Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
2014-January Volume 31 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-January Volume 31 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Upregulation of DNMT1 mediated by HBx suppresses RASSF1A expression independent of DNA methylation

  • Authors:
    • Xuemei Qiu
    • Lihua Zhang
    • Sen Lu
    • Yunwei Song
    • Yingbin Lao
    • Jiaojiao Hu
    • Hong Fan
  • View Affiliations / Copyright

    Affiliations: Department of Medical Genetics and Developmental Biology, Medical School of Southeast University and the Key Laboratory of Developmental Genes and Human Diseases, Ministry of Education, Southeast University, Nanjing, Jiangsu, P.R. China, The Affiliated Zhongda Hospital of Southeast University, Nanjing, Jiangsu, P.R. China, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu, P.R. China
  • Pages: 202-208
    |
    Published online on: November 14, 2013
       https://doi.org/10.3892/or.2013.2848
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The hepatitis B virus (HBV) X protein (HBx) plays a key role in the molecular pathogenesis of HBV-related hepatocellular carcinoma (HCC). However, its critical gene targets remain largely unknown. RASSF1A gene (Ras-association domain family 1A, RASSF1A), a tumor-suppressor gene, is frequently found to be hypermethylated and downregulated in HCC. In the present study, we investigated whether HBx is involved in the hypermethylation and downregulation of RASSF1A and we examined the potential regulation mechanisms. RT-PCR analysis was used to determine RASSF1A and HBx expression in 9 liver cell lines and the results showed that RASSF1A expression was relatively low in HBx-positive cells. Notably, RASSF1A was downregulated in HepG2.2.15 cells, as compared to HepG2 cells. Further analysis revealed that HBx transfection suppressed RASSF1A expression and HBx knockdown induced its expression. Enforced HBx suppressed RASSF1A and meanwhile induced DNMT1 and DNMT3B expression. In addition, RASSF1A is negatively regulated by DNMT1. ChIP analysis using an antibody against DNMT1 revealed that HBx enhanced the binding of DNMT1 to the RASSF1A promoter but the inhibition of RASSF1A by HBx is DNA methylation-independent as detected by methylation-specific PCR (MSP). Further studies using MSP and bisulfite genomic sequencing (BGS) revealed that no significant methylation changes were observed for regional methylation levels of RASSF1A in DNMT1 knockdown cells, although methylation levels of specific CpG sites at the predicted binding sites for the Sp1 and USF transcription factors were reduced. Additionally, RASSF1A was downregulated in HBV-associated HCC (HBV-HCC) as detected by RT-PCR and immunohistochemistry suggesting RASSF1A expression may be related to HBx in HCC and the clinical relevance of our observations. Collectively, our data showed that HBx suppressed RASSF1A expression via DNMT1 and offered a new mechanism of RASSF1A inactive in HCC in addition to the widely known DNA methylation, enriching the epigenetic mechanism by which HBx contributes to the pathogenesis of HBV-HCC.

Introduction

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors and a major cause of cancer-related mortality worldwide. Chronic hepatitis B virus (HBV) infection, which is the major risk factor for developing HCC in East Asia and Africa (1), is prevalent in China (2). The HBV X protein (HBx), an essential factor for HBV replication, is thought to play a key role in the molecular pathogenesis of HBV-associated HCC (HBV-HCC) (3). Previous studies revealed that HBx knocked into p21 locus caused HCC in mice (4). However, critical gene targets remain largely unknown.

RASSF1A gene (Ras-association domain family 1A, RASSF1A), localized at 3p21.3, is a tumor-suppressor gene. De novo methylation of the RASSF1A promoter is one of the most frequent epigenetic inactivation events detected in human cancer and leads to inactivated RASSF1A. Hypermethylation of RASSF1A was frequently found in most major types of human tumors including lung, breast, prostate, pancreas, kidney, liver, cervical, thyroid and several other types of cancer (5). Recent studies have shown that HCC is associated with hypermethylation of RASSF1A (6–8). However, it is not yet known whether these methylation abnormalities result from hepatitis B virus (HBV), a major risk factor for the development of HCC (9). Furthermore, the epigenetic involvement of HBx, the most potent carcinogenic protein in HBV, has yet to be elucidated (10,11). HBx has been implicated to play a role in the epigenetic mechanisms on gene expression (12–14). In particular, HBx has been associated with increased DNA methyltransferase (DNMT) expression levels which result in hypermethylation and downregulation of a variety of genes such as IGFBP3 (12), CDH1 (15) and p16 (16). In the present study, we sought to investigate whether HBx is involved in the hypermethylation and downregulation of RASSF1A and the potential regulation mechanisms.

We found that enforced HBx suppressed RASSF1A and induced DNMT1 and DNMT3B expression. RASSF1A is negatively regulated by DNMT1. HBx enhanced the binding of DNMT1 to RASSF1A promoter but the inhibition of RASSF1A by HBx is DNA methylation independent. Further studies using methylation-specific PCR (MSP) and bisulfite genomic sequencing (BGS) revealed that DNMT1 may suppress RASSF1A expression by hypermethylation of special CpG sites and thereby inhibits transcriptional factor binding without changing regional methylation status. Taken together, our data suggested that HBx silenced RASSF1A by increasing DNMT1 but independent of DNA methylation. Our findings offer a new mechanism of RASSF1A inactive in HCC, enhancing the understanding of both the contribution of HBx to HCC and the pathogenesis of HBV-HCC.

Materials and methods

Cell lines and HCC patient samples

The immortalized human liver cell line L02 and HCC cell lines MHCC-97L, MHCC-97H, HepG2 and HepG2.2.15 cells were maintained in Dulbecco's Modified Eagle's Medium (Gibco-BRL, Birmingham, MI, USA) supplemented with 10% fetal bovine serum (FBS; Wisent, Quebec, Canada). The liver cell lines Chang liver and QSG-7701 and HCC cell lines SMMC-7721 and BEL-7405 cells were grown in RPMI-1640 (Gibco-BRL) containing 10% FBS. The cells were incubated at 37°C in a humidified atmosphere with 5% CO2.

Paired tumorous and adjacent non-tumorous liver tissues from 29 HCC patients were obtained from the First Affiliated Hospital of Nanjing Medical University. The tissue samples were immediately frozen in liquid nitrogen after resection and stored at −80°C until use. All samples were obtained with the written consent of the patients and were analyzed anonymously. This study was performed with the approval of the Medical Ethics Committee of the Medical School of Southeast University.

Transfection

QSG-7701 and SMMC-7721 cells were transfected with 4 μg of the pcDNA4/TO-HBx construct or the control pcDNA4/TO using the FuGENE®HD transfection reagent (Roche, Mannheim, Germany). The cells were harvested 36 h after transfection. L02 cells were transfected as described above. After transfection, cells were grown and selectively cultured in 200 μg/ml Zeocin (Invitrogen Life Technologies, Carlsbad, CA, USA) for 2 months after the initial transfection. L02-HBx #8 were the isolated HBx-transfectants. Transfection of 7,721 cells with siDNMT1 or siDNMT3B constructs was performed as previously described (17,18). Small interfering RNAs (siRNAs) targeting the HBx mRNA were designed and synthesized by GenePharma (Shanghai, China). For the siRNA transfections, the cells were plated to 50% confluency and were then transfected with 50 nmol/l HBx siRNA or a negative control using the X-tremeGENE siRNA transfection reagent (Roche) according to the manufacturer's protocol. After 48 h, the cells were harvested for analysis.

Reverse-transcription (RT)-PCR and quantitative real-time polymerase chain reaction (qPCR)

The total RNA was purified with TRIzol (Invitrogen Life Technologies) and first-strand cDNA was prepared using PrimeScript RT reagent kit with gDNA Eraser (Takara Bio, Inc., Dalian, China) according to the manufacturer's instructions. PCR products were electrophoresed on 2% agarose gel, stained with ethidium bromide, and visualized under UV illumination. The intensities of the specific bands were analyzed and quantified. The qPCR was carried out using the SYBR Premix Ex Taq™ (Takara Bio, Inc.) according to the manufacturer's protocol. The relative expression was evaluated by the comparative CT method. The primer sequences of each gene and PCR conditions are shown in Table I.

Table I

Primers and annealing temperature of genes analyzed by PCR.

Table I

Primers and annealing temperature of genes analyzed by PCR.

GenePrimers (5′ to 3′)Temperature (°C)Amplification size (bp)
RASSF1AF: TCATCTGGGGCGTCGTG
R: CGTTCGTGTCCCGCTCC
62144
DNMT1F: CCGAGTTGGTGATGGTGTGTAC
R: AGGTTGATGTCTGCGTGGTAGC
61324
DNMT3AF: TATTGATGAGCGCACAAGAGAGC
R: GGGTGTTCCAGGGTAACATTGAG
65110
DNMT3BF: GACTTGGTGATTGGCGGAA
R: GGCCCTGTGAGCAGCAGA
64270
HBxF: TTCTTCGTCTGCCGTTCC
R: TCGGTCGTTGACATTGCT
54201
β-actinF: AAAGACCTGTACGCCAACAC
R: GTCATACTCCTGCTTGCTGAT
61220
RASSF1A (BGS)MU379: GTTTTGGTAGTTTAATGAGTTTAGGTTTTTT
ML730: ACCCTCTTCCTCTAACACAATAAAACTAACC
55381
MU379: GTTTTGGTAGTTTAATGAGTTTAGGTTTTTT
ML561: CCCCACAATCCCTACACCCAAAT
55205
RASSF1A (M)F: GTGTTAACGCGTTGCGTATC
R: AACCCCGCGAACTAAAAACGA
5694
RASSF1A (U)F: TTTGGTTGGAGTGTGTTAATGTG
R: CAAACCCCACAAACTAAAAACAA
58108

[i] RASSF1A, Ras association domain family 1A; HBx, hepatitis B virus (HBV) X protein; F, forward; R, reverse.

Bisulfite treatment and promoter methylation analysis

Genomic DNA was extracted from the cells using the phenol-chloroform method followed by bisulfite modification. BGS was performed as previously described (19). Bisulfite-treated genomic DNA from L02-Vector, L02-HBx #8, 7701-Vector, 7701-HBx, 7721-Control and 7721-siDNMT1 cells were amplified using methylated and unmethylated RASSF1A primers (20). For BGS of RASSF1A promoter region in 7721-Control and 7721-siDNMT1 cells, semi-nested PCR was carried out. The PCR products were purified with the AxyPrep gel extraction kit (Axygen, USA) and cloned into pMD19-T vectors (Takara Bio, Inc.), followed by cycle-sequencing of at least 8 clones from each cell line. Primers used for RASSF1A BGS are as previously reported (21) and the sequences are listed in Table I.

Chromatin immunoprecipitation (ChIP) and ChIP-PCR

The ChIP experiments were performed using an EZ-Magna ChIP G kit (Upstate Biotechnology, Inc., Lake Placid, NY, USA) according to the method described previously (22). The primers used for the amplification of the precipitated DNA fragments were reported previously (23).

Immunohistochemical analysis

Paraffin sections (5 mm) were stained with the anti-RASSF1A antibody by incubating the samples overnight at 4°C. Secondary staining with biotin-conjugated anti-rabbit IgG and tertiary staining with HRP-conjugated streptavidin was performed using an ABC kit (PK6100; Vector Laboratories, Burlingame, CA, USA). Specific staining was visualized by 3,3′-diaminobenzidine (DAB) staining. The slides were then counterstained with hematoxylin. Images were captured using the Nikon (Melville, NY, USA) Eclipse TE2000-S microscope system.

Statistical analysis

The independent Student's t-test was used to compare the results, expressed as the means ± SD between any 2 pre-selected groups. A P-value <0.05 was considered to indicate statistically significant differences.

Results

HBx suppresses RASSF1A expression in HCC cell lines

RASSF1A and HBx expression in 9 liver cell lines was detected by RT-PCR. The results showed that HBx was positive in 97H, 97L and HepG2.2.15 cells that constitutively replicate HBV (Fig. 1A). Compared to immortalized human liver cell line L02, normal liver cells Chang liver and QSG-7701 non-tumor hepatocyte cells, RASSF1A expression was relatively low in HCC cell lines, especially in HBx-positive 97H, 97L and HepG2.2.15 cells. The negative correlation between HBx and RASSF1A expression suggested that the expression of RASSF1A may be related to HBx. Notably, RASSF1A was downregulated in HepG2.2.15 cells, which are derived from HepG2 cells transfected with a plasmid containing HBV DNA, as compared to HepG2 cells.

Figure 1

HBx suppresses RASSF1A expression in HCC cell lines. (A) RASSF1A and HBx expression levels were detected in 9 liver or HCC cell lines by RT-PCR. β-actin was used as a loading control. (B) RT-PCR analysis showing the expression of RASSF1A and HBx in QSG-7701 and SMMC-7721 cells transiently transfected with HBx expression constructs or control vectors and L02 cells stably transfected with HBx expression constructs. The #8 cell line is an HBx transfectant (HBx #8). β-actin was used as a loading control. (C) The HBx siRNA or the control siRNA were transfected into L02-HBx #8, 97H and HepG2.2.15 cells (NC or siHBx). The HBx and RASSF1A mRNA expression was examined by qPCR analysis (*P<0.05, independent Student's t-test). HBx, hepatitis B virus (HBV) X protein; RASSF1A, Ras association domain family 1A; HCC, hepatocellular carcinoma.

The QSG-7701 and SMMC-7721 cells were transiently transfected with the pCDNA4-HBx and pCDNA4 vectors (Fig. 1B). Results showed that RASSF1A was downregulated in HBx-transfected cells compared with the control cells (vector) (Fig. 1B). In the L02-HBx #8 cells which were stably transfected with HBx, RASSF1A was also shown to be downregulated (Fig. 1B). To further verify whether this downregulation correlated with HBx expression, we examined the expression of RASSF1A after HBx knockdown by RNAi. The results showed that HBx knockdown increased RASSF1A expression in L02-HBx #8, 97H and HepG2.2.15 cells (P<0.05; Fig. 1C). These data support the hypothesis that HBx downregulates RASSF1A expression.

DNMT1 mediates the suppression of RASSF1A by HBx

Hypermethylation of the RASSF1A promoter is one of the most frequent epigenetic inactivation events leading to silencing of RASSF1A expression. As DNA methylation is catalyzed by DNA methyltransferase including DNMT1, DNMT3A and DNMT3B, we investigated whether HBx regulates DNMT expression and inactivates RASSF1A via promoter hypermethylation. DNMT expression analysis in SMMC-7721 cells showed that DNMT1 and DNMT3B were all upregulated in HBx-transfected cells (Fig. 2A). RASSF1A expression was upregulated in DNMT1-knockdown SMMC-7721 cells but not in DNMT3B-knockdown SMMC-7721 cells (Fig. 2B and C), suggesting that RASSF1A was regulated by DNMT1 and the suppression of RASSF1A by HBx may be through DNMT1. Next, we investigated whether HBx induces hypermethylation of RASSF1A promoter by MSP. The results showed that HBx failed to hypermethylate RASSF1A promoter in QSG-7701 and L02 cells (Fig. 2D). ChIP analysis using an antibody against DNMT1 revealed that the binding of DNMT1 to RASSF1A promoter regions is enriched in L02-HBx cells (Fig. 2E), which suggested that without changing DNA methylation status, DNMT1 mediates the suppression of RASSF1A by HBx.

Figure 2

DNMT1 mediates the suppression of RASSF1A by HBx. (A) The levels of mRNAs encoding DNMT1, DNMT3A and DNMT3B were detected by RT-PCR in SMMC-7721 cells transiently transfected with the HBx expression construct or the control vector. β-actin was used as a loading control. HBx induced DNMT1 and DNMT3B expression. (B) RASSF1A and DNMT1 expression levels were detected by RT-PCR in SMMC-7721 cells after DNMT1 was knocked down by RNAi (siDNMT1) and control cells. β-actin was used as a loading control. (C) RASSF1A and DNMT3B expression levels were detected by RT-PCR in SMMC-7721 cells after DNMT3B was knocked down by RNAi (siDNMT3B) and control cells. β-actin was used as a loading control. (D) The methylation status of RASSF1A promoter was analyzed by methylation-specific PCR (MSP) in QSG-7701 cells transiently transfected with HBx and control constructs and HBx stably transfected L02 cells. M, methylation-specific primer amplification; U, unmethylation-specific amplification. (E) ChIP assay was performed in L02-Vector and L02-HBx cells using a DNMT1 specific antibody, followed by PCR amplification of individual fragments representing RASSF1A promoter regions. Chromatin (defined as ‘input’) and DNA products immunoprecipitated by IgG were used as positive and negative controls, respectively. H2O was used as a blank control. RASSF1A, Ras association domain family 1A; HBx, hepatitis B virus (HBV) X protein. ChIP, chromatin immunoprecipitation.

DNMT1 suppresses RASSF1A expression in a manner independent of DNA methylation

To explore how DNMT1 regulates RASSF1A, MSP and BGS were utilized to test the methylation status of RASSF1A after DNMT1 knockdown in SMMC-7721 cells. No significant changes of methylation were observed between 7721-Control and 7721-siDNMT1 cells for the methylation status of RASSF1A promoter region as evaluated by MSP (Fig. 3A).

Figure 3

DNMT1 suppresses RASSF1A expression in a manner independent of DNA methylation. (A) The methylation status of the RASSF1A promoter was detected in SMMC-7721-siDNMT1 and SMMC-7721-Control cells by methylation-specific PCR. M, methylation-specific primer amplification; U, unmethylation-specific amplification. (B) Mapping of the methylation status of individual CpG sites in the RASSF1A promoter by bisulfite genomic sequencing in SMMC-7721-siDNMT1 and SMMC-7721-Control cells. The regions spanning the CpG island with 16 CpG sites were analyzed. Black represents the methylated CpG site; white represents the unmethylated CpG site; each circle represents bisulfite sequencing of one CpG site for 8 random clones from SMMC-7721-siDNMT1 and SMMC-7721-Control cells. The boxed regions show the schematic of transcription factor binding sites. RASSF1A, Ras association domain family 1A.

The methylation levels of 16 CpG sites of the RASSF1A gene were examined using BGS (Fig. 3B). There were no significant changes in methylation levels in 7721-Control and 7721-siDNMT1 cells (P>0.05; Fig. 3B), the methylation ratio of the 16 CpG sites in the RASSF1A promoter was 53.13 and 55.47% in 7721-Control and 7721-siDNMT1 cells, respectively. Of note, methylation levels of CpG sites at the predicted binding sites for the Sp1 and USF transcription factors were altered in 7721-Control and 7721-siDNMT1 cells (P<0.05; Fig. 3B). Both for the Sp1 and USF transcription factors binding sites, the methylation ratio of the CpG sites was 100 and 62.5% in 7721-Control and 7721-siDNMT1 cells, respectively. Collectively, these data suggest that DNMT1-induced silencing of RASSF1A in SMMC-7721 cells is independent of DNMT1 DNA methyltransferase activity.

RASSF1A is downregulated in HBV-related HCC

RASSF1A expression in HBV-HCC was analyzed by RT-PCR analysis (29 cases). Seven representative results are shown in Fig. 4A. Compared to the paired corresponding non-tumor tissues, 48% of HCC cases showed a downregulation of RASSF1A at the mRNA level (Fig. 4B). Expression of RASSF1A was further examined by immunohistochemistry (IHC). The results showed that the RASSF1A protein was mainly localized in the nucleus. The protein levels were reduced in HCC cells when compared to the adjacent non-cancerous hepatocytes (Fig. 4C). Further evaluation of the relationship between HBx and RASSF1A mRNA levels in HCC samples revealed the negative correlation between RASSF1A and HBx expression in some HCC patients. RASSF1A expression was relatively low in HBx-positive tumor tissues, as shown in 8 representative cases (Fig. 4D).

Figure 4

RASSF1A expression is downregulated in HBV-related HCC. (A) RASSF1A mRNA expression in 7 representative HCC (T) and their matched non-tumor tissues (N) detected by RT-PCR analysis (n=29). β-actin was used as a loading control. (B) Analysis of the relative expression of RASSF1A in the 29 paired HCC and matched non-tumor tissues. The numbers 14, 10 and 5 are case numbers; 2-folds was used as cutoff. (C) Immunohistochemical staining of RASSF1A protein in a representative HCC sample and its matched non-tumor tissue specimen. RASSF1A protein was localized mainly in the nucleus. RASSF1A was expressed at lower levels in HCC samples compared to their matched non-tumor tissues. (D) The mRNA levels of RASSF1A and HBx (detected by RT-PCR) in 8 HCC samples showed a negative correlation between RASSF1A and HBx expression. β-actin was used as a loading control. RASSF1A, Ras association domain family 1A; HBV, hepatitis B virus; HCC, hepatocellular carcinoma; HBx, hepatitis B virus X protein.

Discussion

Ras association domain family 1 isoform A (RASSF1A) is a recently discovered tumor-suppressor gene. RASSF1A knockout mouse were prone to spontaneous tumorigenesis at advanced age (24), and RASSF1A is apparently involved in several growth regulatory and apoptotic pathways. Ectopic expression of RASSF1A in cancer cell lines, which lack endogenous RASSF1A transcripts, resulted in reduced growth of the cells in vitro and in nude mice (21,25–30). In addition, hypermethylation and inactivation of RASSF1A during tumor development was observed in a variety of different tumor types, including HBV-related HCC (6–8). However, whether HBV or HBx was involved in the downregulation of RASSF1A and the regulation mechanisms during HCC carcinogenesis remain unclear. Herein, we report that the major HBV oncoprotein, HBx, suppresses RASSF1A expression. RASSF1A is negatively regulated by DNMT1 and HBx induces DNMT1 expression. Further analysis revealed that HBx promoted recruitment of DNMT1 to RASSF1A promoter regions and may suppress RASSF1A expression by upregulating DNMT1.

HBx promoted recruitment of DNMT1 to RASSF1A promoter regions without changing the methylation status of RASSF1A DNA. Further studies on the regulation mechanisms of RASSF1A by DNMT1 revealed that DNMT1 RNAi influenced methylation of special CpG sites rather than regional methylation status. DNMT1 was previously shown to possess transcriptional suppression abilities, independent of catalyzing DNA methylation, that were partially mediated through a direct interaction with the histone deacetylases, HDAC1 and HDAC2, and other co-repressors (31–33). Thus, HBx-mediated DNMT1 may suppress RASSF1A expression by recruitment of other histone modification proteins and affects chromatin structure. Further studies will reveal the precise regulation mechanisms of RASSF1A by HBx through upregulating DNMT1.

BGS analysis showed that DNMT1 affected methylation status of specific transcription factor binding sites such as Sp1 and USF. The binding of Sp1 is DNA methylation insensitive (34,35). Methylation of Sp1 binding sites is associated with impaired binding of Sp1 at the RASSF1A promoter and the inactivation transcription of RASSF1A in proliferating human mammary epithelial cells (36). HBx-DNMT1-induced methylation of Sp1 binding sites may inhibit binding of Sp1 at the RASSF1A promoter, which results in the suppression of RASSF1A expression. This is consistent with previous reports that HBx specifically suppressed insulin-like growth factor-3 expression through DNMT3A1 and DNMT3A2 and by inhibiting Sp1 binding via recruiting methyl CpG binding protein 2 to the newly methylated Sp1 binding element (12). Upstream Stimulatory Factor (USF) is a family of helix-loop-helix transcription factors. Strong activation of transcription was observed both in vitro and in vivo following binding of USF to specific sites in gene promoters (37–39). Furthermore, CpG methylation can impair USF interaction with core motifs and subsequently alter gene expression, as for the metallothionein-I gene which is silenced in mouse lymphosarcoma (40). Therefore, HBx-DNMT1 may also suppress RASSF1A expression by inducing methylation of USF binding sites and subsequently inhibition of binding of USF at RASSF1A promoter.

In conclusion, we found that HBx enhances recruitment of DNMT1 to RASSF1A promoter regions and, hence, suppresses RASSF1A expression. DNMT1 could suppress RASSF1A expression independently of its regional DNA methylation status. Our studies offer another mechanism for the downregulation of RASSF1A in HBV-HCC other than the widely known DNA methylation, thereby providing insight into the epigenetic mechanism by which HBx contributes to the pathogenesis of HBV-HCC.

Acknowledgements

This study was supported by the National Natural Science Foundation of China, nos. 30470950 and 91229107, and in part by the Innovative Scientific Research Projects for College Graduates of Jiangsu Province, no. CXZZ_0137. The authors thank Professor Guan Xinyuan at the University of Hong Kong for providing the HBx constructs.

References

1 

Thorgeirsson SS and Grisham JW: Molecular pathogenesis of human hepatocellular carcinoma. Nat Genet. 31:339–346. 2002. View Article : Google Scholar : PubMed/NCBI

2 

Merican I, Guan R, Amarapuka D, et al: Chronic hepatitis B virus infection in Asian countries. J Gastroenterol Hepatol. 15:1356–1361. 2000. View Article : Google Scholar : PubMed/NCBI

3 

Lupberger J and Hildt E: Hepatitis B virus-induced oncogenesis. World J Gastroenterol. 13:74–81. 2007. View Article : Google Scholar

4 

Wang Y, Cui F, Lv Y, et al: HBsAg and HBx knocked into the p21 locus causes hepatocellular carcinoma in mice. Hepatology. 39:318–324. 2004. View Article : Google Scholar

5 

Pfeifer GP and Dammann R: Methylation of the tumor suppressor gene RASSF1A in human tumors. Biochemistry. 70:576–583. 2005.PubMed/NCBI

6 

Hu L, Chen G, Yu H and Qiu X: Clinicopathological significance of RASSF1A reduced expression and hypermethylation in hepatocellular carcinoma. Hepatol Int. 4:423–432. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Schagdarsurengin U, Wilkens L, Steinemann D, et al: Frequent epigenetic inactivation of the RASSF1A gene in hepatocellular carcinoma. Oncogene. 22:1866–1871. 2003. View Article : Google Scholar

8 

Zhong S, Yeo W, Tang MW, Wong N, Lai PB and Johnson PJ: Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas. Clin Cancer Res. 9:3376–3382. 2003.PubMed/NCBI

9 

Bréchot C: Pathogenesis of hepatitis B virus-related hepatocellular carcinoma: old and new paradigms. Gastroenterology. 127(Suppl 1): S56–S61. 2004.PubMed/NCBI

10 

Kim CM, Koike K, Saito I, Miyamura T and Jay G: HBx gene of hepatitis B virus induces liver cancer in transgenic mice. Nature. 351:317–320. 1991. View Article : Google Scholar

11 

Yu DY, Moon HB, Son JK, et al: Incidence of hepatocellular carcinoma in transgenic mice expressing the hepatitis B virus X-protein. J Hepatol. 31:123–132. 1999. View Article : Google Scholar : PubMed/NCBI

12 

Park IY, Sohn BH, Yu E, et al: Aberrant epigenetic modifications in hepatocarcinogenesis induced by hepatitis B virus X protein. Gastroenterology. 132:1476–1494. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Tong A, Gou L, Lau QC, et al: Proteomic profiling identifies aberrant epigenetic modifications induced by hepatitis B virus X protein. J Proteome Res. 8:1037–1046. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Zheng DL, Zhang L, Cheng N, et al: Epigenetic modification induced by hepatitis B virus X protein via interaction with de novo DNA methyltransferase DNMT3A. J Hepatol. 50:377–387. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Lee JO, Kwun HJ, Jung JK, Choi KH, Min DS and Jang KL: Hepatitis B virus X protein represses E-cadherin expression via activation of DNA methyltransferase 1. Oncogene. 24:6617–6625. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Zhu Y, Zhu R, Shi L, et al: Hepatitis B virus X protein promotes hypermethylation of p16INK4A promoter through upregulation of DNA methyltransferases in hepatocarcinogenesis. Exp Mol Pathol. 89:268–275. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Fan H, Zhao Z, Quan Y, Xu J, Zhang J and Xie W: DNA methyltransferase 1 knockdown induces silenced CDH1 gene reexpression by demethylation of methylated CpG in hepatocellular carcinoma cell line SMMC-7721. Eur J Gastroenterol Hepatol. 19:952–961. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Xu J, Fan H, Zhao ZJ, Zhang JQ and Xie W: Identification of potential genes regulated by DNA methyltransferase 3B in a hepatocellular carcinoma cell line by RNA interference and microarray analysis. Yi Chuan Xue Bao. 32:1115–1127. 2005.(In Chinese).

19 

Tao Q, Huang H, Geiman TM, et al: Defective de novo methylation of viral and cellular DNA sequences in ICF syndrome cells. Hum Mol Genet. 11:2091–2102. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Kawaguchi Ki, Oda Y, Saito T, et al: DNA hypermethylation status of multiple genes in soft tissue sarcomas. Mod Pathol. 19:106–114. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Dammann R, Li C, Yoon JH, Chin PL, Bates S and Pfeifer GP: Epigenetic inactivation of a RAS association domain family protein from the lung tumour suppressor locus 3p21.3. Nat Genet. 25:315–319. 2000. View Article : Google Scholar : PubMed/NCBI

22 

Chen L, Chan THM, Yuan YF, et al: CHD1L promotes hepatocellular carcinoma progression and metastasis in mice and is associated with these processes in human patients. J Clin Invest. 120:1178–1191. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Yan PS, Shi H, Rahmatpanah F, et al: Differential distribution of DNA methylation within the RASSF1A CpG island in breast cancer. Cancer Res. 63:6178–6186. 2003.PubMed/NCBI

24 

Tommasi S, Dammann R, Zhang Z, et al: Tumor susceptibility of Rassf1a knockout mice. Cancer Res. 65:92–98. 2005.PubMed/NCBI

25 

Burbee DG, Forgacs E, Zöchbauer-Müller S, et al: Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression. J Natl Cancer Inst. 93:691–699. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Hesson L, Bièche I, Krex D, et al: Frequent epigenetic inactivation of RASSF1A and BLU genes located within the critical 3p21.3 region in gliomas. Oncogene. 23:2408–2419. 2004.

27 

Dreijerink K, Braga E, Kuzmin I, et al: The candidate tumor suppressor gene, RASSF1A, from human chromosome 3p21.3 is involved in kidney tumorigenesis. Proc Natl Acad Sci USA. 98:7504–7509. 2001.PubMed/NCBI

28 

Kuzmin I, Gillespie JW, Protopopov A, et al: The RASSF1A tumor suppressor gene is inactivated in prostate tumors and suppresses growth of prostate carcinoma cells. Cancer Res. 62:3498–3502. 2002.

29 

Chow LS, Lo KW, Kwong J, et al: RASSF1A is a target tumor suppressor from 3p21.3 in nasopharyngeal carcinoma. Int J Cancer. 109:839–847. 2004. View Article : Google Scholar

30 

Li J, Wang F, Protopopov A, et al: Inactivation of RASSF1C during in vivo tumor growth identifies it as a tumor suppressor gene. Oncogene. 23:5941–5949. 2004.

31 

Fuks F, Burgers WA, Brehm A, Hughes-Davies L and Kouzarides T: DNA methyltransferase Dnmt1 associates with histone deacetylase activity. Nat Genet. 24:88–91. 2000. View Article : Google Scholar : PubMed/NCBI

32 

Rountree MR, Bachman KE and Baylin SB: DNMT1 binds HDAC2 and a new co-repressor, DMAP1, to form a complex at replication foci. Nat Genet. 25:269–277. 2000. View Article : Google Scholar : PubMed/NCBI

33 

Robertson KD, Ait-Si-Ali S, Yokochi T, Wade PA, Jones PL and Wolffe AP: DNMT1 forms a complex with Rb, E2F1 and HDAC1 and represses transcription from E2F-responsive promoters. Nat Genet. 25:338–342. 2000. View Article : Google Scholar : PubMed/NCBI

34 

Höller M, Westin G, Jiricny J and Schaffner W: Sp1 transcription factor binds DNA and activates transcription even when the binding site is CpG methylated. Genes Dev. 2:1127–1135. 1988.PubMed/NCBI

35 

Pieper RO, Patel S, Ting SA, Futscher BW and Costello JF: Methylation of CpG island transcription factor binding sites is unnecessary for aberrant silencing of the human MGMT gene. J Biol Chem. 271:13916–13924. 1996. View Article : Google Scholar : PubMed/NCBI

36 

Strunnikova M, Schagdarsurengin U, Kehlen A, Garbe JC, Stampfer MR and Dammann R: Chromatin inactivation precedes de novo DNA methylation during the progressive epigenetic silencing of the RASSF1A promoter. Mol Cell Biol. 25:3923–3933. 2005. View Article : Google Scholar : PubMed/NCBI

37 

Sawadogo M and Roeder RG: Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell. 43:165–175. 1985. View Article : Google Scholar : PubMed/NCBI

38 

Luo X and Sawadogo M: Functional domains of the transcription factor USF2: atypical nuclear localization signals and context-dependent transcriptional activation domains. Mol Cell Biol. 16:1367–1375. 1996.

39 

Roy AL, Du H, Gregor PD, Novina CD, Martinez E and Roeder RG: Cloning of an inr-and E-box-binding protein, TFII-I, that interacts physically and functionally with USF1. EMBO J. 16:7091–7104. 1997. View Article : Google Scholar : PubMed/NCBI

40 

Majumder S, Ghoshal K, Li Z, Bo Y and Jacob ST: Silencing of metallothionein-I gene in mouse lymphosarcoma cells by methylation. Oncogene. 18:6287–6295. 1999. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Qiu X, Zhang L, Lu S, Song Y, Lao Y, Hu J and Fan H: Upregulation of DNMT1 mediated by HBx suppresses RASSF1A expression independent of DNA methylation. Oncol Rep 31: 202-208, 2014.
APA
Qiu, X., Zhang, L., Lu, S., Song, Y., Lao, Y., Hu, J., & Fan, H. (2014). Upregulation of DNMT1 mediated by HBx suppresses RASSF1A expression independent of DNA methylation. Oncology Reports, 31, 202-208. https://doi.org/10.3892/or.2013.2848
MLA
Qiu, X., Zhang, L., Lu, S., Song, Y., Lao, Y., Hu, J., Fan, H."Upregulation of DNMT1 mediated by HBx suppresses RASSF1A expression independent of DNA methylation". Oncology Reports 31.1 (2014): 202-208.
Chicago
Qiu, X., Zhang, L., Lu, S., Song, Y., Lao, Y., Hu, J., Fan, H."Upregulation of DNMT1 mediated by HBx suppresses RASSF1A expression independent of DNA methylation". Oncology Reports 31, no. 1 (2014): 202-208. https://doi.org/10.3892/or.2013.2848
Copy and paste a formatted citation
x
Spandidos Publications style
Qiu X, Zhang L, Lu S, Song Y, Lao Y, Hu J and Fan H: Upregulation of DNMT1 mediated by HBx suppresses RASSF1A expression independent of DNA methylation. Oncol Rep 31: 202-208, 2014.
APA
Qiu, X., Zhang, L., Lu, S., Song, Y., Lao, Y., Hu, J., & Fan, H. (2014). Upregulation of DNMT1 mediated by HBx suppresses RASSF1A expression independent of DNA methylation. Oncology Reports, 31, 202-208. https://doi.org/10.3892/or.2013.2848
MLA
Qiu, X., Zhang, L., Lu, S., Song, Y., Lao, Y., Hu, J., Fan, H."Upregulation of DNMT1 mediated by HBx suppresses RASSF1A expression independent of DNA methylation". Oncology Reports 31.1 (2014): 202-208.
Chicago
Qiu, X., Zhang, L., Lu, S., Song, Y., Lao, Y., Hu, J., Fan, H."Upregulation of DNMT1 mediated by HBx suppresses RASSF1A expression independent of DNA methylation". Oncology Reports 31, no. 1 (2014): 202-208. https://doi.org/10.3892/or.2013.2848
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team