Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
January-February 2010 Volume 1 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-February 2010 Volume 1 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Renal carcinoid tumor: An immunohistochemical and molecular genetic study of four cases

  • Authors:
    • Naoto Kuroda
    • Isabel Alvarado-Cabrero
    • Radek Sima
    • Ondrej Hes
    • Michal Michal
    • Hidefumi Kinoshita
    • Tadashi Matsuda
    • Chisato Ohe
    • Noriko Sakaida
    • Yoshiko Uemura
    • Gang-Hong Lee
  • View Affiliations / Copyright

    Affiliations: Department of Diagnostic Pathology, Kochi Red Cross Hospital, Kochi 780-8562, Japan. kurochankochi@yahoo.co.jp
  • Pages: 87-90
    |
    Published online on: January 1, 2010
       https://doi.org/10.3892/ol_00000015
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Few genetic studies of renal carcinoid tumor have been conducted thus far. We performed immunohistochemical and genetic examinations on four renal carcinoid tumors. Histologically, the tumors consisted of neoplastic cells with round to oval nuclei. Various growth patterns such as tightly packed cords and trabeculae, ribbon-like, trabecular, sheet-like or solid growth were observed. Nuclear chromatin showed a coarse and granular pattern. Immunohistochemically, tumors were positive for chromogranin A and synaptophysin. In the fluorescence in situ hybridization study, three of four tumors revealed monosomy of chromosome 3 (D3Z1), but one tumor showed monosomy of chromosome 13 (D13S319/13q34). Using PCR amplification and fragment analysis of three microsatellite markers (D3S1300, D3S666 and D3S1768) of chromosome arm 3p, one tumor showed loss of heterozygosity at D3S1300 and D3S1768, one tumor was not informative and the analysis of two tumors failed due to low DNA quality. In three cases, the VHL gene status was tested. Two tumors showed wild-type, but the analysis of one tumor failed to provide adequate results. In conclusion, we suggest that the abnormality of chromosome 3 is involved in the pathogenesis of renal carcinoid tumor.

Introduction

Primary renal carcinoid tumor arising from renal parenchyma or renal pelvis is a rare neoplasm, and approximately 80 cases with such a tumor have been reported thus far (1–12). However, few studies report on the genetic characteristics of primary renal carcinoid tumor. Previously, a case of primary renal carcinoid tumor sharing common molecular abnormality with clear cell renal cell carcinoma (RCC) was reported (5). Additionally, the numerical and structural abnormality of chromosome 13 was described in primary renal carcinoid tumor associated with horseshoe kidney (6). This study investigated the status of chromosomes 3 and 13 in four primary renal carcinoid tumors using fluorescence in situ hybridization (FISH), loss of heterozygosity (LOH) of 3p and VHL gene analysis and discussed the pathogenesis.

Materials and methods

Archive materials

Among pathology files exceeding 14,000 renal tumors originating from Kochi Red Cross Hospital, Japan; Mexico Medical Center, Mexico; Charles University Hospital Plzen, Czech Republic and Kansai Medical University Hirakata Hospital, Japan, four cases with renal carcinoid tumor arising from the renal pelvis (case 1, Tables I and II) or renal parenchyma (cases 2–4, Tables I and II) were selected for the present study. Patient age ranged from 32 to 55 years, and the gender ratio of male to female was 1:3. One patient was previously described (12).

Table I

Immunohistochemical results.

Table I

Immunohistochemical results.

Case 1Case 2Case 3Case 4
Chromogranin Af, +f, +d, +d, +
Synaptophysinf, +f, +d, +d, +
CD56−f, +d, +−

[i] d, diffuse; f, focal.

Table II

Results of fluorescence in situ hybridization, 3p LOH and VHL gene mutation analyses.

Table II

Results of fluorescence in situ hybridization, 3p LOH and VHL gene mutation analyses.

Chromosome 3Chromosome 13D3S1300D3S666D3S1768VHL gene mutation
Case 1MonosomyMonosomy
 Total cells507599
 One signal261 (51.5%)403 (67.3%)FailedFailedFailedFailed
 Two signals226 (44.6%)196 (32.7%)
 Three signals20 (3.9%)0 (0%)
Case 2MonosomyDisomy
 Total cells518512
 One signal404 (78.0%)85 (16.6%)NegativeNegativeNegativeNot performed
 Two signals112 (21.6%)417 (81.4%)
 Three signals2 (0.2%)10 (2.0%)
Case 3MonosomyDisomy
 Total cells617541
 One signal577 (93.5%)29 (5.4%)LOHNegativeLOHWild-type
 Two signals37 (6.0%)492 (90.9%)
 Three signals3 (9.5%)20 (3.7%)
Case 4DisomyDisomy
 Total cells366334
 One signal43 (11.7%)27 (8.1%)FailedFailedFailedWild-type
 Two signals317 (86.6%)303 (90.7%)
 Three signals6 (1.6%)4 (1.2%)

[i] Failure was due to low DNA quality. LOH, loss of heterozygosity.

Histological examination and immunohistochemistry

Renal tumor tissues obtained from nephrectomy were fixed in 10% formalin and embedded in paraffin. Sections (3-μm thick) were stained with H&E. Additionally, immunohistochemical staining was performed using a Histofine Simple Stain-PO (Multi) kit (Nichirei, Tokyo, Japan). Antibodies against chromogranin A (polyclonal; DakoCytomation, Glostrup, Denmark), synaptophysin (polyclonal; DakoCytomation) and CD56 (N-CAM) (123C3, 1:40; Zymed Laboratories, San Francisco, CA, USA) were employed in the present study. Specimens of normal pancreas were used as positive controls of the above described antibodies.

Fluorescence in situ hybridization (FISH)

FISH was performed using probes detecting chromosome 3 (D3Z1) and chromosome 13 (D13S319/13q34). FISH was carried out in the Cytogenetic Testing Group, Molecular Genetic Testing Department, Clinical Testing Center, Mitsubishi Chemical Medience Corporation, Kyoto, Japan. In each case, >300 neoplastic cells were counted, and the percentages of one, two and three signals per cell were calculated. The cut-off value for monosomy was judged as >20%.

Analyses of 3p LOH and VHL gene mutation

These analyses were performed in the Department of Pathology, Charles University Hospital Plzen, Czech Republic. Several sections (10-μm thick) were cut from each formalin-fixed, paraffin-embedded block. The tumorous component was microdissected. DNA was extracted by the NucleoSpin Tissue Kit (Macherey Nagel, Duren, Germany) according to the manufacturer’s protocol. Polymerase chain reaction (PCR) for LOH analysis of chromosome 3p was performed. Short tandem repeat markers and primers were as follows: D3S1300 F, AGCTCACATTCTAGTCAGCCT and R, GCCAATTCCCC AGATG; D3S666 F, CAAGGCATTAAAGTGGCCACGC and R, GTTTGAACCAGTTTCCTACTGAG; D3S1768 F, GGT TGCTGCCAAAGATTAGA and R, CACTGCATTTGCTGT TGGA. Normal tissues of the same patients were used as a reference. Reaction conditions were as follows: 12.5 μl of HotStart Taq PCR Master Mix (Qiagen, Hilden, Germany), 10 pmol of each primer, 100 ng of template DNA, and distilled water up to 25 μl. The amplification program for the fragments consisted of denaturation at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min. The program was completed by incubation at 72°C for 7 min. The annealing temperature for fragment D3S666 was 58°C. Additionally, analysis of three coding exons and exon-intron junctions of the VHL gene was performed by PCR and direct sequencing according to the previously described method (13).

Results

Microscopic findings

The tumors consisted of neoplastic cells with round to oval nuclei. Various growth patterns such as tightly packed cords and trabeculae, ribbon-like, trabecular (Fig. 1A), sheet-like or solid growth were observed. The cell border was generally indistinct. Nuclear chromatin exhibited a coarse and granular pattern (Fig. 1B). Necrosis or abnormal mitotic figures were absent.

Figure 1

Histological findings of carcinoid tumor. (A) Cuboidal neoplastic cells proliferate in a trabecular pattern. (B) Round nuclei exhibit a coarse granular chromatin pattern, and the cytoplasm shows a eosinophilic staining pattern.

Immunohistochemical findings

Immunohistochemical results are summarized in Table I. Four neoplastic cells were positive for chromogranin A and synaptophysin. The positivity for chromogranin A and synaptophysin in two tumors (cases 3 and 4) was diffuse, and that of the remaining two tumors (cases 1 and 2) was focal. Neoplastic cells were positive for CD56 in two tumors. The positivity of one tumor (case 3) was diffuse, while that of the other (case 2) was focal.

FISH findings

The results of the FISH analysis are summarized in Table II. Tumorous cells of cases 1, 2 and 3 exhibited monosomy of chromosome 3 (Fig. 2), but one tumor (case 4) showed disomy of chromosome 3. In case 1, neoplastic cells demonstrated a monosomy of chromosome 13, but tumorous cells in cases 2, 3 and 4 showed a disomy of chromosome 13.

Figure 2

Results of fluorescence in situ hybridization (FISH). Many neoplastic cells exhibit monosomy of chromosome 3.

Findings of 3p LOH and VHL gene mutation analyses

The results are summarized in Table II. Regarding 3p LOH, one tumor showed LOH at two (D3S1300 and D3S1768) of three loci tested. One tumor was not informative, and two tumors failed to provide better results due to low DNA quality. Concerning VHL gene analysis, two tumors showed wild-type and one tumor failed due to low DNA quality. In one case, VHL gene analysis was not performed (Fig. 3).

Figure 3

Results of 3p loss of heterozygosity (LOH) analysis. Arrow indicates loss of one allele in tumor DNA in comparison with control (non-neoplastic) DNA, using microsatellite markers D3S1300 and D3S1768.

Discussion

Primary renal carcinoid tumor is a rare neoplasm, and approximately 80 cases with such a tumor have been previously reported. This tumor frequently occurs in patients <50 years of age, affects male and female patients with equal frequency and does not appear to present with carcinoid syndrome (11). It is well known that primary renal carcinoid tumor is associated with other renal diseases including horseshoe kidney (17.8%), teratoma (14.3%) or polycystic kidney disease (1.8%) (6–10). However, no tumors in the present study were associated with any other renal diseases. Poor patient prognostic factors include an age >40 years, tumor size >4 cm, a purely solid tumor on the cut surface, a mitotic rate >1/10 high power fields, metastases at initial diagnosis and tumors extending into the extrarenal tissue (9). Patients with this tumor often present with regional lymph node metastases which may progress to distant organ metastases, but usually pursue a prolonged clinical course despite widely metastastic disease (11). Accordingly, it is very important for surgical pathologists to accurately recognize and diagnose renal carcinoid tumors due to their peculiar clinical behavior.

Genetic studies of renal carcinoid tumor are currently limited (5,6). In the present study, three of four tumors (75%) demonstrated monosomy of chromosome 3 by FISH analysis. Therefore, we suggest that the numerical loss of chromosome 3 plays a crucial role in the pathogenesis of primary renal carcinoid tumor. Previous cytogenetic studies of carcinoid tumor of the respiratory area failed to show any abnormalities of chromosome 3 (14,15). Therefore, it is possible that renal carcinoid tumor is genetically different from respiratory carcinoid tumor. On the other hand, primary renal carcinoid tumor showing the abnormality of chromosome 3, characteristic of clear cell RCC, was previously reported (5). In pulmonary carcinoid tumor, Hurr et al (16) failed to detect any 3p deletion, and some investigators detected allelic loss at a limited loci of small number (17,18). From the results of the present study, we can infer that LOH of chromosome 3p is involved in the pathogenesis of certain cases of renal carcinoid tumors. A large scale study is necessary to clarify the frequency and significance of 3p LOH in renal carcinoid tumor. However, it is unlikely that the VHL gene is associated with the pathogenesis of renal carcinoid tumor. This suggests that renal carcinoid tumors do not differentiate from clear cell RCC or that both tumors do not originate from common stem cells. Additionally, only one of the four tumors (25%) showed monosomy of chromosome 13 by FISH analysis. The abnormality of chromosome 13 by G-band karyotype has been reported in gastric carcinoid tumor (19). Although Van den Berg et al (6) detected the numerical and structural abnormality of chromosome 13 by a G-band karyotype, a numerical abnormality of chromosome 13 in renal carcinoid tumor appears to occasionally occur on the basis of our results. The rate (25%) of abnormality of chromosome 13 in renal carcinoid tumor using FISH analysis appears to be comparable with the rate (17%) of abnormality of chromosome 13 in carcinoid tumor of various anatomic sites using genome-wide single nucleotide polymorphism analysis (20).

In conclusion, the abnormality of chromosome 3 may be involved in the pathogenesis of some cases of renal carcinoid tumor.

Acknowledgements

The authors are grateful to the Cytogenetic Testing Group, Molecular Genetic Testing Department, Clinical Testing Center, Mitsubishi Chemical Medience Corporation, Kyoto, Japan for their technical assistance.

References

1 

Toker C: Carcinoidal renal tumor. J Urol. 111:10–11. 1974.

2 

Stahl RE and Sidhu GS: Primary carcinoid tumor of the kidney. Light and electron microscopic study. Cancer. 44:1345–1349. 1974. View Article : Google Scholar

3 

Ji X and Li W: Primary carcinoid of renal pelvis. J Environ Pathol Toxicol Oncol. 13:269–271. 1994.

4 

Rudrick B, Nguyen GK and Lakey WH: Carcinoid tumor of the renal pelvis: report of a case with positive urine cytology. Diagn Cytopathol. 12:360–363. 1995. View Article : Google Scholar : PubMed/NCBI

5 

El-Naggar AK, Troncoso P and Ordonez NG: Primary renal carcinoid tumor with molecular abnormality characteristic of conventional renal cell neoplasms. Diagn Mol Pathol. 4:48–53. 1995. View Article : Google Scholar

6 

Van den Berg E, Gouw A, Oosterhuis JW, Störkel S, Dijkhuizen T, Mensink HJ and de Jong B: Carcinoid in a horseshoe kidney. Morphology, immunohistochemistry and cytogenetics. Cancer Genet Cytogenet. 84:95–98. 1995.PubMed/NCBI

7 

Krishnan B, Truong LD, Saleh G, Sirbasku M and Slawin KM: Horseshoe kidney is associated with an increased relative risk of primary carcinoid tumor. J Urol. 157:2059–2066. 1997. View Article : Google Scholar : PubMed/NCBI

8 

Yoo J, Park S, Lee HJ, Kang SJ and Kim BK: Primary carcinoid tumor arising in a mature teratoma of the kidney. A case report and review of the literature. Arch Pathol Lab Med. 126:979–981. 2002.PubMed/NCBI

9 

Romero FR, Rais-Bahrami S, Permpongkosol S, Fine SW, Kohanim S and Jarrett TW: Primary carcinoid tumor of the kidney. J Urol. 176:2359–2366. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Murali R, Kneale K, Lalak N and Delprado W: Carcinoid tumors of the urinary tract and prostate. Arch Pathol Lab Med. 130:1693–1706. 2006.PubMed/NCBI

11 

Hansel DE, Epstein JI, Berbescu E, Fine SW, Young RH and Cheville JC: Renal carcinoid tumor: a clinicopathologic study of 21 cases. Am J Surg Pathol. 31:1539–1544. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Kuroda N, Tamura M, Hes O, Michal M, Hayashi Y and Lee GH: Carcinoid tumor of renal pelvis: consideration on the histogenesis. Pathol Int. 58:51–54. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Michal M, Hes O, Nemcova J, Sima R, Kuroda N, Bulimbasic S, Franco M, Sakaida N, Danis D, Kazakov DV, Ohe C and Hora M: Renal angiomyoadenomatous tumor: morphologic, immunohistochemical and molecular genetic study of a distinct entity. Virchows Arch. 454:89–99. 2009. View Article : Google Scholar

14 

Teyssier JR, Sadrin R, Nou JM, Bureau G, Adnet JJ, Bajolle F and Pigeon F: Trisomy 7 in a lung carcinoid tumor. Precocious index of malignant transformation? Cancer Genet Cytogenet. 15:277–282. 1985. View Article : Google Scholar : PubMed/NCBI

15 

Johansson M, Hein S, Mandahl N, Hambraeus G, Johansson L and Mitelman F: Cytogenetic analysis of six bronchial carcinoids. Cancer Genet Cytogenet. 66:33–38. 1993. View Article : Google Scholar : PubMed/NCBI

16 

Hurr K, Kemp B, Silver SA and El-Naggar AK: Microsattelite alteration at chromosome 3p loci in neuroendocrine and non-neuroendocrine lung tumors. Am J Pathol. 149:613–620. 1996.PubMed/NCBI

17 

Kovatich A, Friedland DM, Druck T, Hadaczek P, Huebner K, Comis RL, Hauck W and McCue PA: Molecular alterations to human chromosome 3p loci in neuroendocrine lung tumors. Cancer. 83:1109–1117. 1998. View Article : Google Scholar : PubMed/NCBI

18 

Onuki N, Wistuba II, Travis W, Virmani AK, Yashima K, Brambilla E, Hasleton P and Gazdar AF: Genetic changes in the spectrum of neuroendocrine lung tumors. Cancer. 85:600–607. 1999. View Article : Google Scholar : PubMed/NCBI

19 

Panani AD, Malliaros S, Ferti A and Raptis S: Cytogenetic study of a malignant carcinoid tumor. Cancer Genet Cytogenet. 59:2201992. View Article : Google Scholar : PubMed/NCBI

20 

Kim DH, Nagano Y, Choi IS, White JA, Yao JC and Rashid A: Allelic alterations in well-differentiated neuroendocrine tumors (carcinoid tumors) identified by genome-wide single nucleotide polymorphism analysis and comparison with pancreatic endocrine tumors. Genes Chromosomes Cancer. 47:84–92. 2008. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kuroda N, Alvarado-Cabrero I, Sima R, Hes O, Michal M, Kinoshita H, Matsuda T, Ohe C, Sakaida N, Uemura Y, Uemura Y, et al: Renal carcinoid tumor: An immunohistochemical and molecular genetic study of four cases . Oncol Lett 1: 87-90, 2010.
APA
Kuroda, N., Alvarado-Cabrero, I., Sima, R., Hes, O., Michal, M., Kinoshita, H. ... Lee, G. (2010). Renal carcinoid tumor: An immunohistochemical and molecular genetic study of four cases . Oncology Letters, 1, 87-90. https://doi.org/10.3892/ol_00000015
MLA
Kuroda, N., Alvarado-Cabrero, I., Sima, R., Hes, O., Michal, M., Kinoshita, H., Matsuda, T., Ohe, C., Sakaida, N., Uemura, Y., Lee, G."Renal carcinoid tumor: An immunohistochemical and molecular genetic study of four cases ". Oncology Letters 1.1 (2010): 87-90.
Chicago
Kuroda, N., Alvarado-Cabrero, I., Sima, R., Hes, O., Michal, M., Kinoshita, H., Matsuda, T., Ohe, C., Sakaida, N., Uemura, Y., Lee, G."Renal carcinoid tumor: An immunohistochemical and molecular genetic study of four cases ". Oncology Letters 1, no. 1 (2010): 87-90. https://doi.org/10.3892/ol_00000015
Copy and paste a formatted citation
x
Spandidos Publications style
Kuroda N, Alvarado-Cabrero I, Sima R, Hes O, Michal M, Kinoshita H, Matsuda T, Ohe C, Sakaida N, Uemura Y, Uemura Y, et al: Renal carcinoid tumor: An immunohistochemical and molecular genetic study of four cases . Oncol Lett 1: 87-90, 2010.
APA
Kuroda, N., Alvarado-Cabrero, I., Sima, R., Hes, O., Michal, M., Kinoshita, H. ... Lee, G. (2010). Renal carcinoid tumor: An immunohistochemical and molecular genetic study of four cases . Oncology Letters, 1, 87-90. https://doi.org/10.3892/ol_00000015
MLA
Kuroda, N., Alvarado-Cabrero, I., Sima, R., Hes, O., Michal, M., Kinoshita, H., Matsuda, T., Ohe, C., Sakaida, N., Uemura, Y., Lee, G."Renal carcinoid tumor: An immunohistochemical and molecular genetic study of four cases ". Oncology Letters 1.1 (2010): 87-90.
Chicago
Kuroda, N., Alvarado-Cabrero, I., Sima, R., Hes, O., Michal, M., Kinoshita, H., Matsuda, T., Ohe, C., Sakaida, N., Uemura, Y., Lee, G."Renal carcinoid tumor: An immunohistochemical and molecular genetic study of four cases ". Oncology Letters 1, no. 1 (2010): 87-90. https://doi.org/10.3892/ol_00000015
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team