Expression and clinical significance of estrogen‑regulated long non-coding RNAs in estrogen receptor α-positive ovarian cancer progression

  • Authors:
    • Jun-Jun Qiu
    • Le-Chi Ye
    • Jing-Xin Ding
    • Wei-Wei Feng
    • Hong‑Yan Jin
    • Ying Zhang
    • Qing Li
    • Ke-Qin Hua
  • View Affiliations

  • Published online on: January 27, 2014     https://doi.org/10.3892/or.2014.3000
  • Pages: 1613-1622
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Estrogen (E2) has long been implicated in epithelial ovarian cancer (EOC) progression. The effects of E2 on cancer progression can be mediated by numerous target genes, including coding RNAs and, more recently, non-coding RNAs (ncRNAs). Among the ncRNAs, long ncRNAs (lncRNAs) have emerged as new regulators in cancer progression; therefore, our aim was to determine whether the expression of any lncRNAs is regulated by E2 and, if so, whether a subset of these lncRNAs have some clinical significance in EOC progression. A microarray was performed to identify E2-regulated lncRNAs in E2 receptor (ER) α-positive EOC cells. Bioinformatics analyses of lncRNAs were conducted, focusing on gene ontology and pathway analyses. Quantitative real-time polymerase chain reactions were performed to confirm the expression of certain lncRNAs in ERα-positive EOC tissues. The correlation between certain lncRNA expression and clinicopathological factors as well as prognosis in ERα-positive EOC patients was then analyzed. We showed that 115 lncRNAs exhibited significant changes in E2-treated SKOV3 cells compared with untreated controls. Most of these lncRNAs were predicated to have potential to contribute to cancer progression. Notably, three candidates (TC0100223, TC0101686 and TC0101441) were aberrantly expressed in ERα-positive compared to ERα-negative EOC tissues, showing correlations with some malignant cancer phenotypes such as advanced FIGO stage and/or high histological grade. Furthermore, multivariate analysis indicated that TC0101441 was an independent prognostic factor for overall survival. Taken together, these results indicate for the first time that E2 can modulate lncRNA expression in ERα-positive EOC cells and that certain lncRNAs are correlated with advanced cancer progression and suggestive of a prognostic indicator in ERα-positive EOC patients. Knowledge of these E2-regulated lncRNAs could aid in the future understanding of the estrogenic effect on EOC progression and may assist in the clinical design of new target therapies based on a perspective of lncRNA.

Introduction

Epithelial ovarian cancer (EOC) is the most deadly malignancy of the female reproductive tract in many countries (1,2). Involvement of steroid hormones, primarily estrogen, has been associated with EOC. Ample evidence from epidemiologic, clinical and experimental research has demonstrated that E2 is responsible for promoting EOC progression (39). Although the effects of E2 on EOC progression have been extensively studied, the underlying mechanisms remain unknown and the clinical response to steroid hormone therapy remains disappointing. Thus, fully identifying the contributions of E2 to EOC progression is urgently required.

Compelling data have demonstrated that the effects of E2 on EOC development are mediated by the regulation of target genes involved in the control of cancer progression. Previous studies, including ours, have identified a panel of aberrantly expressed E2-regulated protein-coding genes that are involved in cellular growth control, such as cyclin D1 and c-myc, and in cellular metastasis control, such as fibulin-1, cathepsin-D, HIF-1, nm23-H1, E-cadherin and MMP-2 (47,10,11). Despite these protein-coding genes, undoubtedly, the set of genes that directly mediate estrogenic effects on EOC progression has not been fully defined. Therefore, exploration of new E2-regulated genes is needed, which may help elucidate estrogenic effects on EOC progression and provide optional therapeutic targets.

The human transcriptome was found to be more complex than a collection of protein-coding genes, showing extensive non-coding RNA (ncRNA) expression (12). Long ncRNAs (lncRNAs; >200 nt in length), initially argued to be spurious transcriptional noise (13), are emerging as new regulators in the cancer paradigm. Aberrant expression of lncRNAs has been reported to be associated with malignant phenotypes in various human tissues, and some lncRNAs, such as HOTAIR, MALAT-1, H19, HULC, lincRNA-p21 and MEG3, might also function as tumor suppressor genes or oncogenes (1419). Although several published studies have reported lncRNAs such as lncRNA-LSINCT5 and HOST2 in EOC (20,21), to our knowledge, no studies have focused on E2-regulated lncRNAs in EOC.

Therefore, we sought to identify E2-regulated lncRNAs in EOC. We found that E2 stimulation of ERα-positive (ERα+) EOC cells resulted in a panel of differentially expressed lncRNAs, showing great potential to contribute to cancer progression based on bioinformatics analyses. Moreover, we found that some candidate lncRNAs were aberrantly expressed in ERα+ compared to ERα-negative (ERα−) EOC tissues, and their differential expression was associated with certain clinicopathological variables and poor prognosis of ERα+ EOC patients. Our results highlight for the first time the potential use of lncRNAs as causal link with estrogenic effects on EOC progression and as surrogate targets to hormone therapy.

Materials and methods

Cells and treatment

The ovarian cancer cell line SKOV3 was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). SKOV3 cells were routinely maintained in RPMI-1640 medium (Gibco-BRL, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum (FBS; Gibco) and maintained at 37°C with 5% CO2. For the E2 induction experiments, cells (plated at 20–30% confluence) were grown for 3 days in phenol red-free RPMI-1640 (Gibco) containing 5% activated, charcoal-treated foetal bovine serum (Serana, Bunbury, Australia). Next, the cells were treated for 24 h with 10−8 M E2 or vehicle alone (DMSO, 0.01% of final volume) as a control.

RNA extraction and microarray

TRIzol (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from SKOV3 cells with or without 24-h treatment with 10−8 M E2. There were three replicates of each sample; they were purified using an RNeasy Micro kit (cat. #74004; Qiagen GmbH, Hilden, Germany). An Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA) was used to quantify the RNA and evaluate its integrity; the 28S:18S ratio was determined, and an RNA integrity number (RIN) was assigned to each sample. RNA with no evidence of degradation and no signs of DNA contamination (as indicated by an RIN ≥7.0 and a 28S:18S ratio ≥0.7) was processed for further analysis.

The lncRNA and mRNA expression profiles were obtained using the Glue Grant Human Transcriptome (GG-H) Array, which was manufactured by Affymetrix and Stanford University. This array contains 5,869 probes covering 730 non-coding, functional RNAs and 3,292,929 probes covering 27,670 coding genes collected from RefSeq, Ensembl and UCSC Known Genes, based on human genome assembly hg18 (22). The array experiments and computational analysis were performed according to the manufacturer’s instructions (Affymetrix, Santa Clara, CA, USA). Briefly, 0.2 μg of total RNA was amplified and labelled, and 20 μg of labelled cDNA was loaded onto the array. The array was hybridized and washed using the GeneChip® Hybridization, Wash and Stain kit (cat. #900720), Hybridization Oven 645 (cat. #00-0331-220V) and Fluidics Station 450 (cat. #00-0079). The slides were scanned in a GeneChip® Scanner 3000 (cat. #00-00212). The raw data were obtained using Command Console Software 3.1 with the default settings and were processed using Affymetrix Power Tools with Robust Multiarray Analysis (RMA) for background correction, normalization and summarization. Differentially expressed genes [defined as a fold-change ≥1.5 and a P-value <0.05 (t-test)] were selected for further study.

Bioinformatics functional analysis of E2-regulated lncRNAs
Identification of lncRNA-mRNA targeting pairs

Two procedures were performed to search for the target mRNAs of lncRNAs. First, UCSC hg18 (http://genome.ucsc.edu/) was used to predict lncRNA targets. Target genes under cis-regulatory control were defined as genes whose transcription was regulated by lncRNAs in nearby genomic locations (≤10 kbp upstream or downstream) (23). Based on mRNA sequence complementarity and RNA duplex energy prediction, trans-acting target genes were identified using BLAST software in the first round of screening (with the parameter e <1E-5) and RNAplex software for final verification (with the parameter -e −20) (24). Additionally, to improve the accuracy of the target prediction, the predicted lncRNA targets (both cis and trans) were combined with the differentially expressed mRNAs in the profile. The resultant overlapping mRNAs were considered the final putative targets of the differentially expressed lncRNAs. This information formed the basis for determining the lncRNA-mRNA targeting pairs.

Gene ontology (GO) and pathway analysis

For the GO and pathway analyses, the putative targets were initially inputted into the Database for Annotation, Visualization and Integrated Discovery (DAVID, http://david.abcc.ncifcrf.gov/), which searched the GO terms to identify the molecular function represented in the gene profile (25), and then into the database of the Kyoto Encyclopedia of Genes and Genomes (KEGG; http://www.genome.ad.jp/kegg/) to analyze the roles of the targets in molecular pathways (26).

Tissue samples and patient data

The study included 95 patients who underwent surgery for primary ovarian cancer in the Department of Gynecology, Obstetrics and Gynecology Hospital of Fudan University between January 2006 and December 2008. Patients were included based on the availability of tissue and follow-up data. Patients with borderline ovarian tumors or with two or more different malignancies were excluded from the study. None of the patients had received preoperative radiotherapy, chemotherapy or hormonal therapy. All EOC tissue samples were frozen immediately after surgery and stored in liquid nitrogen until use.

Clinical and pathological data of EOC patients were evaluated by reviewing medical charts and the original pathology reports. Staging and grading were evaluated in accordance with the criteria of the International Federation of Gynecologists and Obstetricians (FIGO) and the World Health Organization (WHO). Follow-up data were obtained by reviewing the out patient charts, contacting patients or correspondence. Overall survival (OS) was calculated from the date of surgery until the date of mortality or end of follow-up (January 2013). The present study was approved by the Research Ethics Committee of Fudan University, China. Informed consent was obtained from all the patients.

Immunohistochemistry

The immunohistochemical study of ERα was performed using a standard streptavidin-peroxidase method. The endogenous peroxidase activity was blocked with 3% H2O2 for 10 min. For the antigen retrieval, slides were immersed in 10 mM citrate buffer (pH 6.0) and boiled for 15 min in a microwave oven. Non-specific binding was blocked by 5% normal goat serum for 10 min. The slides were incubated with a 1:50 dilution of monoclonal antibody against ERα (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at 4°C overnight in a moist chamber. The slides were sequentially incubated with biotinylated goat anti-mouse IgG (1:100 dilution; Santa Cruz Biotechnology) and then streptavidin-peroxidase conjugate, each for 30 min at room temperature. Isotope-matched human IgG was used in each case as a negative control. Finally, the 3,5-diaminobenzidine (DAB) Substrate kit (Dako) was used for color development followed by Mayer’s hematoxylin counterstaining. ERα+ cases were defined as tumors with >10% stained nuclei (27).

Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR)

qRT-PCR analysis of lncRNA expression was performed using FastStart Universal SYBR-Green Master (Rox; Roche) and an ABI Prism 7900 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). Briefly, total RNA was extracted from cells and tissues and converted to cDNA using an iScript cDNA Synthesis kit (Bio-Rad Laboratories) according to the manufacturer’s protocol. The PCR amplifications were performed in a 10-μl (total volume) reaction that included 1 μl of cDNA template (~5 ng), 5 μl of FastStart Universal SYBR-Green Master (Rox), 3.6 μl of double-distilled water and 0.2 μl of each pair of forward and reverse primers (Table I; Sangon Biotech Co., Ltd., Shanghai, China). The PCR conditions included an initial denaturation step at 95°C for 10 min and 40 cycles of 95°C for 15 sec and 60°C for 30 sec. All the experiments were performed in triplicate, and all the samples were normalized to GAPDH expression. The expression fold-changes were calculated using the 2−ΔΔCt method.

Table I

Primer sequences of the studied genes.

Table I

Primer sequences of the studied genes.

GenePrimerSequence (5′-3′)
TC1500845F: ACCACGACTCCCAAGAGGTA
R: CAGCTGCGATGGTGAGAACT
TC0101441F: CAAGGCAGGTGAGAACGAGT
R: CTCGACTTAGGGAGCTGCAC
TC0100223F: ATGAGGGCTCTGCTCTATGAATGG
R: GGCTTGTTCAGTGTCTGTTAAGGGT
TC0101686F: GGCTACTTACATGGTCCAGCA
R: TAGCATGGAAAGGACCACTGC
GAPDHF: TGACTTCAACAGCGACACCCA
R: CACCCTGTTGCTGTAGCCAAA

[i] F, forward; R, reverse.

Statistical analysis

The data were processed using SPSS version 16.0 software (SPSS, Inc., Chicago, IL, USA). Comparison of continuous data was analyzed using the Student’s t-test, whereas categorical data was analyzed using the Chi-square test and Fisher’s exact test where appropriate (when the expected frequency was <5). OS curves were plotted according to the Kaplan-Meier method, with the log-rank test applied for comparison. Variables were used in multivariate analysis on the basis of the Cox proportional hazards model. A P-value <0.05 was considered to indicate a statistically significant difference (P<0.05).

Results

Identification of E2-regulated lncRNAs in ERα+ ovarian cancer cells
Identification of E2-regulated lncRNAs in SKOV3 cells

As our previous studies provided evidence that E2 regulated some protein-coding genes in ERα+ ovarian cancer SKOV3 cells (57), we examined whether the expression of any lncRNAs is also regulated by E2 in SKOV3 cells. In the present study, SKOV3 cells were treated with 10−8 M E2 for 24 h, and changes in the lncRNA expression profile were analyzed by performing a microarray. The microarray data indicated that 115 lncRNAs were significantly dysregulated following E2 treatment, including 51 upregulated and 64 downregulated lncRNAs (fold-change ≥1.5, P<0.05; data not shown). The top ten relative increased and decreased E2-regulated lncRNAs are listed in Table II.

Table II

The top ten relative increased and decreased E2-regulated lncRNAs in SKOV3 cells.

Table II

The top ten relative increased and decreased E2-regulated lncRNAs in SKOV3 cells.

Annotations

Probeset_idRegulatedFold-change (E2/control)SeqnameStartEndStrand
TC0500815Upregulated3.419413635chr510431431050457
TC0101441Upregulated3.275356271chr1202377159202378011+
TC0901107Upregulated3.269435942chr98987117089871958
TC0301101Upregulated3.258219523chr33782519937878275
TC1900181Upregulated3.247328231chr191082007810841404+
TC1201706Upregulated3.232226492chr12131237621131240193
TC0601086Upregulated3.186614845chr62980235929824805
TC1500845Upregulated3.183351441chr153877337638774597
TC0300769Upregulated3.143316689chr3169450147169514658+
TC0X00076Upregulated2.989272086chrX1882124418823011+
TC0501141Downregulated0.300418806chr59064259490645975
TC1201365Downregulated0.301520979chr126455692264561625
TC0101686Downregulated0.30390326chr1244341256244343791+
TC1200811Downregulated0.31213872chr12125146739125152812+
TC0300928Downregulated0.318626574chr3197148023197150980+
TC1900906Downregulated0.325966672chr196149914061513631+
TC0801241Downregulated0.328971081chr8128289293128300515
TC1400428Downregulated0.333717978chr148888636988900796+
TC0201596Downregulated0.335402449chr26987084069879634
TC0100223Downregulated0.342972038chr12146557021466331+

To confirm the microarray findings, we examined the expression of four lncRNAs selected from the top ten relative increased and decreased E2-regulated lncRNAs using qRT-PCR. The results revealed that the expression levels of TC0100223 and TC0101686 were significantly downregulated by E2, whereas TC1500845 and TC0101441 were significantly upregulated by E2 in SKOV3 cells, consistent with the microarray results (Fig. 1).

Putative targets of E2-regulated lncRNAs and their functional analysis

Based on the overlap between the targets predicted by bioinformatics and the differentially expressed mRNAs detected in the microarray, we constructed 55 E2-regulated lncRNA-target mRNA pairs (Table III). The GO (Fig. 2) and pathway (Table IV) analyses showed that a set of E2-regulated lncRNAs that mapped to the target mRNAs were correlated with several cellular processes and pathways known to be related to cancer progression, such as cell cycle and proliferation, developmental processes, cell adhesion, cell death, MAPK signaling, Hedgehog signaling, Jak-STAT signaling and cancer pathways, suggesting their great potential to contribute to cancer progression.

Table III

lncRNA-target mRNA pairs regulated by E2 in SKOV3 cells.

Table III

lncRNA-target mRNA pairs regulated by E2 in SKOV3 cells.

Information of lncRNAslncRNA-mRNA pairsInformation of mRNAs



StartEndStrandSeqnamelncRNA Probeset_idmRNA SymbolTypeStartEndStrandSeqname
4382171843827655+chr20TC2000321CD40cis4418031344366257+chr20
4382171843827655+chr20TC2000321UBE2Ccis4387466243879003+chr20
6331078763321606chr19TC1901868ZNF544cis6343209263480673+chr19
6331078763321606chr19TC1901868ZSCAN4cis6287211562882317+chr19
6331078763321606chr19TC1901868ZNF417cis6311005363119796chr19
6331078763321606chr19TC1901868ZNF460cis6248367062496635+chr19
6149914061513631+chr19TC1900906ZNF460cis6248367062496635+chr19
1082007810841404+chr19TC1900181CDC37cis1036280910375271chr19
1082007810841404+chr19TC1900181QTRT1cis1067310610805160+chr19
7592598175926392+chr17TC1700826KIAA1618cis7584926275925295+chr17
2973836229740074chr16TC1600989QPRTcis2959785929616810+chr16
7015745570163889+chr16TC1600575LOC652737cis6939879169457733chr16
3877337638774597chr15TC1500845TYRO3cis3963852439658826+chr15
3877337638774597chr15TC1500845IVDcis3848497838515438+chr15
6775113367757033+chr15TC1500441PAQR5cis6737834867486098+chr15
2137926221379796+chr14TC1400062ABHD4cis2213698622151097+chr14
1159945611603583+chr12TC1200137TAS2R7cis1084539910846493chr12
71541707159091+chr12TC1200076CDCA3cis68242246830686chr12
71541707159091+chr12TC1200076CLSTN3cis71742347202795+chr12
71541707159091+chr12TC1200076ING4cis66297076642565chr12
71541707159091+chr12TC1200076PTPN6cis69260016940741+chr12
69666127033762+chr12TC1200074CDCA3cis68242246830686chr12
69666127033762+chr12TC1200074CLSTN3cis71742347202795+chr12
69666127033762+chr12TC1200074ING4cis66297076642565chr12
69666127033762+chr12TC1200074PTPN6cis69260016940741+chr12
53835895384883+chr12TC1200045NTF3cis54735275474725+chr12
5845769258582501chr11TC1101435STX3cis5927910859326752+chr11
1882124418823011+chrXTC0X00076GPR64cis1891734819050676chrX
6645084766456323chr9TC0900981PIK3C2Btrans2.03E+08202730566chr1
1226436712270292+chr8TC0800087DLC1cis1298524313506486chr8
1226436712270292+chr8TC0800087CTSBcis1173744211763147chr8
1.28E+081.28E+08chr7TC0701620OPN1SWcis1.28E+08128203087chr7
1.28E+081.28E+08chr7TC0701620TSPAN33cis1.29E+08128595907+chr7
1.28E+081.28E+08chr7TC0701620SMOcis1.29E+08128640619+chr7
1.42E+081.42E+08+chr7TC0700794TAS2R5cis1.41E+08141137635+chr7
1.4E+081.41E+08+chr7TC0700753TAS2R5cis1.41E+08141137635+chr7
2980235929824805chr6TC0601086KIAA1949cis3075214630763651chr6
1.5E+081.5E+08chr5TC0501415TNIP1cis1.5E+08150446914chr5
1.5E+081.5E+08chr5TC0501415SLC36A1cis1.51E+08150852132+chr5
1.5E+081.5E+08chr5TC0501415ANXA6cis1.5E+08150517636chr5
1.5E+081.5E+08chr5TC0501415CCDC69cis1.51E+08150583899chr5
10431431050457chr5TC0500815LPCAT1cis15145441577092chr5
1.15E+081.15E+08chr4TC0401208ARSJcis1.15E+08115120306chr4
3782519937878275chr3TC0301101XYLBcis3836324438431471+chr3
1.35E+081.35E+08+chr3TC0300635AMOTL2cis1.36E+08135576450chr3
1.24E+081.24E+08+chr3TC0300552STXBP5Lcis1.22E+08122621336+chr3
1.14E+081.14E+08+chr2TC0200609PAX8cis1.14E+08113752969chr2
2.46E+082.46E+08chr1TC0103436ZNF670cis2.45E+08245308738chr1
2.44E+082.44E+08+chr1TC0101686ZNF670cis2.45E+08245308738chr1
2.02E+082.02E+08+chr1TC0101441PIK3C2Bcis2.03E+08202730566chr1
2.02E+082.02E+08+chr1TC0101441ATP2B4cis2.02E+08201979832+chr1
5356649353569511+chr1TC0100566C1orf163cis5292509652936964chr1
5356649353569511+chr1TC0100566CC2D1Bcis5258885552604453chr1
2146557021466331+chr1TC0100223ECE1cis2141766421544621chr1
2146557021466331+chr1TC0100223RAP1GAPcis2179530121868437chr1

Table IV

Target mRNA-related pathways in SKOV3 cells.

Table IV

Target mRNA-related pathways in SKOV3 cells.

TermCountGenes
Pentose and glucuronate interconversions1XYLB
Valine, leucine and isoleucine degradation1IVD
Inositol phosphate metabolism1PIK3C2B
Nicotinate and nicotinamide metabolism1QPRT
Metabolic pathways4IVD, QPRT, XYLB, PIK3C2B
MAPK signaling pathway1NTF3
Phosphatidylinositol signaling system1PIK3C2B
Ubiquitin mediated proteolysis1UBE2C
SNARE interactions in vesicular transport1STX3
Hedgehog signaling pathway1SMO
Adherens junction1PTPN6
Jak-STAT signaling pathway1PTPN6
Natural killer cell mediated cytotoxicity1PTPN6
T cell receptor signaling pathway1PTPN6
B cell receptor signaling pathway1PTPN6
Neurotrophin signaling pathway1NTF3
Pathways in cancer1SMO
Basal cell carcinoma1SMO
Expression of several candidate lncRNAs in ERα+ EOC tissues

In order to confirm the potential of some E2-regulated lncRNAs to contribute to cancer progression, we initially selected the four lncRNAs (TC0100223, TC0101686, TC1500845 and TC0101441) as candidates and tested their expression levels in EOC tissues. Considering the fact that ERα is the main form expressed in malignant ovarian tumors and as ERα has been reported to promote poor prognosis in EOC patients (28,29), we determined whether the expression of in vitro E2-regulated lncRNAs, detected in ERα+ ovarian cancer cells, could discriminate between ERα+ and ERα− EOC tissues. Based on the qRT-PCR assay, we found that ERα+ tissues had lower expression of TC0100223 and TC0101686 and higher expression of TC0101441 (Fig. 3, ERα+, n=64 vs. ERα−, n=31, P<0.01; Fig. 3A shows the representative immunohistochemistry results of ERα expression in EOC tissues). In contrast, TC1500845 was not differentially expressed between ERα+ and ERα− EOC tissues. These results may be suggestive of the potential clinical significance of TC0100223, TC0101686 and TC0101441 in ERα+ EOC.

Association of lncRNA expression with clinicopathological characteristics in ERα+ EOC

According to the median value which was used as the cut-off (30), specific lncRNA expression in ERα+ EOC tissues, equal or more than median value was defined as high lncRNA group, and less than median value was defined as low lncRNA group. As shown in Table V, low-expression of TC0100223 and TC0101686 and high-expression of TC0101441 were closely related to ERα+ EOC tissues with advanced FIGO stage and/or high histological grade (P<0.05), suggesting that aberrant expression of the three candidate lncRNAs is associated with a more malignant ovarian cancer phenotype.

Table V

Association of lncRNA expression with clinicopathological variables in ERα-positive EOC patients.

Table V

Association of lncRNA expression with clinicopathological variables in ERα-positive EOC patients.

High TC0101441 expressionLow TC0100223 expressionLow TC0101686 expression



VariablesCases (N)n (%)P-valuen (%)P-valuen (%)P-value
Age (years)
 <502514 (56.0)0.44210 (40.0)0.215 (60.0)0.2
 ≥503918 (46.2)22 (56.4)17 (43.6)
Histological subtype
 Serous4923 (46.9)0.37624 (49.0)0.76822 (44.9)0.14
 Other159 (60.0)8 (53.3)10 (66.7)
FIGO stage
 I–II245 (20.8)<0.0018 (33.3)0.0397 (29.2)0.01
 III–IV4027 (67.5)24 (60.0)25 (62.5)
Histological grade
 G1–G2276 (22.2)<0.0019 (33.3)0.02311 (40.7)0.206
 G33726 (70.3)23 (62.2)21 (56.8)
Ascites
 >1002011 (55.0)0.597 (35.0)0.10612 (60.0)0.281
 ≥1004421 (47.7)25 (56.8)20 (45.5)
Association of lncRNA expression with prognosis of ERα+ EOC patients

We investigated whether the expression of TC0100223, TC0101686 and TC0101441 correlated with the postoperative survival of ERα+ EOC patients. Among the 64 ERα+ EOC patients, 38 died during follow-up. In univariate analysis, OS was associated with the FIGO stage, histological grade and expression of TC0100223 and TC0101441 (P<0.05; Table VI). Multivariate analysis further confirmed that high TC0101441 expression, advanced FIGO stage and high histological grade were independent factors for evaluation of OS in ERα+ EOC patients (P<0.05, Table VI; Fig. 4 shows the OS curves according to TC0101441 expression). Thus, it was concluded that of the three candidate lncRNAs, TC0101441 could be used as an independent prognostic factor for OS of ERα+ EOC patients.

Table VI

Univariate analysis for overall survival in ERα-positive EOC patients.

Table VI

Univariate analysis for overall survival in ERα-positive EOC patients.

Univariate analysisMultivariate analysis


Overall survivalOverall survival


VariablesMean ± SE (months)P-valueβSEWaldP-valueExp (β)95% CI
Age (years)
 <5045.52±4.210.939------
 ≥5047.49±3.98------
Histological subtype
 Serous45.99±3.530.496------
 Other52.30±5.71------
FIGO stage
 I–II69.63±2.42------
 III–IV33.03±2.73<0.0012.3050.63513.168<0.00110.0222.886–34.803
Histological grade
 G1–G264.81±2.97------
 G332.62±2.90<0.0010.9910.4814.2380.042.6931.049–6.915
Ascites
 <10044.71±5.950.77------
 ≥10048.67±3.48------
TC0101686 expression
 Low44.45±4.230.325------
 High50.32±4.28------
TC0100223 expression
 Low37.48±3.480.018------
 High54.40±3.990.0190.3520.0030.9570.9810.492–1.956
TC0101441 expression
 Low60.88±3.48------
 High32.16±3.04<0.0010.8170.4024.1220.0422.2631.029–4.979

[i] β, regression coefficient; SE, standard error; CI, confidence interval.

Discussion

In the present study, we identified a series of differentially expressed E2-regulated lncRNAs in ERα+ ovarian cancer SKOV3 cells using a microarray. Bioinformatics functional analyses indicated that a fraction of these lncRNAs had the potential to contribute to cancer progression. Furthermore, in order to confirm that some E2-regulated lncRNAs are related to the development of ERα+ EOC, we tested the expression of several candidate lncRNAs in EOC tissues. The results showed that some candidate lncRNAs were aberrantly expressed in ERα+ compared to ERα− EOC tissues, and their differential expression was associated with certain clinicopathological variables and poor prognosis of ERα+ EOC. To the best of our knowledge, this is the first study to report E2-regulated lncRNAs in ERα+ EOC, the results of which may provide insight into the estrogenic effects on EOC progression and the design of new target therapies based on a perspective of lncRNA.

It is known that the ovary is a main source and target tissue of E2 in women. The action of E2 on ovarian tissue is believed to be mediated by the two ERs, ERα and ERβ. ERβ is highly expressed in normal epithelial ovarian cells and benign tumors, whereas ERα is expressed to a much greater extent in malignant ovarian tumors (28). Several studies thus far have revealed the contributions to EOC progression by multiple E2/ERα-regulated target protein-coding genes, such as cyclin D1 and c-myc (which are involved in cellular growth control) and fibulin-1 and cathepsin-D (which are involved in cellular motility and invasion) (10,11). Our previous studies also showed that E2 promoted metastasis and invasion in ERα+ ovarian cancer SKOV3 cells by regulating HIF-1, nm23-H1, E-cadherin and MMP-2 (57). Despite these protein-coding genes, however, the exact effects of E2 on EOC development remain unclear. In the present study, we identified 115 E2-regulated lncRNAs in ERα+ SKOV3 cells using a microarray, and subsequent bioinformatics analyses indicated that a subset of these lncRNAs had the potential to contribute to cancer progression. These findings may extend our current knowledge regarding E2 regulation of protein-coding genes in EOC progression to include lncRNAs.

lncRNAs, initially argued to be spurious transcriptional noise, are emerging as new regulators in the cancer paradigm. Misregulation of lncRNAs has been documented in many types of human cancer. For example, DDC and PCGEM are overexpressed in prostate cancer compared to normal prostate tissue, implicating their roles in tumorigenesis (31,32). Increased expression of MALAT1 indicates a poorer clinical outcome of lung cancer patients (15). HOTAIR is overexpressed in primary breast tumors and metastases, and elevated HOTAIR expression is an indispensable predictor of eventual metastasis and mortality (14). Inspired by these lines of evidence of lncRNA roles in cancer biology, we hypothesized that certain E2-regulated lncRNAs detected in SKOV3 cells in the current study may also have the potential to contribute to EOC progression. To address this hypothesis, we initially tested two upregulated (TC1500845 and TC0101441) and two downregulated lncRNAs (TC0100223 and TC0101686) in EOC tissues, the results of which showed a significant correlation of overexpressed TC0101441 and low-expressed TC0100223 and TC0101686 with ERα+ compared to ERα− EOC. Moreover, low-expression of TC0100223 and TC0101686 and overexpression of TC0101441 were found to be related to ERα+ EOC tissues with advanced FIGO stage and/or high histological grade. Most importantly, multivariate survival analysis revealed that TC0101441 was an independent prognostic factor for overall survival. Taken together, our findings suggest that the aberrant expression of certain E2-regulated lncRNAs is associated with malignant cancer phenotypes and poor clinical outcome of ERα+ EOC patients. Hence, these results may also lead us to consider that E2-regulated lncRNAs can be used as candidate biomarkers for EOC prognosis and therapy. Clearly, further studies are required to elucidate the roles and mechanisms by which these lncRNAs promote EOC development in detail.

In conclusion, the present study provided the first evidence that E2 can modulate a panel of lncRNAs in ERα+ EOC cells. Some aberrantly expressed lncRNAs, including TC0100223, TC0101686 and TC0101441, are correlated with the advanced cancer phenotypes. Of note, TC0101441 was an independent factor for poor prognosis of ERα+ EOC patients. Collectively, encouraged by the involvement of these E2-regulated lncRNAs in ERα+ EOC progression, our data highlight the utility of considering lncRNA expression in the future understanding of estrogenic effects on EOC progression and in the design of new target therapies.

Acknowledgements

The authors are grateful to the department managers who provided the microarray services at the National Engineering Center for Biochip at the Shanghai Biotechnology Corporation. The project described was supported by a Grant Number 81370689 from the National Natural Science Foundation of China.

References

1 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar

2 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2012. CA Cancer J Clin. 62:10–29. 2012. View Article : Google Scholar

3 

Tsilidis KK, Allen NE, Key TJ, Dossus L, Kaaks R, Bakken K, Lund E, Fournier A, Dahm CC, Overvad K, Hansen L, Tjønneland A, Rinaldi S, Romieu I, Boutron-Ruault MC, Clavel-Chapelon F, Lukanova A, Boeing H, Schütze M, Benetou V, Palli D, Berrino F, Galasso R, Tumino R, Sacerdote C, Bueno-de-Mesquita HB, van Duijnhoven FJ, Braem MG, Onland-Moret NC, Gram IT, Rodríguez L, Duell EJ, Sánchez MJ, Huerta JM, Ardanaz E, Amiano P, Khaw KT, Wareham N and Riboli E: Menopausal hormone therapy and risk of ovarian cancer in the European prospective investigation into cancer and nutrition. Cancer Causes Control. 22:1075–1084. 2011. View Article : Google Scholar

4 

Park SH, Cheung LW, Wong AS and Leung PC: Estrogen regulates snail and slug in the down-regulation of E-cadherin and induces metastatic potential of ovarian cancer cells through estrogen receptor alpha. Mol Endocrinol. 22:2085–2098. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Hua K, Din J, Cao Q, Feng W, Zhang Y, Yao L, Huang Y, Zhao Y and Feng Y: Estrogen and progestin regulate HIF-1α expression in ovarian cancer cell lines via the activation of Akt signaling transduction pathway. Oncol Rep. 21:893–898. 2009.

6 

Hua K, Feng W, Cao Q, Zhou X, Lu X and Feng Y: Estrogen and progestin regulate metastasis through the PI3K/AKT pathway in human ovarian cancer. Int J Oncol. 33:959–967. 2008.PubMed/NCBI

7 

Ding JX, Feng YJ, Yao LQ, Yu M, Jin HY and Yin LH: The reinforcement of invasion in epithelial ovarian cancer cells by 17β-estradiol is associated with upregulation of Snail. Gynecol Oncol. 103:623–630. 2006.PubMed/NCBI

8 

Spillman MA, Manning NG, Dye WW, Sartorius CA, Post MD, Harrell JC, Jacobsen BM and Horwitz KB: Tissue-specific pathways for estrogen regulation of ovarian cancer growth and metastasis. Cancer Res. 70:8927–8936. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Laviolette LA, Garson K, Macdonald EA, Senterman MK, Courville K, Crane CA and Vanderhyden BC: 17β-estradiol accelerates tumor onset and decreases survival in a transgenic mouse model of ovarian cancer. Endocrinology. 151:929–938. 2010.

10 

Twal WO, Czirok A, Hegedus B, Knaak C, Chintalapudi MR, Okagawa H, Sugi Y and Argraves WS: Fibulin-1 suppression of fibronectin regulated cell adhesion and motility. J Cell Sci. 114:4587–4598. 2001.PubMed/NCBI

11 

Rochefort H, Chalbos D, Cunat S, Lucas A, Platet N and Garcia M: Estrogen regulated proteases and antiproteases in ovarian and breast cancer cells. J Steroid Biochem Mol Biol. 76:119–124. 2001. View Article : Google Scholar : PubMed/NCBI

12 

Wilusz JE, Sunwoo H and Spector DL: Long noncoding RNAs: functional surprises from the RNA world. Genes Dev. 23:1494–1504. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Nagano T and Fraser P: No-nonsense functions for long noncoding RNAs. Cell. 145:178–181. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, Tsai MC, Hung T, Argani P, Rinn JL, Wang Y, Brzoska P, Kong B, Li R, West RB, van de Vijver MJ, Sukumar S and Chang HY: Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 464:1071–1076. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Tano K, Mizuno R, Okada T, Rakwal R, Shibato J, Masuo Y, Ijiri K and Akimitsu N: MALAT-1 enhances cell motility of lung adenocarcinoma cells by influencing the expression of motility-related genes. FEBS Lett. 584:4575–4580. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Matouk IJ, DeGroot N, Mezan S, Ayesh S, Abu-lail R, Hochberg A and Galun E: The H19 non-coding RNA is essential for human tumor growth. PLoS One. 2:e8452007. View Article : Google Scholar : PubMed/NCBI

17 

Du Y, Kong G, You X, Zhang S, Zhang T, Gao Y, Ye L and Zhang X: Elevation of highly up-regulated in liver cancer (HULC) by hepatitis B virus X protein promotes hepatoma cell proliferation via down-regulating p18. J Biol Chem. 287:26302–26311. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Huarte M, Guttman M, Feldser D, Garber M, Koziol MJ, Kenzelmann-Broz D, Khalil AM, Zuk O, Amit I, Rabani M, Attardi LD, Regev A, Lander ES, Jacks T and Rinn JL: A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response. Cell. 142:409–419. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Zhou Y, Zhang X and Klibanski A: MEG3 noncoding RNA: a tumor suppressor. J Mol Endocrinol. 48:R45–R53. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Silva JM, Boczek NJ, Berres MW, Ma X and Smith DI: LSINCT5 is over expressed in breast and ovarian cancer and affects cellular proliferation. RNA Biol. 8:496–505. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Rangel LB, Sherman-Baust CA, Wernyj RP, Schwartz DR, Cho KR and Morin PJ: Characterization of novel human ovarian cancer-specific transcripts (HOSTs) identified by serial analysis of gene expression. Oncogene. 22:7225–7232. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Xu W, Seok J, Mindrinos MN, Schweitzer AC, Jiang H, Wilhelmy J, Clark TA, Kapur K, Xing Y, Faham M, Storey JD, Moldawer LL, Maier RV, Tompkins RG, Wong WH, Davis RW and Xiao W: Human transcriptome array for high-throughput clinical studies. Proc Natl Acad Sci USA. 108:3707–3712. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Jia H, Osak M, Bogu GK, Stanton LW, Johnson R and Lipovich L: Genome-wide computational identification and manual annotation of human long noncoding RNA genes. RNA. 16:1478–1487. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Tafer H and Hofacker IL: RNAplex: a fast tool for RNA-RNA interaction search. Bioinformatics. 24:2657–2663. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Dennis G Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC and Lempicki RA: DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol. 4:P32003. View Article : Google Scholar : PubMed/NCBI

26 

Zhang C, Han L, Zhang A, Yang W, Zhou X, Pu P, Du Y, Zeng H and Kang C: Global changes of mRNA expression reveals an increased activity of the interferon-induced signal transducer and activator of transcription (STAT) pathway by repression of miR-221/222 in glioblastoma U251 cells. Int J Oncol. 36:1503–1512. 2010.PubMed/NCBI

27 

Yang XY, Xi MR, Yang KX and Yu H: Prognostic value of estrogen receptor and progesterone receptor status in young Chinese ovarian carcinoma patients. Gynecol Oncol. 113:99–104. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Pujol P, Rey JM, Nirde P, Roger P, Gastaldi M, Laffargue F, Rochefort H and Maudelonde T: Differential expression of estrogen receptor-α and -β messenger RNAs as a potential marker of ovarian carcinogenesis. Cancer Res. 58:5367–5373. 1998.

29 

Darb-Esfahani S, Wirtz RM, Sinn BV, Budczies J, Noske A, Weichert W, Faggad A, Scharff S, Sehouli J, Oskay-Ozcelik G, Zamagni C, De Iaco P, Martoni A, Dietel M and Denkert C: Estrogen receptor 1 mRNA is a prognostic factor in ovarian carcinoma: determination by kinetic PCR in formalin-fixed paraffin-embedded tissue. Endocr Relat Cancer. 16:1229–1239. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Yuan SX, Yang F, Yang Y, Tao QF, Zhang J, Huang G, Yang Y, Wang RY, Yang S, Huo XS, Zhang L, Wang F, Sun SH and Zhou WP: Long noncoding RNA associated with microvascular invasion in hepatocellular carcinoma promotes angiogenesis and serves as a predictor for hepatocellular carcinoma patients’ poor recurrence-free survival after hepatectomy. Hepatology. 56:2231–2241. 2012.PubMed/NCBI

31 

Bussemakers MJ, van Bokhoven A, Verhaegh GW, Smit FP, Karthaus HF, Schalken JA, Debruyne FM, Ru N and Isaacs WB: DD3: a new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res. 9:5975–5979. 1999.PubMed/NCBI

32 

Srikantan V, Zou Z, Petrovics G, Xu L, Augustus M, Davis L, Livezey JR, Connell T, Sesterhenn IA, Yoshino K, Buzard GS, Mostofi FK, McLeod DG, Moul JW and Srivastava S: PCGEM1, a prostate-specific gene, is overexpressed in prostate cancer. Proc Natl Acad Sci USA. 97:12216–12221. 2000. View Article : Google Scholar

Related Articles

Journal Cover

April 2014
Volume 31 Issue 4

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Qiu, J., Ye, L., Ding, J., Feng, W., Jin, H., Zhang, Y. ... Hua, K. (2014). Expression and clinical significance of estrogen‑regulated long non-coding RNAs in estrogen receptor α-positive ovarian cancer progression. Oncology Reports, 31, 1613-1622. https://doi.org/10.3892/or.2014.3000
MLA
Qiu, J., Ye, L., Ding, J., Feng, W., Jin, H., Zhang, Y., Li, Q., Hua, K."Expression and clinical significance of estrogen‑regulated long non-coding RNAs in estrogen receptor α-positive ovarian cancer progression". Oncology Reports 31.4 (2014): 1613-1622.
Chicago
Qiu, J., Ye, L., Ding, J., Feng, W., Jin, H., Zhang, Y., Li, Q., Hua, K."Expression and clinical significance of estrogen‑regulated long non-coding RNAs in estrogen receptor α-positive ovarian cancer progression". Oncology Reports 31, no. 4 (2014): 1613-1622. https://doi.org/10.3892/or.2014.3000