clarifying the core molecular pathways by which FAM122B regulates the occurrence and progression of LGG. The results revealed that FAM122B was markedly enriched in three cellular signaling pathways in LGG, including ECM-receptor interaction, Toll-like receptor signaling pathway and focal adhesion. Activation of these cellular signaling pathways plays a pivotal role in tumor progression and regulates malignant phenotypes through multiple pathways and molecular mechanisms (45–47).

In the present study, indirect exploration of the biological function of FAM122B was attempted via the aforementioned analytical strategies. Given that the three signaling pathways exert essential regulatory effects on the formation of the immunosuppressive tumor microenvironment, the role of FAM122B in the immune microenvironment of LGG was further investigated. The results showed that the enrichment of tumor immune cells was markedly higher in the FAM122B high-expression group, particularly for M2-type tumor-associated macrophages and CD4+ T cells. Meanwhile, high FAM122B expression was positively correlated with the levels of multiple immune checkpoint molecules.

Collectively, these findings suggest that FAM122B may be associated with the formation of the immunosuppressive microenvironment in LGG via the three aforementioned signaling pathways, which potentially contributes to the malignant progression of glioma. For example, glioma cells secrete abundant ECM components, such as collagen and fibronectin, which bind to surface receptors on macrophages (such as integrins, CD36 or CD44). This interaction activates downstream signaling pathways, recruiting monocytes to the tumor microenvironment and inducing their polarization into M2-type macrophages, which exhibit immunosuppressive and pro-angiogenic functions (48–50).

In glioma, abnormal activation of the Toll-like receptor signaling pathway can upregulate the expression of immune checkpoint molecules such as PD-L1, thereby enabling tumor cells to evade immune surveillance and elimination. Meanwhile, glioma further activates the TLR signaling cascade to enhance the PD-1/PD-L1 immune checkpoint pathway, which reduces the infiltration of CD4+ T cells and suppresses Th1-mediated cytotoxicity within the tumor microenvironment, ultimately maintaining an overall immunosuppressive state. Furthermore, targeted intervention of the Toll-like receptor signaling pathway can effectively regulate macrophage polarization and may help reverse resistance to immune checkpoint therapy (51).

Studies have indicated that the activation of CD4+ T cells is regulated by multiple factors during tumor progression (52–54). Alterations in the activity of the focal adhesion signaling pathway can modulate the function of CD4+ T cells within the tumor immune microenvironment, thereby affecting the malignant progression of tumors (52). Previous literature reports also provide indirect support for these analytical findings. The present study only preliminarily explored the biological regulatory role of FAM122B in the pathological progression of LGG, and its specific molecular mechanisms remain to be further verified by experiments.

The major strengths of the present study lie in the full utilization of data from multiple databases to conduct highly logical and scientifically rigorous analyses. A variety of analytical tools were adopted, enabling mutual verification among the research findings. Nevertheless, there are several shortcomings. The suggested roles of FAM122B in signaling pathways and the immune microenvironment are based on correlational bioinformatic analyses and were not directly validated through mechanistic experiments in the present study. The present study only provided correlational analytical outcomes rather than direct conclusive results. Further attention and in-depth improvement by subsequent researchers are required in this regard and the present work merely serves as a reference basis. The present study did not perform analyses on clinical tissue samples from patients, which constitutes a limitation of the present research. In addition, significant heterogeneity was observed in this meta-analysis. The data were collected from populations across different countries and ethnic groups and the inconsistent detection methods also contributed to heterogeneity, which may affect the reliability and interpretation of the pooled results.

In summary, the results of the present study suggest that FAM122B is relatively highly expressed in LGG and may act as a potential oncogene in LGG. The present study may partially fill the research gap related to the FAM122 family in LGG and help enrich the pathophysiological regulatory network of the FAM122 protein family. The present study provided preliminary evidence supporting a potential role of FAM122B in LGG and that further experimental and clinical studies are required to validate its clinical significance.

Acknowledgements

Not applicable.

Funding

The present study was supported by Henan Provincial Key Research and Development Program (grant no. 251111312600) and Henan Young and Middle-aged Health Science and Technology Innovation Talent Project (grant no. LJRC2023007).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

HW was responsible for data collection and manuscript drafting. YZ participated in data collection. TG and YG were responsible for data analysis. RQ participated in study conception and experimental design, critical revision of the manuscript, project review and supervision, and funding acquisition. HW and RQ confirm the authenticity of all the raw data. All authors have read and approved the final version of the manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Patel SH, Poisson LM, Brat DJ, Zhou Y, Cooper L, Snuderl M, Thomas C, Franceschi AM, Griffith B, Flanders AE, et al: T2-FLAIR mismatch, an imaging biomarker for IDH and 1p/19q status in lower-grade gliomas: A TCGA/TCIA project. Clin Cancer Res. 23:6078–6085. 2017. View Article : Google Scholar : PubMed/NCBI

2 

Louis DN, Perry A, Wesseling P, Brat DJ, Cree IA, Figarella-Branger D, Hawkins C, Ng HK, Pfister SM, Reifenberger G, et al: The 2021 WHO classification of tumors of the central nervous system: A summary. Neuro Oncol. 23:1231–1251. 2021. View Article : Google Scholar : PubMed/NCBI

3 

Jooma R, Waqas M and Khan I: Diffuse Low-grade glioma-changing concepts in diagnosis and management: A review. Asian J Neurosurg. 14:356–363. 2019. View Article : Google Scholar : PubMed/NCBI

4 

Nahed BV, Redjal N, Brat DJ, Chi AS, Oh K, Batchelor TT, Ryken TC, Kalkanis SN and Olson JJ: Management of patients with recurrence of diffuse low grade glioma: A systematic review and evidence-based clinical practice guideline. J Neurooncol. 125:609–630. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Fournier C, Mercey-Ressejac M, Derangère V, Al Kadi A, Rageot D, Charrat C, Leroy A, Vollaire J, Josserand V, Escudé M, et al: Nanostructured lipid carriers based mRNA vaccine leads to a T cell-inflamed tumour microenvironment favourable for improving PD-1/PD-L1 blocking therapy and long-term immunity in a cold tumour model. EBioMedicine. 112:1055432025. View Article : Google Scholar : PubMed/NCBI

6 

Sun X, Jia Q, Li K, Tian C, Yi L, Yan L, Zheng J, Jia X and Gu M: Comparative genomic landscape of lower-grade glioma and glioblastoma. PLoS One. 19:e03095362024. View Article : Google Scholar : PubMed/NCBI

7 

Yang YS, Liu MH, Yan ZW, Chen GQ and Huang Y: FAM122A is required for mesendodermal and cardiac differentiation of embryonic stem cells. Stem Cells. 41:354–367. 2023. View Article : Google Scholar : PubMed/NCBI

8 

Fan F, Zhao J, Liu Y, Zhao H, Weng L, Li Q, Chen G and Xu Y: Identifying the SUMO1 modification of FAM122A leading to the degradation of PP2A-Cα by ubiquitin-proteasome system. Biochem Biophys Res Commun. 500:676–681. 2018. View Article : Google Scholar : PubMed/NCBI

9 

Wasserman JS, Faezov B, Patel KR, Kurimchak AM, Palacio SM, Glass DJ, Fowle H, McEwan BC, Xu Q, Zhao Z, et al: FAM122A ensures cell cycle interphase progression and checkpoint control by inhibiting B55α/PP2A through helical motifs. Nat Commun. 15:57762024. View Article : Google Scholar : PubMed/NCBI

10 

Liu MH, Chen J, Yang YS, Wang YQ, Chen GQ, Zhang Y and Huang Y: FAM122A promotes acute myeloid leukemia cell growth through inhibiting PP2A activity and sustaining MYC expression. Haematologica. 106:903–907. 2021.PubMed/NCBI

11 

Zhou Y, Shi WY, He W, Yan ZW, Liu MH, Chen J, Yang YS, Wang YQ, Chen GQ and Huang Y: FAM122A supports the growth of hepatocellular carcinoma cells and its deletion enhances Doxorubicin-induced cytotoxicity. Exp Cell Res. 387:1117142020. View Article : Google Scholar : PubMed/NCBI

12 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Kawaguchi A, Yajima N, Tsuchiya N, Homma J, Sano M, Natsumeda M, Takahashi H, Fujii Y, Kakuma T and Yamanaka R: Gene expression signature-based prognostic risk score in patients with glioblastoma. Cancer Sci. 104:1205–1210. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Buczkowicz P, Hoeman C, Rakopoulos P, Pajovic S, Letourneau L, Dzamba M, Morrison A, Lewis P, Bouffet E, Bartels U, et al: Genomic analysis of diffuse intrinsic pontine gliomas identifies three molecular subgroups and recurrent activating ACVR1 mutations. Nat Genet. 46:451–456. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Yu X, Feng L, Liu D, Zhang L, Wu B, Jiang W, Han Z and Cheng S: Quantitative proteomics reveals the novel co-expression signatures in early brain development for prognosis of glioblastoma multiforme. Oncotarget. 7:14161–14171. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Feng L, Qian H, Yu X, Liu K, Xiao T, Zhang C, Kuang M, Cheng S, Li X, Wan J and Zhang K: Heterogeneity of tumor-infiltrating lymphocytes ascribed to local immune status rather than neoantigens by multi-omics analysis of glioblastoma multiforme. Sci Rep. 7:69682017. View Article : Google Scholar : PubMed/NCBI

17 

Park CK, Park I, Lee S, Sun CH, Koh Y, Park SH, Kim JE, Yun H and Lee SH: Genomic dynamics associated with malignant transformation in IDH1 mutated gliomas. Oncotarget. 6:43653–43666. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Björkblom B, Wibom C, Eriksson M, Bergenheim AT, Sjöberg RL, Jonsson P, Brännström T, Antti H, Sandström M and Melin B: Distinct metabolic hallmarks of WHO classified adult glioma subtypes. Neuro Oncol. 24:1454–1468. 2022. View Article : Google Scholar : PubMed/NCBI

19 

Chen W, Lei C, Liu P, Liu Y, Guo X, Kong Z and Wang Y, Dai C and Wang Y, Ma W and Wang Y: Progress and prospects of recurrent glioma: A recent scientometric analysis of the web of science in 2019. World Neurosurg. 134:e387–e399. 2020. View Article : Google Scholar : PubMed/NCBI

20 

Decuyper M, Bonte S, Deblaere K and Van Holen R: Automated MRI based pipeline for segmentation and prediction of grade, IDH mutation and 1p19q co-deletion in glioma. Comput Med Imaging Graph. 88:1018312021. View Article : Google Scholar : PubMed/NCBI

21 

Huang S, Ernberg I and Kauffman S: Cancer attractors: A systems view of tumors from a gene network dynamics and developmental perspective. Semin Cell Dev Biol. 20:869–876. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Tao H, Liao Y, Yan Y, He Z, Zhou J, Wang X, Peng J, Li S and Liu T: BRCC3 promotes tumorigenesis of bladder cancer by activating the NF-κB signaling pathway through targeting TRAF2. Front Cell Dev Biol. 9:7203492021. View Article : Google Scholar : PubMed/NCBI

23 

Han X, Wang Z, Zhang L, Shen Y, Tan Q, Sun Y, Wang J, Qian X, Yang H and Shi Y: SLF1 polymorphism predicts response to oxaliplatin-based adjuvant chemotherapy in patients with colon cancer. Am J Cancer Res. 11:1522–1539. 2021.PubMed/NCBI

24 

Zhang H, Xiao X, Wei W, Huang C, Wang M, Wang L, He Y, Sun J, Jiang Y, Jiang G and Zhang X: CircLIFR synergizes with MSH2 to attenuate chemoresistance via MutSα/ATM-p73 axis in bladder cancer. Mol Cancer. 20:702021. View Article : Google Scholar : PubMed/NCBI

25 

Wu B, Huang X, Shi X, Jiang M, Liu H and Zhao L: LAMTOR1 decreased exosomal PD-L1 to enhance immunotherapy efficacy in non-small cell lung cancer. Mol Cancer. 23:1842024. View Article : Google Scholar : PubMed/NCBI

26 

Mohammed HN, Pickard MR and Mourtada-Maarabouni M: The protein phosphatase 4-PEA15 axis regulates the survival of breast cancer cells. Cell Signal. 28:1389–1400. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Neophytou CM, Panagi M, Stylianopoulos T and Papageorgis P: The role of tumor microenvironment in cancer metastasis: Molecular mechanisms and therapeutic opportunities. Cancers. 13:20532021. View Article : Google Scholar : PubMed/NCBI

28 

Zhang P, Cao X, Guan M, Li D, Xiang H, Peng Q, Zhou Y, Weng C, Fang X, Liu X, et al: CPNE8 promotes gastric cancer metastasis by modulating focal adhesion pathway and tumor microenvironment. Int J Biol Sci. 18:4932–4949. 2022. View Article : Google Scholar : PubMed/NCBI

29 

Benencia F, Alaniz LD and McCall KD: Editorial: Toll-like receptor expression in transformed cells: Role in tumor development and cancer therapies. Front Immunol. 15:14784312024. View Article : Google Scholar : PubMed/NCBI

30 

Mortezaee K: Immune escape: A critical hallmark in solid tumors. Life Sci. 258:1181102020. View Article : Google Scholar : PubMed/NCBI

31 

Pardoll DM: The blockade of immune checkpoints in cancer immunotherapy. Nat Rev Cancer. 12:252–264. 2012. View Article : Google Scholar : PubMed/NCBI

32 

Ostrom QT, Price M, Neff C, Cioffi G, Waite KA, Kruchko C and Barnholtz-Sloan JS: CBTRUS statistical report: Primary brain and other central nervous system tumors diagnosed in the United States in 2015–2019. Neuro Oncol. 24 (Suppl 5):v1–v95. 2022. View Article : Google Scholar : PubMed/NCBI

33 

Nakasu S and Nakasu Y: Malignant progression of diffuse Low-grade Gliomas: A systematic review and Meta-analysis on incidence and related factors. Neurol Med Chir (Tokyo). 62:177–185. 2022. View Article : Google Scholar : PubMed/NCBI

34 

Wang YQ, Yang YS, Chen J, Liu MH, Chen GQ and Huang Y: FAM122A maintains DNA stability possibly through the regulation of topoisomerase IIα expression. Exp Cell Res. 396:1122422020. View Article : Google Scholar : PubMed/NCBI

35 

Familiari P, Lapolla P, Picotti V, Palmieri M, Pesce A, Carosi G, Relucenti M, Nottola S, Gianno F, Minasi S, et al: Role of 1p/19q codeletion in diffuse Low-grade glioma tumour prognosis. Anticancer Res. 43:2659–2670. 2023. View Article : Google Scholar : PubMed/NCBI

36 

Talari K and Goyal M: Retrospective studies-utility and caveats. J R Coll Physicians Edinb. 50:398–402. 2020. View Article : Google Scholar : PubMed/NCBI

37 

Charmpi K, Guo T, Zhong Q, Wagner U, Sun R, Toussaint NC, Fritz CE, Yuan C, Chen H, Rupp NJ, et al: Convergent network effects along the axis of gene expression during prostate cancer progression. Genome Biol. 21:3022020. View Article : Google Scholar : PubMed/NCBI

38 

Huang Q, Zheng S, Gu H, Yang Z, Lu Y, Yu X and Guo G: The deubiquitinase BRCC3 increases the stability of ZEB1 and promotes the proliferation and metastasis of triple-negative breast cancer cells. Acta Biochim Biophys Sin (Shanghai). 56:564–575. 2024.PubMed/NCBI

39 

Zhang F and Zhou Q: Knockdown of BRCC3 exerts an anti-tumor effect on cervical cancer in vitro. Mol Med Rep. 18:4886–4894. 2018.PubMed/NCBI

40 

Hu X, Wu J and Xu J: UCA1 executes an oncogenic role in pancreatic cancer by regulating miR-582-5p/BRCC3. Front Oncol. 13:11332002023. View Article : Google Scholar : PubMed/NCBI

41 

Feng X, He S, Chen Y and Zhang L: Deubiquitinase BRCC3 promotes the migration, invasion and EMT progression of colon adenocarcinoma by stabilizing MET expression. Genes Genomics. 46:637–646. 2024. View Article : Google Scholar : PubMed/NCBI

42 

Ko JC, Chiu HC, Wo TY, Huang YJ, Tseng SC, Huang YC, Chen HJ, Syu JJ, Chen CY, Jian YT, et al: Inhibition of p38 MAPK-dependent MutS homologue-2 (MSH2) expression by metformin enhances gefitinib-induced cytotoxicity in human squamous lung cancer cells. Lung Cancer. 82:397–406. 2013. View Article : Google Scholar : PubMed/NCBI

43 

Sun Y, Guan Z, Sheng Q, Duan W, Zhao H, Zhou J, Deng Q and Pei X: N-myristoyltransferase-1 deficiency blocks myristoylation of LAMTOR1 and inhibits bladder cancer progression. Cancer Lett. 529:126–138. 2022. View Article : Google Scholar : PubMed/NCBI

44 

Zhao L, Gao N, Peng X, Chen L, Meng T, Jiang C, Jin J, Zhang J, Duan Q, Tian H, et al: TRAF4-mediated LAMTOR1 ubiquitination promotes mTORC1 activation and inhibits the inflammation-induced colorectal cancer progression. Adv Sci (Weinh). 11:e23011642024. View Article : Google Scholar : PubMed/NCBI

45 

Kidd LC, Rogers EN, Yeyeodu ST, Jones DZ and Kimbro KS: Contribution of toll-like receptor signaling pathways to breast tumorigenesis and treatment. Br Cancer (Dove Med Press). 5:43–51. 2013.PubMed/NCBI

46 

Liu Z, Zhang X, Ben T, Li M, Jin Y, Wang T and Song Y: Focal adhesion in the tumour metastasis: From molecular mechanisms to therapeutic targets. Biomark Res. 13:382025. View Article : Google Scholar : PubMed/NCBI

47 

Lu P, Weaver VM and Werb Z: The extracellular matrix: A dynamic niche in cancer progression. J Cell Biol. 196:395–406. 2012. View Article : Google Scholar : PubMed/NCBI

48 

Cui X, Morales RT, Qian W, Wang H, Gagner JP, Dolgalev I, Placantonakis D, Zagzag D, Cimmino L, Snuderl M, et al: Hacking macrophage-associated immunosuppression for regulating glioblastoma angiogenesis. Biomaterials. 161:164–178. 2018. View Article : Google Scholar : PubMed/NCBI

49 

Xiong J, Xiao R, Zhao J, Zhao Q, Luo M, Li F, Zhang W and Wu M: Matrix stiffness affects tumor-associated macrophage functional polarization and its potential in tumor therapy. J Transl Med. 22:852024. View Article : Google Scholar : PubMed/NCBI

50 

Ellert-Miklaszewska A, Poleszak K, Pasierbinska M and Kaminska B: Integrin signaling in glioma pathogenesis: From biology to therapy. Int J Mol Sci. 21:8882020. View Article : Google Scholar : PubMed/NCBI

51 

Norollahi SE, Babaei K, Rashidy-Pour A, Yousefi B, Baharlou R, Far BF, Jalali A and Samadani AA: Role of the TLR signaling pathway in the pathogenesis of glioblastoma multiforme with an emphasis on immunotherapy. Biochem Biophys Rep. 43:1021492025.PubMed/NCBI

52 

Wiemer AJ, Wernimont SA, Cung TD, Bennin DA, Beggs HE and Huttenlocher A: The focal adhesion kinase inhibitor PF-562,271 impairs primary CD4+ T cell activation. Biochem Pharmacol. 86:770–781. 2013. View Article : Google Scholar : PubMed/NCBI

53 

Guo M, Liu MYR and Brooks DG: Regulation and impact of tumor-specific CD4(+) T cells in cancer and immunotherapy. Trends Immunol. 45:303–313. 2024. View Article : Google Scholar : PubMed/NCBI

54 

Accogli T, Bruchard M and Végran F: Modulation of CD4 T cell response according to tumor cytokine microenvironment. Cancers. 13:3732021. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ma J, Xiang C and Xia D: Colorectal cancer and tumor vaccines (Review). Oncol Lett 32: 472, 2026.
APA
Ma, J., Xiang, C., & Xia, D. (2026). Colorectal cancer and tumor vaccines (Review). Oncology Letters, 32, 472. https://doi.org/10.3892/ol.2026.15827
MLA
Ma, J., Xiang, C., Xia, D."Colorectal cancer and tumor vaccines (Review)". Oncology Letters 32.4 (2026): 472.
Chicago
Ma, J., Xiang, C., Xia, D."Colorectal cancer and tumor vaccines (Review)". Oncology Letters 32, no. 4 (2026): 472. https://doi.org/10.3892/ol.2026.15827
Copy and paste a formatted citation
x
Spandidos Publications style
Ma J, Xiang C and Xia D: Colorectal cancer and tumor vaccines (Review). Oncol Lett 32: 472, 2026.
APA
Ma, J., Xiang, C., & Xia, D. (2026). Colorectal cancer and tumor vaccines (Review). Oncology Letters, 32, 472. https://doi.org/10.3892/ol.2026.15827
MLA
Ma, J., Xiang, C., Xia, D."Colorectal cancer and tumor vaccines (Review)". Oncology Letters 32.4 (2026): 472.
Chicago
Ma, J., Xiang, C., Xia, D."Colorectal cancer and tumor vaccines (Review)". Oncology Letters 32, no. 4 (2026): 472. https://doi.org/10.3892/ol.2026.15827
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team