Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
November 2012 Volume 28 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November 2012 Volume 28 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Direct serum and tissue assay for EGFR mutation in non-small cell lung cancer by high-resolution melting analysis

  • Authors:
    • Chengjin Hu
    • Xiaolei Liu
    • Yingjian Chen
    • Xiaoming Sun
    • Yanwen Gong
    • Ming Geng
    • Liquan Bi
  • View Affiliations / Copyright

    Affiliations: Department of Laboratory Medicine, General Hospital of Jinan Military Command, Jinan, Shandong 250031, P.R. China, Department of Pathology, General Hospital of Jinan Military Command, Jinan, Shandong 250031, P.R. China
  • Pages: 1815-1821
    |
    Published online on: August 23, 2012
       https://doi.org/10.3892/or.2012.1987
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Biological therapy with epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) have noted promising outcomes for patients with non-small cell lung carcinoma (NSCLC), especially those with mutated EGFR. Tissue EGFR gene mutation testing can predict the benefit of taking a first-line EGFR-TKI, thus, allowing the physician to prescribe the most suitable therapy. Unfortunately, most lung cancer patients, especially NSCLC patients present with advanced disease that is surgically unresectable. The goal of this study was to develop high-resolution melting (HRM) assays to detect EGFR mutations in exons 18 to 21, compare their sensitivity and concordance to direct sequencing, and evaluate the feasibility and reliability of serum as a tissue alternate for routine EGFR mutation screening. EGFR mutations of 126 Formalin-Fixed Paraffin-Embedded (FFPE), 47 fresh frozen tissues and from 47 matched pre-operation serum specimens of NSCLC patients were screened by the HRM assays. EGFR mutations by HRM were confirmed through sequencing. We found 78 EGFR mutations in 70 FFPE tissues, 25 EGFR mutations in 24 fresh frozen tissues, with a mutation rate of 55.56% (70/126) and 51.06% (24/47), respectively. Most mutations were correctly identified by sequencing. EGFR mutations were detected in 22 serum samples from 24 tissue EGFR mutation-positive patients. The concordance rate between serum and tissue in EGFR mutation screening was 91.67%. We conclude that the HRM assay can provide convincing and valuable results both for serum and tissues samples, thus, it is suitable for routine serum EGFR mutation screening for NSCLC patients, especially those surgically unresectable.

Introduction

Lung cancer is the leading cause of cancer-related death in worldwide, and accounts for one third of all deaths (1). Current treatment of lung cancer is still based on traditional surgery. Unfortunately, most lung cancer patients, especially non-small cell lung cancer (NSCLC) patients present advanced disease that is surgically unresectable. It is current practice to treat these patients with a combination of chemotherapy and external beam irradiation. But treatment outcomes for NSCLC remain unsatisfactory, with low long-term survival rates (<15%). Emerging TARGETED therapy with epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) are currently being evaluated in NSCLC.

EGFR is a receptor tyrosine kinase (TK) which is widely distributed in mammalian epithelial cells, glial cells, fibroblasts, keratinocytes and other cell surface. EGFR family includes four structurally-related tyrosine kinase receptors: EGFR (ErbB-1), HER2/c-neu (ErbB-2), Her3 (ErbB-4). These receptors are related to 70% of cancer (2). Abnormal activation of EGFR can promote tumor cell proliferation, differentiation, migration. EGFR has been found to be overexpressed in a variety of human malignancies (2,3). Activation of EGFR results in the initiation of a diverse range of cellular signaling pathways, including cell proliferation and protection of the cell from apoptosis (4). In 2004, Lynch et al (5) and Paez et al (6) proposed the EGFR gene mutations in lung cancer can be predicted, which is considered a milestone for NSCLC individualized targeted molecular therapies. These mutations are located in EGFR exons 18–21 (7) and ~90% of the sensitizing mutations are in-frame deletions in exon19, and the point mutation L858R in exon 21 (8). These mutations cluster around the ATP binding pocket of the tyrosine kinase domain of EGFR, leading to ligand-independent activation of the receptor and prolonged activation time compared to wild-type EGFR. Although exon 20 mutations were less, it is associated with resistance to anti-EGFR therapies (9–11).

The treatment of NSCLC using EGFR-TKIs, such as gefitinib and erlotinib was confirmed, showing promising outcomes for some patients with NSCLC, especially those with mutated EGFR (5,6,12). EGFR mutations increase sensitivity to TK inhibitors, most likely through induction of critical structural modifications of the ATP-binding site in the TK domain (13). EGFR mutation testing may be prognostically important to guide identify potential responders (or non-responders) to therapy. Therefore, a rapid, sensitive and reliable method for EGFR mutations testing is required.

The classic method for detecting EGFR mutations is direct sequencing. However, sequencing for routine testing is impeded by relatively high cost, requirement of sophisticated equipment and technical expertise, which are often only available in specialized molecular pathology laboratories (14). HRM is a recently developed technique that shows great potential for somatic mutations (15), but rarely uses serum samples. In 1989, studies have shown that the DNA in the plasma of cancer patients had tumor characteristics (16). In 1994, Sorenson et al and Vasioukhin et al detected the same gene mutation in tumor and plasma, this discovery confirmed that a part of free DNA from tumor existed in plasma (17,18). However, the clinical development of EGFR mutation detection was impeded by the low sensitivity of conventional methods, because the tumor DNA levels in peripheral blood is extremely low. In this study, we aimed to establish a sensitive and reliable HRM method for routine EGFR mutation screening using serum, which will benefit many NSCLC patients, especially those surgically unresectable.

Materials and methods

Samples

A total of 126 FFPE specimens (71 adenocarcinomas, 53 squamous cell carcinomas, one large cell carcinoma, and one adenosquamous carcinoma) between December 2008 and September 2010, 47 fresh frozen surgically resected tumor tissues (28 adenocarcinomas, 19 squamous cell carcinomas) between October 2010 and June 2011 were obtained from tumor tissue bank of Department of Pathology at Jinan General Hospital of PLA. All tissues were finally diagnosed as NSCLC by Pathology. We also successfully collected 47 matched pre-operation serum specimens for the 47 NSCLC patients between October 2010 and June 2011.

DNA extraction

The paraffin rolls were cut from each block (5 sections of 5-μm thickness) for DNA extraction. About 300 mg fresh frozen tissue was used for DNA extraction. QIAamp DNA FFPE tissue kit (Qiagen) and QIAamp DNA mini kit (Qiagen) was used to extract FFPE and fresh frozen tissue DNA, respectively. DNA was extracted from 200 μl serum using QIAamp DNA blood mini kit (Qiagen). All DNA solutions were quantitated with the Lambda Bio Spectrophotometer system (PerkinElmer Company, USA), adjusted to the same concentration of 30 ng/μl, and then stored at −20°C until use.

Design of HRM primers

Primers specific for EGFR exons 18 to 21 were designed using Primer Designer Software (primer premier 5.0). Primers that flanked the exons as closely as possible were chosen. All primers were analyzed for specificity and to ensure similar melting temperatures using Primer-BLAST software. The sequences of primers for the EGFR exon 18 to 21 were listed in Table I. All amplicons were less than 250 bp and covered the most common EGFR mutations.

Table I

HRM primer sequences.

Table I

HRM primer sequences.

ExonPrimerT (°C)G/C (%)Amplicon size (bp)
18F: CTGAGGTGACCCTTGTCTCTGTGTTC66.6353.85183
R: AGGCCTGTGCCAGGGACCTTA67.3661.90
19F: GCATGTGGCACCATCTCACAA64.4252.38204
R: CCTGAGGTTCAGAGCCATGGA64.8857.14
20F: CATTCATGCGTCTTCACCTG60.3050.00228
R: TCTTTGTGTTCCCGGACATAG60.0047.60
21F: GCAGAGCTTCTTCCCATGATGA63.9850.00236
R: GCTGACCTAAAGCCACCTCCT62.0157.14

[i] F, forward; R, reverse.

Real-time PCR and HRM assay

Real-time PCR and HRM assays were performed with LightCycler® 480 Real-time system (Roche Diagnostics, Switzerland). Each 20 μl reaction system contained ~30 ng DNA, 1X LightCycler HRM Master reaction mix (Roche Diagnostics), 2.5 mM MgCl2, and 4 μM forward and reverse primer (HPLC purified). The same PCR program was used for all amplicons: 95°C for 10 min; 50 cycles of 95°C for 10 sec, 60°C for 15 sec. After amplification, a post amplification melting curve program was initiated by heating to 95°C for 1 min, cooling to 60°C for 1 min, and increasing the temperature to 95°C while continuously measuring fluorescence at 25 acquisitions per degree. Each PCR run contained a negative (no template) control. Data were acquired and analyzed using LC480 Gene Scanning software V1.5 (Roche Diagnostics). All curves were analyzed following normalization, temperature shifting, and the inspection of difference plots.

Specificity and sensitivity of HRM assays

All amplified products were sent to sequence, and then were analyzed for specificity to ensure the homology of EGFR gene using BLAST (19). Sequence analysis was performed with Chromas 2.31 software. To test the sensitivity, we mixed the genomic DNA of the EGFR-mutated sample with wild-type DNA sample in dilutions of 50, 25, 12.5, 10, 5 and 2.5%, and then HRM were performed, PCR products were also sequenced.

EGFR mutation rate screening by HRM

All 126 FFPE specimens, 47 fresh frozen tissue samples and 47 serum specimens were tested by HRM for the detection of mutations in EGFR exons 18–21. Samples were amplified in 96-well plates.

Statistical analysis

SPSS statistical software (version 17) was used for statistical analysis. Difference of EGFR mutation between FFPE and fresh frozen tissue samples were analyzed with Fisher’s exact test. The correlation between the presence of EGFR mutation status and the clinicopathological categorical characteristics was assessed by Logistic Regression. A two-tailed p-value of <0.05 was statistically significant.

Results

Specificity and sensitivity of EGFR HRM assay

Amplicons sequences were verified using BLAST to search the NCBI GenBank. The sensitivity was evaluated by detection of serial dilutions of EGFR-mutated sample. HRM assays for EGFR exons 18, 19, 20, and 21 mutations were detected in dilution of 5, 2.5, 5, and 5%, respectively (Fig. 1). While EGFR mutations were detected by direct sequencing in dilutions of 50 and 25, 12.5, but not <10%.

Figure 1

Sensitivity of the EGFR HRM assay. Using HRM, the mutation was readily detectable at 5% mutation frequency in exon 18 (A), exon 20 (C) and exon 21 (D). Adjusted melting curves (top) and differential plots (bottom) showing the presence of 50, 25, 12.5, 10, 5 and 0% mutant. The 2.5% dilution was not distinct from the normal DNA. (B) The sensitivity of exon 19, it can detect 2.5% dilution. Adjusted melting curves (top) and differential plots (bottom) showing the presence of 50, 25, 12.5, 10, 5, 2.5 and 0% mutant.

EGFR mutation status in FFPE and fresh frozen tissues of NSCLC

Difference plots and sequence traces of representative mutations for each amplicon are depicted in Fig. 2, with Table II showing the results obtained. EGFR mutations (78) were detected in 70 NSCLC FFPE samples by HRM, with a total mutation rate of 55.56% (70/126). Among all the mutations, there were 5 in exon 18 (3.97%), 23 in exon 19 (18.25%), 27 in exon 20 (21.42%), and 23 in exon 21 (18.25%). 74 EGFR mutation identified by HRM were confirmed by direct sequencing. There were 5 in exon 18 (G719S), 22 in exon 19 (2236-225Del), 25 in exon 20 (3 insertion mutation, 22 Q787Q nonsense mutation), and 22 in exon 21 (20 L858R, 2 L861Q). In addition, 8 patients were found to have double EGFR mutations, 4 in exon 19 and exon 20, 3 in exon 20 and exon 21, one in exon 18 and exon 21. We found 25 EGFR mutations in 24 fresh frozen NSCLC tissues; the total mutation rate was 51.06% (24/47). There was one in exon 18 (2.13%, G719S), 8 in exon 19 (17.02%, 2236–2250 Del), 9 in exon 20 (19.15%, Q787Q nonsense mutation), and 7 in exon 21 (14.89%, L858R), one in exon 19 and exon 20. There was no difference in the mutation status between FFPE and fresh frozen tissues (P>0.05).

Figure 2

HRM assays and sequence traces for EGFR. The amplification plot of EGFR exons 18–21 shows aberrant shifting of melting curves from the wild-type (WT, blue line). Difference plot showing two different melting profiles, wild-type samples in blue (WT), mutation in other colors. (A) Exon 18 mutations, genotype is E-18 2155G>A(G719S). (B) Exon 19 mutations, genotype is 2236–2250 del (GAATTAAGAGAAGCA). (C) Exon 20 mutations, genotypes are 2310–2311 insGGT and 2359G>A (Q787Q). (D) Exon 21 mutations, genotypes are 2573T>G (L858R) and 2582T>A (L861Q).

Table II

EGFR mutations detected by HRM and sequencing.

Table II

EGFR mutations detected by HRM and sequencing.

HRM (%)Gene sequencing


Mutation inFFPEFrozenFFPEFrozenGenotype
Exon 185 (3.97)1 (2.13)51G719S
Exon 1923 (18.25)8 (17.02)2282236–2250Del
Exon 2027 (21.42)9 (19.15)228Q787Q
30 2310–2311insGGT
Exon 2123 (18.25)7 (14.89)206L858R
20L861Q
Exon 18 + exon 211 (1.28)010G719S and L858R
Exon 19 + exon 204 (5.13)1 (4.17)412236–2250Del and Q787Q
Exon 20 + exon 213 (3.85)030Q787Q and L858R
Total mutations78257423
Cases70 (55.56)24 (51.06)6622

In addition, there was an obvious Tm shift between the insertion mutation (2310–2311 ins GGT) and Q787Q nonsense mutation in exon 20, so we could easily differentiated the two mutation types by setting positive mutation standard. However, the two exon 21 mutation types could not be identified through HRM.

Serum EGFR mutations testing

EGFR mutations were detected in 22 serum samples from 24 fresh frozen tissue EGFR mutations positive NSCLC patients (Table III). The serum positive rate was 100% (13/13) for those tissue EGFR mutations positive patients in stages II-IV, 81.8% (9/11) for stage I. No false negative was found in stage II-IV patients, while there was 18.2% false negatives for stage I patients. Therefore, the sensitivity of serum EGFR screening by HRM assay was 91.67%, specificity 100%.

Table III

Summary of data of 24 serum samples.

Table III

Summary of data of 24 serum samples.

CaseGenderAgeHistologic typeStagingSmoking statusMutation
1M55AdIIIACExon 20
2M58AdIIANExon 20
3F54SCCIVNExon 19
4M65SCCIACExon 20
5M57SCCIBCExon 20
6M70AdIBCExon 21
7F75AdIIANExon 21
8M59AdIIBNExon 18
9M64SCCIBCExon 20
10F51AdIIIANExon 19
11F51AdIIANExon 21
12M74SCCIIACExon 19
13F62AdIIIANExon 20
14M76SCCIIACExon 19
15F59AdIIIANExon 19
16F70AdIANExon 21
17F63AdIANExon 21
18M53SCCIBCExon 20
19F63SCCIBNExon 19
20M62SCCIIACExon 20
21M46SCCIIACExon 19
22F68AdIANExon 19
23F76AdIANNot detected
24F74AdIBCNot detected

[i] F, female; M, male; Ad, adenocarcinoma; SCC, squamous cell carcinoma; C, current; N, never.

Relationship between EGFR mutations and clinicopathological factors

The correlation between clinicopathological characteristics of the patients and EGFR mutations is summarized in Table IV. EGFR mutations were detected more frequently in never-smokers than smokers (81.03% versus 33.82%; P<0.01), females than males (90.48% versus 38.10%; P<0.05), adenocarcinoma histology compared to squamous cell carcinoma (76.06% versus 28.30%; P<0.01). EGFR mutation status did not show any significant association with clinical staging (P=0.197).

Table IV

Relationship between EGFR mutations and clinicopathological factors.

Table IV

Relationship between EGFR mutations and clinicopathological factors.

EGFR mutation

No. patientP-valueEGFR wild-typeTotal
Total no. patient70-56126
Gender
 Male325284
 Female380.028442
Smoking history
 Never471158
 Former/current230.0044568
Histological diagnosis
 Adenocarcinoma54771
 Squamous cell carcinoma150.0033853
 Large cell carcinoma-11
 Adenosquamous carcinoma1-1
Staging
 I-II494089
 III–IV210.1971435

Discussion

Personalized medicine for cancer has raised new hope of cancer treatment, and become widely used in clinical settings over the last decade. Based on specific genetic information of various cancers, it had become possible to determine the genetic type of cancer, select the appropriate treatment, then enhance drug efficacy and reduce toxicity. However, the effectiveness of these new introduced molecular targeted drugs was closely dependent on the presence of specific genetic mutations in the tumor context (20–22). Gene mutation testing is the premise to using molecular-targeting drugs. EGFR gene mutations have recently been identified as a predictor for first-line EGFR-TKIs sensitivity (23). It was shown that 70% of EGFR mutation-positive NSCLC patients were effective to EGFR-TKIs, while only 10% of EGFR mutation- negative NSCLC patients (24). In addition, the responses of patients with different EGFR mutation types to EGFR-TKIs treatment were also different (25–27). Thus, it is of great importance to detect EGFR mutation status and type for NSCLC patients, which can effectively predict the benefit of taking an EGFR-TKI, and allow the physician to prescribe the most suitable therapy.

There are several methods for EGFR mutation testing, such as PCR-SSCP, gene chips and gene sequencing, with the gene sequencing being the current gold standard (28). HRM is a technique recently developed on the basis of real-time PCR amplification, which shows great potential for somatic mutations. A double stranded DNA binding dye is utilized in melting analysis in order to characterize primer-related non-specific amplification (or primer dimer) for detection of a specific target (29). Compared with traditional real-time PCR, HRM which adopt saturated dye have higher resolution, even single-base change can make the melting temperature of PCR products different (30). All the processes of PCR amplification followed by HRM take place in the same tube during a real-time run in <2 h (31). Therefore, HRM is the method of choice for rapid EGFR mutation screening.

In our study, we confirmed that both FFPE and fresh frozen tissue can be used for the HRM method. Mutation rates of FFPE and fresh frozen tissue are compatible; fresh frozen tissues showed no better than FFPE as others have reported (29). In addition, we found that HRM method could be used to differentiate 2310–2311insGGT and Q787Q mutation in exon 20 if known positive mutations control were properly set. However, HRM failed to identify the two mutation types in exon 21; sequencing had to be done to discriminate them.

Owing to the fact that tissue samples cannot be obtained from most of the lung cancer patients, the use of EGFR mutation screening in tissue samples is limited in practice. Plasma or serum which has free DNA from tumor provides as good alternative. However, the tumor DNA levels in peripheral blood are extremely low, which needs a more sensitive method for detection. The HRM assays described herein successfully identified EGFR mutations not only in tissue specimens but also in serum samples from NSCLC patients. The concordance rate between serum and fresh frozen tissues was better than in a previous report (32). The HRM assays acted perfectly in serum from NSCLC patients in stage II-IV, and no false negative was found. In addition, for NSCLC patients in stage I, most mutations can also be detected despite the 18.2% false negative rate. The sensitivity and specificity for serum EGFR screening by HRM was 91.67 and 100%, respectively. Therefore, HRM assays using serum samples for EGFR mutation screening can act as a good alternative for tissue screening, provide convincing and valuable results for the physician, and benefit surgically unresectable NSCLC patients.

The reported EGFR mutation rate in NSCLC patients differs and varies from 5 to 48.3% (30,32,33). It was shown that EGFR mutations were found in ~10% of cases of NSCLC in North America and 30–50% of NSCLC patients of East Asian descent (7). The frequency of the activating mutations is higher in Asian populations (34). In our research, the total EGFR mutation rate was 55.56%, which is the highest so far. This result may suggest the EGFR mutation rate of people in eastern China must be higher than other regions. In addition, many reports suggest major activating EGFR mutations are primarily in exons 19 and 21, with the inframe deletion in exon 19 and L858R accounting for 90% of reported mutations, additional mutations do occur in exons 18 and 20 that account for 8% of mutants (35). However, we found in this region of china, EGFR mutation occurs in exon 20 more often, especially Q787Q, and then in exons 19 and 21. Therefore, we should not only detect EGFR mutation in exons 19 and 21, but must attach great importance in EGFR exon 20 mutation detection in this region. We recommend that EGFR mutations in exons 18–21 should be detected before prescribing an EGFR-TKI for NSCLC patients from eastern China.

There have been debates on the relationships between EGFR mutation state and clinical characteristics (14,33,36). Our data showed EGFR mutations were more frequently observed in never-smokers, females, and those with adenocarcinoma histology, and there was no correlation between different clinical stages. Our results are comparable to those of Sriram et al (14) and Takano et al (33).

In summary, we have confirmed the feasibility of HRM for screening EGFR mutations in serum. Serum EGFR gene mutation screening by HRM assays are fast, relatively cheap, and robust, and can benefit surgically unresectable NSCLC patients; provide rapid scientific reference to the physician, and guide them to prescribe the most suitable therapy.

References

1 

Sasaki H, Endo K, Konishi A, et al: EGFR mutation status in Japanese lung cancer patients: genotyping analysis using LightCycler. Clin Cancer Res. 11:2924–2929. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Nicholson RI, Gee JM and Harper ME: EGFR and cancer prognosis. Eur J Cancer. 37(Suppl 4): S9–S15. 2001. View Article : Google Scholar

3 

Ohsaki Y, Tanno S, Fujita Y, et al: Epidermal growth factor receptor expression correlates with poor prognosis in non-small cell lung cancer patients with p53 overexpression. Oncol Rep. 7:603–607. 2000.PubMed/NCBI

4 

Scaltriti M and Baselga J: The epidermal growth factor receptor pathway: a model for targeted therapy. Clin Cancer Res. 12:5268–5272. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Lynch TJ, Bell DW, Sordella R, et al: Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med. 350:2129–2139. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Paez JG, Janne PA, Lee JC, et al: EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science. 304:1497–1500. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Shigematsu H, Lin L, Takahashi T, et al: Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst. 97:339–346. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Borras E, Jurado I, Hernan I, et al: Clinical pharmacogenomic testing of KRAS, BRAF and EGFR mutations by high resolution melting analysis and ultra-deep pyrosequencing. BMC Cancer. 11:406–415. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Yasuda H, Kobayashi S and Costa DB: EGFR exon 20 insertion mutations in non-small-cell lung cancer: preclinical data and clinical implications. Lancet Oncol. 13:e23–e31. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Murray S, Dahabreh IJ, Linardou H, Manoloukos M, Bafaloukos D and Kosmidis P: Somatic mutations of the tyrosine kinase domain of epidermal growth factor receptor and tyrosine kinase inhibitor response to TKIs in non-small cell lung cancer: an analytical database. J Thorac Oncol. 3:832–839. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Linardou H, Dahabreh IJ, Bafaloukos D, Kosmidis P and Murray S: Somatic EGFR mutations and efficacy of tyrosine kinase inhibitors in NSCLC. Nat Rev Clin Oncol. 6:352–366. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Han SW, Kim YT, Hwang PG, et al: Predictive and prognostic impact of epidermal growth factor receptor mutation in non-small-cell lung cancer patients treated with gefitinib. J Clin Oncol. 23:2493–2501. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Carey KD, Garton AJ, Romero MS, et al: Kinetic analysis of epidermal growth factor receptor somatic mutant proteins shows increased sensitivity to the epidermal growth factor receptor tyrosine kinase inhibitor, erlotinib. Cancer Res. 66:8163–8171. 2006. View Article : Google Scholar

14 

Sriram KB, Tan ME, Savarimuthu SM, et al: Screening for activating EGFR mutations in surgically resected nonsmall cell lung cancer. Eur Respir J. 10:455–465. 2011.PubMed/NCBI

15 

Taylor CF: Mutation scanning using high-resolution melting. Biochem Soc Trans. 37:433–437. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Stroun M, Anker P, Maurice P, Lyautey J, Lederrey C and Beljanski M: Neoplastic characteristics of the DNA found in the plasma of cancer patients. Oncology. 46:318–322. 1989. View Article : Google Scholar : PubMed/NCBI

17 

Sorenson GD, Pribish DM, Valone FH, Memoli VA, Bzik DJ and Yao SL: Soluble normal and mutated DNA sequences from single copy genes in human blood. Cancer Epidemiol Biomarkers Prev. 3:67–71. 1994.PubMed/NCBI

18 

Vasioukhin V, Anker P, Maurice P, Lyautey J, Lederrey C and Stroun M: Point mutations of the N-ras gene in the blood plasma DNA of patients with myelodysplastic syndrome or acute myelogenous leukaemia. Br J Haematol. 86:774–779. 1994. View Article : Google Scholar : PubMed/NCBI

19 

NCBI/BLAST. http://blast.ncbi.nlm.nih.gov/Blast.cgi.

20 

Horn L and Pao W: EML4-ALK: Honing in on a new target in non-small-cell lung cancer. J Clin Oncol. 27:4232–4235. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Choi YL, Soda M, Yamashita Y, et al: EML4-ALK mutations in lung cancer that confer resistance to ALK inhibitors. N Engl J Med. 363:1734–1739. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Pao W and Girard N: New driver mutations in non-small-cell lung cancer. Lancet Oncol. 12:175–180. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Sequist LV, Bell DW, Lynch TJ and Haber DA: Molecular predictors of response to epidermal growth factor receptor antagonists in non-small-cell lung cancer. J Clin Oncol. 25:587–595. 2007. View Article : Google Scholar : PubMed/NCBI

24 

Uramoto H and Mitsudomi T: Which biomarker predicts benefit from EGFR-TKI treatment for patients with lung cancer? Br J Cancer. 96:857–863. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Jackman DM, Yeap BY, Sequist LV, et al: Exon 19 deletion mutations of epidermal growth treated with gefitinib or erlotinib. Clin Cancer Res. 12:3908–3914. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Riely GJ, Pao W, Pham D, et al: Clinical course of patients with non-small cell lung cancer and epidermal growth factor receptor exon 19 and exon 21 mutations treated with gefitinib or erlotinib. Clin Cancer Res. 12:839–844. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Mitsudomi T, Kosaka T, Endoh H, et al: Mutations of the epidermal growth factor receptor gene predict prolonged survival after gefitinib treatment in patients with non-small cell lung cancer with postoperative recurrence. J Clin Oncol. 23:2513–2520. 2005. View Article : Google Scholar

28 

Pao W and Ladanyi M: Epidermal growth factor receptor mutation testing in lung cancer: searching for the ideal method. Clin Cancer Res. 13:4954–4955. 2007. View Article : Google Scholar : PubMed/NCBI

29 

Bosquet JG, Calcei J, Wei JS, et al: Detection of somatic mutations by high-resolution DNA melting (HRM) analysis in multiple cancers. PLoS One. 6:e145222011. View Article : Google Scholar : PubMed/NCBI

30 

Nomoto K, Tsuta K, Takano T, et al: Detection of EGFR mutations in archived cytologic specimens of non-small cell lung cancer using high resolution melting analysis. Am J Clin Pathol. 126:608–615. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Camila GC and Mauricio RL: The use of high-resolution melting analysis for genotyping Symbiodinium strains: a sensitive and fast approach. Mol Ecol Resour. 11:394–399. 2011. View Article : Google Scholar : PubMed/NCBI

32 

Sriram KB, Tan ME, Savarimuthu SM, et al: Screening for activating EGFR mutations in surgically resected nonsmall cell lung cancer. Eur Respir J. 38:903–910. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Takano T, Ohe Y, Tsuta K, et al: Epidermal growth factor receptor mutation detection using high-resolution melting analysis predicts outcomes in patients with advanced non small cell lung cancer treated with gefitinib. Clin Cancer Res. 18:5385–5390. 2007. View Article : Google Scholar

34 

Bell DW, Lynch TJ, Haserlat SM, et al: Epidermal growth factor receptor mutations and gene amplification in non-small-cell lung cancer: molecular analysis of the IDEAL/INTACT gefitinib trials. J Clin Oncol. 23:8081–8092. 2005. View Article : Google Scholar : PubMed/NCBI

35 

Sharma SV, Bell DW, Settleman J and Haber DA: Epidermal growth factor receptor mutations in lung cancer. Nat Rev Cancer. 7:169–181. 2007. View Article : Google Scholar : PubMed/NCBI

36 

Smith GD, Chadwick BE, Willmore-Payne C and Bentz JS: Detection of epidermal growth factor receptor gene mutations in cytology specimens from patients with non-small cell lung cancer utilising high-resolution melting amplicon analysis. J Clin Pathol. 61:487–493. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Hu C, Liu X, Chen Y, Sun X, Gong Y, Geng M and Bi L: Direct serum and tissue assay for EGFR mutation in non-small cell lung cancer by high-resolution melting analysis. Oncol Rep 28: 1815-1821, 2012.
APA
Hu, C., Liu, X., Chen, Y., Sun, X., Gong, Y., Geng, M., & Bi, L. (2012). Direct serum and tissue assay for EGFR mutation in non-small cell lung cancer by high-resolution melting analysis. Oncology Reports, 28, 1815-1821. https://doi.org/10.3892/or.2012.1987
MLA
Hu, C., Liu, X., Chen, Y., Sun, X., Gong, Y., Geng, M., Bi, L."Direct serum and tissue assay for EGFR mutation in non-small cell lung cancer by high-resolution melting analysis". Oncology Reports 28.5 (2012): 1815-1821.
Chicago
Hu, C., Liu, X., Chen, Y., Sun, X., Gong, Y., Geng, M., Bi, L."Direct serum and tissue assay for EGFR mutation in non-small cell lung cancer by high-resolution melting analysis". Oncology Reports 28, no. 5 (2012): 1815-1821. https://doi.org/10.3892/or.2012.1987
Copy and paste a formatted citation
x
Spandidos Publications style
Hu C, Liu X, Chen Y, Sun X, Gong Y, Geng M and Bi L: Direct serum and tissue assay for EGFR mutation in non-small cell lung cancer by high-resolution melting analysis. Oncol Rep 28: 1815-1821, 2012.
APA
Hu, C., Liu, X., Chen, Y., Sun, X., Gong, Y., Geng, M., & Bi, L. (2012). Direct serum and tissue assay for EGFR mutation in non-small cell lung cancer by high-resolution melting analysis. Oncology Reports, 28, 1815-1821. https://doi.org/10.3892/or.2012.1987
MLA
Hu, C., Liu, X., Chen, Y., Sun, X., Gong, Y., Geng, M., Bi, L."Direct serum and tissue assay for EGFR mutation in non-small cell lung cancer by high-resolution melting analysis". Oncology Reports 28.5 (2012): 1815-1821.
Chicago
Hu, C., Liu, X., Chen, Y., Sun, X., Gong, Y., Geng, M., Bi, L."Direct serum and tissue assay for EGFR mutation in non-small cell lung cancer by high-resolution melting analysis". Oncology Reports 28, no. 5 (2012): 1815-1821. https://doi.org/10.3892/or.2012.1987
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team