Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
April 2012 Volume 27 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April 2012 Volume 27 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

microRNA-1301-mediated inhibition of tumorigenesis

  • Authors:
    • Lin Fang
    • Ning Yang
    • Jie Ma
    • Yong Fu
    • Guang-Shun Yang
  • View Affiliations / Copyright

    Affiliations: Fifth Department of Liver Surgery, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, Shanghai 200438, P.R. China, Fifth Department of Liver Surgery, Eastern Hepatobiliary Surgery Hospital, Second Military Medical University, 225 Chang Hai Road, Shanghai 200438, P.R. China
    Copyright: © Fang et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].
  • Pages: 929-934
    |
    Published online on: December 12, 2011
       https://doi.org/10.3892/or.2011.1589
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The relatively recent discovery of microRNAs has added a completely new dimension to the study of the regulation of tumor cells, but how they control cell behavior remains largely elusive. HepG2 cells were assigned to the miR-1301 group and the control group. RT-PCR, Western blotting, wound healing, the Transwell chamber migration and MTT assays, and apoptosis detection assays were used to analyze cell behavior of HepG2 cells after miR-1301 mimic transfection. Our study showed that miR-1301 was downregulated in HepG2 cells, and that miR-1301 inhibited migration and invasion of HepG2 cells and promoted cellular apoptosis after transfection with miR-1301 mimics. In addition, p53 mRNA and p53 protein expression was upregulated, and Bcl-2 and Bcl-xL mRNA and protein expression was downregulated in the miR-1301 group. These results indicate that miR-1301 may be an inhibitor of tumorigenesis in HepG2 cells.

Introduction

microRNAs (miRNAs) are a class of approximately 20–25 nucleotide-non-coding RNAs that can regulate post-transcriptional gene expression. These miRNAs may degrade the target mRNAs or the translational repression of encoded proteins by partially binding to complementary target sites in messenger RNA (mRNA) 3′ untranslated regions (UTRs) (1).

Bioinformatic analyses have estimated that miRNAs may regulate as many as 30% of the human protein coding genes (2). In general, one gene can be repressed by multiple miRNAs, and one miRNA may repress multiple target genes. Using miRNA target prediction algorithms, hundreds of potential target mRNAs for a specific miRNA can be identified. miRNA target binding sites have been predicted to be present in almost any transcript. Many miRNAs are expressed in a tissue-specific manner and play pivotal roles in the control of proliferation and differentiation of different cell types (3–5).

Many miRNAs have been shown to be downregulated or upregulated in different tumors. miRNA expression profiles have been reported to undergo changes in papillary thyroid cancer (6), breast cancer (7), lung cancer (8), hepatocellular carcinoma (9), pancreatic adenocarcinoma (10) and colorectal cancer (11). In addition, deregulation of miRNAs may lead to oncogenesis and cancer progression. Studies have shown that miRNAs affect the expression of genes and pathways involved in cancer pathogenesis from initiation to metastatic disease (12,13). miRNAs are also involved in important homeostatic processes such as cellular proliferation and cell apoptosis (14,15).

In our previous study, we found that miR-1301 expression was lower in the HepG2 cell line than in the Qsg7701 cell line which is a normal liver cell line. In this study, we compared mRNA transcription, cell proliferation, migration ability, invasion ability and apoptosis rate in the HepG2 cell line before and after transfection with miR-1301 mimics to understand the role of miR-1301 in the control of HepG2 cell apoptosis.

Materials and methods

Cell line, culture and transfection

The human cell line HepG2 (Cell Bank of Chinese Academy of Sciences, Shanghai, China) were assigned to miR-1301 group and control group. The cells were maintained in monolayer cultures in high glucose Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/v) fetal bovine serum (FBS) and 1% (v/v) penicillin at 37°C in a humidified atmosphere of 5% CO2 in air.

Cells at the log phase were harvested and a cell suspension of 3.0×104 cells/ml was prepared in 96-well tissue culture plates. miR-1301 mimics (GenePharma Co., Ltd., Shanghai, China) were introduced into cells by the procedure according to the manufacturer’s instructions. miR-1301 mimics were mixed with Lipofectamine transfection reagent (GenePharma Co., Ltd.), incubated for 10 min, and diluted to a concentration of 50 nmol before transfection. The transfected cells were incubated for 24 and 48 h before harvest, and the samples were assayed. All transfections were carried out in triplicate. The primers for miR-1301 mimics were forward, UUGCAGCUGCCUGGGAGUGACUUC and reverse, AGUCACUCCCAGGCAGCUGCAAUU; negative control forward, UUCUCCGAACGUGUCACGUTT and reverse, ACGUGACACGUUCGGAGAATT.

Reverse transcription-polymerase chain reaction (RT-PCR) analysis

Total RNA was extracted from human HepG2 cell lines using TRIzol reagent (Takara Biotechnology Co., Ltd.). Reverse transcription was performed using 1 μg of total RNA as a template and random hexamer as a primer. cDNA was amplified by PCR using specific paired primers. Expression of p65, β-catenin, p53, Tg737, Bcl-2, Bcl-xL, caspase-3, and caspase-8 in the cell line was detected by TaqMan stem-loop RT-PCR. TaqMan probes were used to quantify the levels of miRNA. All PCR reactions were run in triplicate.

Western blotting

Cellular lysates were prepared as previously described (16). Total cell extracts were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. After saturation overnight in phosphate-buffered saline (PBS) containing 10% (w/v) skim milk with constant shaking, the nitrocellulose membrane was cut into strips and individually incubated with 1 ml of human serum diluted 1:500 in PBS/10% (w/v) skim milk at 37°C for 2 h. Each strip was washed three times with PBS/0.1% (v/v) Tween-20 and incubated with peroxidase-conjugated anti-human IgG (diluted 1:2000) for 2 h at room temperature. After washing, the reaction was developed with 0.5 mg/ml diaminobenzidine in PBS. The reaction was terminated with water. Positive and negative control sera were included in each experiment.

Wound healing assay

For in vitro scratch assays, HepG2 cells were seeded and grown in 6-well plates at a density of 3×104 cells/well in growth medium until they reached a confluence of ~80%. A scratch was made through each well using a sterile pipette tip, and cells were monitored under the microscope (magnification, ×150) for 0, 12, 24 and 48 h after wounding at 37°C in 5% CO2. Images of cells were captured at the same position before and after incubation to document the repair process. The experiments were repeated twice and representative pictures are shown.

Transwell chamber migration assay

The Transwell migration assay was performed in a 24-well Transwell chamber system. The filter was washed with the same medium and placed between the lower and the upper chambers. HepG2 cells were trypsinized, resuspended in DMEM with 15% (v/v) FBS and transferred to the upper chambers. The chambers were incubated at 37°C in 5% CO2. After 48 h, the filter was removed. Cells were stained with eosin and then with thiazide dye. The upper surface of the filter containing non-migrating cells was cleared using a wet cotton swab. Five fields of each well were randomly gated and counted.

MTT assay

The MTT assay was performed in HepG2 cells that were seeded and grown in 6-well plates at a density of 5×104 cells/well. Cells were grown in growth medium until they reached a confluence of ~60%. miR-1301 mimics were diluted to concentrations of 10, 20, 40, 60, 80 and 100 nmol for transfection. The transfected cells were incubated in 96-well microculture plates at 37°C and maintained in humidified air with 5% CO2. After 24-, 48- and 72-h of transfection, MTT was added to all wells. The optical density (OD) of each well was measured with a microplate spectrophotometer at 490 nm. The inhibitor rate (IR) of HepG2 cell proliferation was calculated by the equation: IR = (1-ODtreated well/mean ODcontrol well) × 100%.

Effect of miR-1301 transfection on HepG2 cell apoptosis

After removing the medium, HepG2 cells were washed with PBS. The reaction product was prepared according to the manufacturer’s instructions (Trevigen, Inc., Gaithersburg, MD, USA) and added. Cells were viewed under a fluorescence microscope through a dual pass filter allowing to visualize the Annexin-V-FITC positive and the propidium iodide positive cells in the same field according to the manufacturer’s instructions (Trevigen, Inc.).

Statistical analysis

All data are presented as the mean ± SD. Statistical significance was calculated using the unpaired Student’s t-test. Significance was accepted at P≤0.05. All analyses were performed using SPSS version 13.0 (SPSS Inc., Chicago, IL, USA).

Results

miR-1301 regulates p53, Bcl-2 and Bcl-xL gene expression

In this study, we found that p53 gene expression was upregulated in the miR-1301 group, and that Bcl-2 gene and Bcl-xL gene expression was downregulated when compared with the untransfected control group (Table I). Western blot analysis showed that levels of p53 protein increased, while levels of the Bcl-2 and Bcl-xL proteins decreased in the miR-1301 group (Fig. 1), indicating that miR-1301 may regulate HepG2 cell proliferation/apoptosis through apoptotic gene expression or tumor suppressor gene expression. There were no significant differences in p65, β-catenin, Tg737, caspase-3 and caspase-8 expression levels between the miR-1301 group and the control group.

Figure 1

Protein expressions of p53, Bcl-2 and Bcl-xL after miR-1301 transfection. Western blotting shows that p53, Bcl-2 and Bcl-xL protein levels were altered. p53 protein expression increased in miR-1301 group, and Bcl-2 and Bcl-xL protein expression decreased in the miR-1301 group. Expression of β-actin was used as a control. Lane A, control group; lane B, miR-1301 group; lane C, Qsg7701 cells (normal liver cell line).

Table I

ΔCt values of expression genes between the miR-1301 and the control groups.

Table I

ΔCt values of expression genes between the miR-1301 and the control groups.

GroupmiR-1301p65β-cateninp53Tg737Bcl-2Bcl-xLCaspase-3Caspase-8
miR-1301−1.25±0.32a5.26±0.264.60±0.305.05±0.14a3.27±3.693.54±0.40a−1.17±0.30a3.35±0.524.26±0.46
Control3.62±0.115.10±0.203.94±0.265.95±0.050.82±0.230.98±0.11−3.70±0.232.75±0.254.68±0.02
t-value−21.1410.8293.508−16.0431.94511.22720.2212.651−1.482

a P<0.05 vs. the control group.

miR-1301 inhibits the migration and invasion ability of HepG2 cells

The scratch test is a useful method to investigate wound healing ability. Our results showed that the capacity for proliferation and migration of HepG2 cells into the wounded area was reduced in the miR-1301 group after a 24 and 48 h repair period (Fig. 2). There was no difference between the miR-1301 group and the control group at 12 h. The results of the transwell migration assay showed that the number of migration cells in the miR-1301 group was less than that in the control group. This indicated that the invasion ability of HepG2 cells might be inhibited by miR-1301 (Figs. 3 and 4).

Figure 2

miR-1301 inhibits the migration of HepG2 cells in a scratch test. The scratch test was used to investigate the wound healing ability at 0, 12, 24 and 48 h. We observed that the proliferation and migration ability of HepG2 cells in the wounded area was reduced in the miR-1301 group after a 24 and 48 h repair period when compared with the control group. There was no difference between the miR-1301 transfected and the control group at 12 h.

Figure 3

miR-1301 inhibits the invasion of HepG2 cells in the Transwell chamber assay. Cell invasion ability was analyzed by the Transwell chamber assay 48 h after miR-1301 transfection. The results showed that the number of migration cells in the miR-1301 group was less than that in control group. This indicated that the invasion ability of HepG2 cells might be inhibited by miR-1301.

Figure 4

The number of migration cells in transwell chamber assay. The results showed that the number of migration cells in transwell chamber assay 48 h after miR-1301 transfection was less than that in control group (P<0.05). *P<0.05 compared with the control group.

miR-1301 inhibits cell proliferation

The MTT assay was performed to monitor the proliferation rate of HepG2 cells after transfection with varying concentrations of miR-1301 (10, 20, 40, 60, 80 and 100 nmol). The optical density of each well was measured with a microplate spectrophotometer at 490 nm at 24 h (Fig. 5A), 48 h (Fig. 5B), and 72 h (Fig. 5C) after transfection. Compared with the control group, the optical density of the miR-1301 group decreased at 24, 48 and 72 h. The proliferation rate of HepG2 cells was dependent on the concentration and time of transfection, with higher concentrations of miR-1301 and longer transfection times inhibiting cell proliferation (Fig. 5D).

Figure 5

miR-1301 inhibits cell proliferation. The MTT assay was performed to monitor the proliferation rate of HepG2 cells after miR-1301 transfection. The optical density of each well was measured with a microplate spectrophotometer at 490 nm. The optical density of the miR-1301 group decreased at 24 h (A), 48 h (B), and 72 h (C) after transfection. The proliferation rate of cells decreased with increasing concentrations of inhibitor and increasing transfection time (D).

miR-1301 promotes cell apoptosis

HepG2 cell apoptosis was observed under a fluorescence microscopy. The results showed that HepG2 cell apoptosis increased in the miR-1301 group 48 h after transfection with miR-1301 mimics when compared with the control group (Fig. 6).

Figure 6

miR-1301 promotes cell apoptosis. Apoptosis of HepG2 cells was observed using fluorescence microscopy through a dual pass filter allowing to visualize the Annexin-V-FITC positive and the propidium iodide positive cells in the same field. The results showed that apoptosis of HepG2 cells increased 48 h after transfection of miR-1301 mimics in the miR-1301 group (Aa) when compared with the control group (Ba). (Aa) Apoptosis cells of the Annexin-V-FITC positive cells in the miR-1301 group; (Ab) cells excited by normal light in the miR-1301 group; (Ba) apoptosis cells of the Annexin-V-FITC positive cells in the control group; (Bb) cells excited by normal light in the control group.

Discussion

In this study, we found that miR-1301 expression was low in HepG2 cells. In addition, cells transfected with miR-1301 exhibited an upregulation of p53 gene expression, a downregulation of Bcl-2 and Bcl-xL gene expression, and increased apoptotic cell death. Moreover, miR-1301 reduced the cell migratory and invasive function of HepG2 cells. We therefore speculate that miR-1301 may be a tumor inhibitor.

The function of miRNAs has attracted much attention and research interest. Recent studies have shown that some miRNAs may behave as oncomiRs or tumor suppressors (17–19). These differing expressions of miRNAs could lead to different human cancers. miRNAs that are downregulated in cancers are usually termed tumor suppressors, while miRNAs that are upregulated in cancers are classified as oncogenes.

In this study, miR-1301 inhibits the proliferation of HepG2 cells. A number of miRNAs involved in regulating proliferation and growth have been identified through linkage with cancer phenotypes (20,21). Let-7 is known to control the timing of proliferation and differentiation in C. elegans (22). Let-7 has also been shown to repress Ras and c-Myc expression. Akao and colleagues (23) reported that Let-7 was greatly reduced in lung cancer and may facilitate high levels of Ras expression, and hence may act as a potent growth suppressor and tumor suppressor in normal cells. miR-372 and miR-373 have been shown to interfere with p53 function. They can also act as a promoter of tumors, and as oncogenes in testicular germ cell tumors (24). miR-125a has been shown to act as a regulator of the p53 gene, and may be add to the growing list of miRNA with oncogenic targets (25). The results of our study show that miR-1301 can inhibit the proliferation of HepG2 cells. The p53 gene was upregulated after transfection with miR-1301 mimics. We presume that miR-1301 may also interfere with p53 function, hence affecting cell proliferation. We also found that miR-1301 interfered with the migration and invasion ability of HepG2 cells, but the reason for this action remains unclear.

In this study, miR-1301 promoted apoptosis in HepG2 cells, and miRNAs have been shown to induce tumor apoptosis (26). Cimmino and colleagues (27) found that miR-15 and miR-16 could induce apoptosis by targeting Bcl-2 mRNA. Other studies (28,29) showed that there was a correlation between the expression of Bcl-2 and an absence of miR-15 and miR-16, which is important in the regulation of apoptosis in chronic lymphocytic leukemia. The Let-7 family of microRNAs inhibits Bcl-xL expression and potentially induces apoptosis in human hepatocellular carcinoma (30). Bcl-2 and Bcl-xL are anti-apoptotic proteins, which oppose the progression of apoptosis. These proteins inhibit apoptosis through the maintenance of mitochondrial membrane integrity and by binding to pro-apoptotic Bcl family members (31). Our study showed that miR-1301 promotes apoptosis, and that Bcl-2 and Bcl-xL genes were downregulated by miR-1301 at the same time. In our study, Bcl-2 and Bcl-xL gene expression were inhibited by miR-1301. We therefore conclude that miR-1301 may affect cell apoptosis through Bcl-2 and Bcl-xL.

Although we observed that miR-1301 could affect the proliferation and invasion ability and promote apoptosis in HepG2 cells, the true reason for this function remains unclear. First, it is unclear which genes are controlled by miR-1301 and how these genes are regulated. In addition, the mechanisms of cellular apoptosis and invasion remain unclear. Finally, our study was only performed in HepG2 cells, and we did not perform experiments to find target genes of miR-1301, which we are currently investigating.

In conclusion, our study indicates that miR-1301 reduces cellular proliferation, migration and invasion, and promotes cell apoptosis. We speculate that miR-1301 may be a tumor inhibitor. Further studies are needed to find target genes of miR-1301 and mechanisms of cellular apoptosis that are regulated by miR-1301, with the aim of preventing and treating tumors with related miRNAs.

Acknowledgements

This study was partly supported by grants from the National Natural Science Foundation of China (NSFC) (30940034).

References

1 

Baetel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Lewis BP, Burge CB and Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 120:15–20. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Dar AA, Majid S, de Semir D, Nosrati M, Bezrookove V and Kashani-Sabet M: miRNA-205 suppresses melanoma cell proliferation and induces senescence via regulation of E2F1 protein. J Biol Chem. 286:16606–16614. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Osaki M, Takeshita F, Sugimoto Y, Kosaka N, Yamamoto Y, Yoshioka Y, Kobayashi E, Yamada T, Kawai A, Inoue T, et al: MicroRNA-143 regulates human osteosarcoma metastasis by regulating matrix metalloprotease-13 expression. Mol Ther. 19:1123–1130. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Leucht C, Stigloher C, Wizenmann A, Klafke R, Folchert A and Bally-Cuif L: MicroRNA-9 directs late organizer activity of the midbrain-hindbrain boundary. Nat Neurosci. 11:641–648. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Mazeh H, Mizrahi I, Halle D, Ilyayev N, Stojadinovic A, Trink B, Mitrani-Rosenbaum S, Roistacher M, Ariel I, Eid A, et al: Development of a microRNA-based molecular assay for the detection of papillary thyroid carcinoma in aspiration biopsy samples. Thyroid. 21:111–118. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Dedes KJ, Natrajan R, Lambros MB, Geyer FC, Lopez-Garcia MA, Savage K, Jones RL and Reis-Filho JS: Down-regulation of the miRNA master regulators Drosha and Dicer is associated with specific subgroups of breast cancer. Eur J Cancer. 47:138–150. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Wang XC, Du LQ, Tian LL, Wu HL, Jiang XY, Zhang H, Li DG, Wang YY, Wu HY, She Y, et al: Expression and function of miRNA in postoperative radiotherapy sensitive and resistant patients of non-small cell lung cancer. Lung Cancer. 72:92–99. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Murakami Y, Yasuda T, Saigo K, Urashima T, Toyoda H, Okanoue T and Shimotohno K: Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 25:2537–2545. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, Liu CG, Bhatt D, Taccioli C and Croce CM: MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. JAMA. 297:1901–1908. 2007. View Article : Google Scholar

11 

Schetter A, Leung SY, Sohn JJ, Zanetti KA, Bowman ED, Yanaihara N, Yuen ST, Chan TL, Kwong DL, Au GK, et al: MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. JAMA. 299:425–436. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Ma L, Teruya-Feldstein J and Weinberg RA: Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Nature. 449:682–688. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Zhu S, Wu H, Wu F, Nie D, Sheng S and Mo YY: MicroRNA-21 targets tumor suppressor genes in invasion and metastasis. Cell Res. 18:350–359. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Cheng AM, Byrom MW, Shelton J and Ford LP: Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic Acids Res. 33:1290–1297. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Lima RT, Busacca S, Almeida GM, Gaudino G, Fennell DA and Vasconcelos MH: MicroRNA regulation of core apoptosis pathways in cancer. Eur J Cancer. 47:163–174. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Lai TH, Fong YC, Fu WM, Yang RS and Tang CH: Osteoblasts derived BMP-2 enhances the motility of prostate cancer cells via activation of integrins. Prostate. 68:1341–1353. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Pallante P, Visone R, Ferracin M, Ferraro A, Berlingieri MT, Troncone G, Chiappetta G, Liu CG, Santoro M, Negrini M, et al: MicroRNA deregulation in human thyroid papillary carcinomas. Endocr Rel Cancer. 13:497–508. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio M, Roldo C, Ferracin M, et al: A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA. 103:2257–2261. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Noguchi S, Mori T, Hoshino Y, Maruo K, Yamada N, Kitade Y, Naoe T and Akao Y: MicroRNA-143 functions as a tumor suppressor in human bladder cancer T24 cells. Cancer Lett. 307:211–220. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Esquela-Kerscher A and Slack FJ: Oncomirs-microRNAs with a role in cancer. Nat Rev Cancer. 6:259–269. 2006. View Article : Google Scholar

21 

Liu WH, Yeh SH, Lu CC, Yu SL, Chen HY, Lin CY, Chen DS and Chen PJ: MicroRNA-18a prevents estrogen receptor-α expression, promoting proliferation of hepatocellular carcinoma cells. Gastroenterology. 136:683–693. 2009.PubMed/NCBI

22 

Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda MI, Maller B, Hayward DC, Ball EE, Degnan B, Muller P, et al: Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408:86–89. 2000. View Article : Google Scholar : PubMed/NCBI

23 

Akao Y, Nakagawa Y and Naoe T: let-7 microRNA functions as a potential growth suppressor in human colon cancer cells. Biol Pharm Bull. 29:903–906. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Voorhoeve PM, le Sage C, Schrier M, Gillis AJ, Stoop H, Nagel R, Liu YP, van Duijse J, Drost J, Griekspoor A, et al: A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell. 124:1169–1181. 2006. View Article : Google Scholar

25 

YZ, Gao JS, Tang XL, Tucker LD, Quesenberry P, Rigoutsos I and Ramratnam B: MicroRNA 125a and its regulation of the p53 tumor suppressor gene. FEBS Lett. 583:3725–3730. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Babashah S and Soleimani M: The oncogenic and tumour suppressive roles of microRNAs in cancer and apoptosis. Eur J Cancer. 47:1127–1137. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, Wojcik SE, Aqeilan RI, Zupo S, Dono M, Rassenti L, Alder H, et al: MiR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci USA. 102:13944–13949. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, et al: Frequent deletions and down-regulation of micro-RNA genes mir15 and mir16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci USA. 99:15524–15529. 2002. View Article : Google Scholar : PubMed/NCBI

29 

Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD, Shimizu M, Cimmino A, Zupo S, Dono M, et al: MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci USA. 101:11755–11760. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Shimizu S, Takehara T, Hikita H, Kodama T, Miyagi T, Hosui A, Tatsumi T, Ishida H, Noda T, Nagano H, et al: The let-7 family of microRNAs inhibits Bcl-xL expression and potentiates sorafenib-induced apoptosis in human hepatocellular carcinoma. J Hepatol. 52:698–704. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Sun XM, Bratton SB, Butterworth M, Macfarlane M and Cohen GM: Bcl-2 and Bcl-xl inhibit CD95- mediated apoptosis by preventing mitochondrial release of Smac/DIABLO and subsequent inactivation of X-linked inhibitor-of-apoptosis protein. J Biol Chem. 277:11345–11351. 2002. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Fang L, Yang N, Ma J, Fu Y and Yang G: microRNA-1301-mediated inhibition of tumorigenesis. Oncol Rep 27: 929-934, 2012.
APA
Fang, L., Yang, N., Ma, J., Fu, Y., & Yang, G. (2012). microRNA-1301-mediated inhibition of tumorigenesis. Oncology Reports, 27, 929-934. https://doi.org/10.3892/or.2011.1589
MLA
Fang, L., Yang, N., Ma, J., Fu, Y., Yang, G."microRNA-1301-mediated inhibition of tumorigenesis". Oncology Reports 27.4 (2012): 929-934.
Chicago
Fang, L., Yang, N., Ma, J., Fu, Y., Yang, G."microRNA-1301-mediated inhibition of tumorigenesis". Oncology Reports 27, no. 4 (2012): 929-934. https://doi.org/10.3892/or.2011.1589
Copy and paste a formatted citation
x
Spandidos Publications style
Fang L, Yang N, Ma J, Fu Y and Yang G: microRNA-1301-mediated inhibition of tumorigenesis. Oncol Rep 27: 929-934, 2012.
APA
Fang, L., Yang, N., Ma, J., Fu, Y., & Yang, G. (2012). microRNA-1301-mediated inhibition of tumorigenesis. Oncology Reports, 27, 929-934. https://doi.org/10.3892/or.2011.1589
MLA
Fang, L., Yang, N., Ma, J., Fu, Y., Yang, G."microRNA-1301-mediated inhibition of tumorigenesis". Oncology Reports 27.4 (2012): 929-934.
Chicago
Fang, L., Yang, N., Ma, J., Fu, Y., Yang, G."microRNA-1301-mediated inhibition of tumorigenesis". Oncology Reports 27, no. 4 (2012): 929-934. https://doi.org/10.3892/or.2011.1589
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team