Reduced expression of semaphorin 4D and plexin-B in breast cancer is associated with poorer prognosis and the potential linkage with oestrogen receptor

  • Authors:
    • Muhammad Faraz Arshad Malik
    • Lin Ye
    • Wen G. Jiang
  • View Affiliations

  • Published online on: May 28, 2015     https://doi.org/10.3892/or.2015.4015
  • Pages: 1049-1057
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Involvement of semaphorin 4D (Sema4D) and the receptor proteins of the plexins B family (plexin-B1, -B2 and -B3) in solid tumours suggests they play a role in breast cancer. In the present study, the expression of Sema4D and plexin-Bs was examined in a breast cancer cohort. The expression of Sema4D and plexin-Bs was examined in 147 tumours together with 22 normal mammary tissues using quantitative PCR along with clinicopathological patient data, as well as in MCF-7 and MDA-MB-231 cell lines treated with selective oestrogen receptor modulators (SERMs). The expression of Sema4D, plexin-B1 and -B2 was markedly reduced in tumours with local recurrence, compared to the patients that remained disease-free. The reduced Sema4D expression was associated with poorer disease-free survival (median, 111.6 months, 95% CI, 96.5-126.7), compared to the patients with a higher expression (median, 144.0 months; 95% CI, 130.8-157.3; p=0.033). A reduced expression of plexin‑B1 was observed in tumours with poorer differentiation and was associated with poorer overall and disease‑free survival. No similar association was identified in relation to plexin‑B2 and -B3. A higher expression of Sema4D and plexin‑B1 was observed in the ERα-positive tumours compared to the ERα-negative tumours. The expression of these molecules was largely regulated in breast cancer cells exposed to SERMs. A decreased expression of Sema4D, plexin‑B1 and -B2 was associated with local recurrence and poor prognosis. Response to SERMs indicated potential perspectives of these molecules in clinical assessment and management of diseases.

Introduction

Breast cancer is a heterogeneous disease influenced by genetic and environmental factors (1). Tumour metastasis is regulated by a set of non-randomized events, starting from loss of cancer cells adhesion at the primary site, local invasion, intravasation, survival in circulation, extravasation and colonisation at distant sites. The nervous and vascular system share several anatomical and developmental similarities as these systems are combined in neurovascular bundles and in peripheral tissues. Notably, these shared developmental links also assist scientists to speculate the involvement of certain molecules controlling growth and migration of nerves in cancer cell proliferation, differentiation and dissemination (2,3). Apart from acting as axonal guidance cues, the involvement of semaphorins and plexins in altering the cytoskeleton, organization of actin filaments and microtubule networks in non-neural systems has also been observed (4,5).

Semaphorins are classified as secreted, transmembrane or glycosylphosphatidylinositol-linked proteins containing a phylogenetically conserved extracellular ‘sema’ domain. These molecules are further delineated into eight classes, of which classes 3–7 are present in vertebrates (6). Plexins are transmembrane protein receptors for semaphorins grouped further under A to D categories. Previously, the two families were initially identified as axon guidance cues in the nervous system and were later found to be involved in other systems including vascular, reproductive and immune systems (4,79).

Aberrant expression of these molecules was also associated with different diseases. For example, mutations of plexin-A2 and Sema3D have been observed in schizophrenia and anxiety (10,11). Similarly, involvement of semaphorin 4D (Sema4D) and plexin-B1 in the perineural invasion of tumour cells and angiogenesis has been established (12). Sema4D also termed CD100, constitutes 863 amino acids containing a transmembrane, an immunoglobulin (Ig)-like and a sema domain (13). Apart from their role in axonal guidance, Sema4D and plexin-B1 interactions have also been found to be responsible for T-cell proliferation (14) and B-cell survival and aggregation (15). A higher expression of Sema4D has been observed in T cells while its lowest level is evident in mature B cells, macrophages and dendritic cells (6). P1exin-B1, a transmembrane protein is present on plasma membrane in the majority of cell types and acts as a binding receptor for Sema4D (6,17). Plexin-B2 and -B3 are the binding receptors for Sema4C and Sema5A, respectively (1820). Altered expression patterns of these molecules have been observed in different types of tumours, as well as various cancer cell lines. Cancer cell proliferation and tumour-related angiogenesis may vary to a greater extent under the influence of these molecules.

Increased Sema4D and plexin-B1 expression in pancreatic ductal adenocarcinoma patients is correlated with lymph node involvement and metastasis (21). Similarly, in soft tissue sarcoma patients the elevated expression of Sema4D is associated with an increased mitotic division of cancer cells. Higher Sema4D levels are correlated with poorer overall and disease-free survival (22). Mammary cancer cell proliferative, angiogenic and metastatic abilities were well compromised under Sema4D knockout. A role for Sema4D as an oncogene responsible for invasiveness, metastasis and angiogenesis progression in mammary cell lines (66cl4, 4T1 and 168FARN) was also established (23). However, a significant effect of Sema4D as a guardian against metastatic progression has also been observed in a mammary tumour cohort (24). Contrasting findings regarding the expression profile of Sema4D and the plexin-B family in relation to different types of tumours have also been reported. For example, an increased Sema4D and plexin-B1 expression has also been observed in prostate (2527), cervical (28), and breast and ovarian cancers (29). A combined effect of increased plexin-B1 along with c-Met was associated with poor cell differentiation and higher lymph node metastasis. The co-expression of the two proteins was correlated with unfavourable outcomes according to a study of 50 breast and ovarian neoplasms using immunohistochemistry and immunofluorescence staining (29). The interactions among Sema4D, plexin-B1 and Met were also responsible for triggering tumour invasive growth and metastasis (25). However, in renal and breast cancer patients, a reduced expression of plexin-B1 was observed in relation to disease progression (3032). Plexin-B2 also shares a structural homology with plexin-B1 and its interaction with Sema4D has also been established (33).

In the present study, the expression profile of these molecules (Sema4D, plexin-B1, -B2 and -B3) was examined in a breast cancer cohort. The aim of the present study was to provide a thorough insight into the expression profiles of these molecules and their association with breast cancer progression, disease stage, cell differentiation, nodular involvement, local recurrence and bone metastasis.

Materials and methods

Collection of breast cancer specimens

Mammary tissue samples (n=169) were collected immediately after surgery and stored at −80°C until further use, with prior approval from the local Ethics Committee. Breast cancer tissues (n=147) and background normal breast tissues (n=22) were verified by a consultant pathologist. A routine follow-up was carried out after surgery with a median follow-up period of 120 months. A higher incidence of ductal carcinoma tissues was observed in this cohort. Grading along with Nottingham prognostic index (NPI) values were evaluated by independent histologists aided with clinical and laboratory reports. Data regarding cohort are provided in Table I.

Table I

Expression of Sema4D, plexin-B in breast cancer cohort.

Table I

Expression of Sema4D, plexin-B in breast cancer cohort.

Clinicopathological statusNo.Transcripts (copies/μl, mean ± SD)
Sema4DPlexin-B1Plexin-B2Plexin-B3
Tissue samples
 Normal2229.4±22.43235±1906167±1230.701±0.292
 Tumour14724.82±4.792548±976178.2±421.910±0.424
Tumour grade
 12118.19±6.3112111±5204137.8±67.50.316±0.137
 24318.82±6.73664±530a149.5±38.72.624±0.989a
 35831.79±8.58602±262a220.2±81.42.023±0.520a
TNM staging
 I7029.77±6.994544±1793179.7±35.82.041±0.649
 II4015.99±5.22376±200a104.2±32.42.018±0.746
 III711.44±5.8466.9±32.2a80.7±64.50.806±0.224
 IV412.8±12.214.44±8.56a28±18.0a0.807±0.694
NPI (score)
 1 (<3.4)6620.40±6.632708±1678107.2±27.81.801±0.603
 2 (3.4–5.4)3828.68±6.562861±1489201.9±48.51.451±0.600
 3 (>5.4)1638.0±20.31903±1311439±2753.80±1.64
Clinical outcomes
 Disease-free9028.11±6.273262±1358200.1±57.61.737±0.438
  With metastases73.77±2.86a714±68162.8±48.27.08±4.31
  With local recurrence53.12±2.14a162±102a16.5±10.6a0.951±0.761
 Died of breast cancer1626.6±10.3645±463261.4±72.71.613±0.670
 Poor prognosis2816.44±6.19565±301160.8±46.02.96±1.26

a P<0.05. Sema4D, semaphorin 4D; TNM, tumor-node-metastasis; NPI, Nottingham prognostic index.

Tissue processing and extraction of RNA and generation of cDNA

Approximately 20 sections from each tissue sample were homogenised in an RNA extraction solution using a hand held homogeniser for RNA isolation. RNA quantification was carried out using a UV spectrophotometer (WPA UV 1101; Biotech Photometer, Cambridge, UK). Reverse transcription (RT) was performed from 1 μg of total RNA using a Reverse Transcription kit (AbGene Laboratories, Essex, UK).

Conventional PCR

The quality of generated cDNA was verified using GAPDH primers (Table II). Reaction conditions started with an initial denaturation of 5 min at 94°C followed by 35 cycles of 10 sec at 94°C, 30 sec at 55°C for annealing and 30 sec at 72°C, with a final elongation of 72°C for 10 min. Thermal cyclers used in this regard were obtained from Perkin-Elmer, Surrey, UK. Amplified products were then separated on a 2% agarose gel and visualized under ultraviolet light following ethidium bromide staining.

Table II

Primer sequences used in the present study.

Table II

Primer sequences used in the present study.

GeneSense primers (5′-3′)Antisense primers (5′-3′)
Sema4D ctcagcagggaacaagact actgaacctgaccgtacactccagctctgcatcatc
Plexin-B1 gaggtggcctacatcgag actgaacctgaccgtacagtggtctgagccacagg
Plexin-B2 gaagacaccatccacatc actgaacctgaccgtacaatgcacgtcaaagatgaag
Plexin-B3 ctcaacctgggcatcag actgaacctgaccgtacaggctcgcagtacaggtg
GAPDH ggctgcttttaactctggta gactgtggtcatgagtcctt
GAPDH (q-PCR) ctgagtacgtcgtggagtc actgaacctgaccgtacagagatgatgacccttttg
Quantitative PCR

This study was based on the Ampliflour™ technology which was performed using the StepOne™ system (Applied Biosystems, Foster City, CA, USA). The methodology for this study has previously been optimized to quantify the transcript copy number in the mammary carcinoma specimens, as previously reported (34). Briefly, a set of standards along with the negative controls were included in this study. Beacon Designer software (Premier Biosoft International, Palo Alto, CA, USA) was used to design the primer pairs provided in Table II. A short stretch of sequence, complementary to universal Z probe, was also incorporated at the 5′-end of each reverse primer (InterGen, Inc., Purchase, NY, USA). The reagents used for this reaction included 2X concentrated hot-start Q-Master mix (AbGene Laboratories), 10 pmol of specific forward primer, 1 pmol of reverse primer, 10 pmol of FAM-tagged universal probe and cDNA. The qPCR conditions were 95°C for 15 min, followed by 60 cycles at 95°C for 20 sec, 55°C for 30 sec and 72°C for 20 sec. qPCR for GAPDH was also performed on the same samples to normalise for any residual differences in the initial quantification of cDNA, as previously reported (34,35).

Effect of SERMs on cancer cell lines

The effect of oestrogen receptors on the expression of Sema4D and plexin-B1 was studied using MCF-7 and MDA-MB-231 breast cancer cell lines. These cell lines were purchased from the European Collection of Animal Cell Culture (ECACC; Salisbury, UK). The lines were routinely maintained in Dulbecco’s modified Eagle’s medium (DMEM)/F12 medium with 10% foetal calf serum (FCS). Selective oestrogen receptor modulators (SERMs) used in the present study included an agonist and antagonist for ERα and ERβ receptors. PPT (agonist) for ERα receptor while ERβ041 (agonist) for ERβ receptor were purchased from Tocris Biosciences (Bristol, UK). The SERMs were dissolved in a DMEM at 4X concentration in reference to their respective IC50 value.

A duplicate set of 6-well plates was used for this study. The cells (5×105) from each cell line were seeded in the well separately. The plates were incubated at 37°C in a normal DMEM/F12 medium for a minimal of 24 h. The cells were later exposed to serum starvation for170 1 h duration. These wells were then exposed to a variable concentration of SERMs. After 4–5 h of treatment, the cells were lysed in total RNA isolation reagents for RNA isolation.

Statistical analysis

Statistical analysis was carried out using the Minitab statistical software package (version 14). Non-normally distributed data were assessed using the Mann-Whitney test (IQR), whereas the Student’s t-test (mean ± SD) was used for normally distributed data where appropriate. P<0.05 was defined as statistically significant. A Kaplan-Meier survival analysis was carried out using SPSS statistical software (version 12; SPSS, Inc.).

Results

Aberrant expression of Sema4D and the plexin-B family in breast cancer

Transcript levels of Sema4D and plexin-B2 in the breast tumours were similar to their expression in the normal background tissues. Plexin-B1 appeared to be expressed at relatively lower levels in the tumours. Notably, plexin-B3 was upregulated in the tumours, p=0.02 when compared to the control (Table I).

Correlation of Sema4D and the plexin-B family with differentiation of breast cancer cells

Transcript levels of Sema4D did not show any significant variations among well, moderately and poorly differentiated tumour tissues (Table I). The expression of plexin-B1 was markedly reduced when compared among well (grade 1) and both moderate (grade 2) and poorly differentiated (grade 3) tumour tissues, respectively (Table I). No significant correlation of plexin-B2 with tumour grading was observed. A pronounced increase of plexin-B3 expression was observed in moderately and poorly differentiated tumours in comparison to well-differentiated tumours. This increase of plexin-B3 was also statistically significant among grade 1 vs. 2 p=0.026; and grade 1 vs. 3 p=0.0024, respectively (Table I).

Expressional variations among different breast cancer types

Increased expression of Sema4D and plexin-B1 was observed in ductal (n=87) when compared with lobular (n=12), muscin (n=4), medullary (n=2), tubular (n=1) and other types of breast cancer patients (n=7). A significant correlation of the expression of Sema4D and plexin-B1 among ductal versus all previously mentioned types, excluding lobular cancer, was also established in the cohort (p<0.001). Similarly, plexin-B2 and -B3 molecules showed the highest expression in ductal cancer patients when compared with other types of breast cancers. A significant correlation of the plexin-B2 and -B3 expression levels among ductal versus all earlier mentioned types, excluding lobular cancer, was also established in the cohort (p<0.001).

Correlation of tumor-node-metastasis (TNM) staging

Transcript levels of Sema4D, plexin-B1, -B2 and -B3 tended to be reduced in the tumours at more advanced stages according to the grouping of TNM stages. Significant associations were observed in levels of plexin-B1 and -B2. The highest transcript levels of plexin-B1 were evident in tumours at an extremely early stage (TNM1), with its expression level being reduced during disease progression. The lowest expression of plexin-B1 was seen in the most advanced diseases. Similarly, the lowest expression levels of plexin-B2 were evident in the tumours with metastases (Table I).

Relationship with the clinical outcome of breast cancer

A reduced expression of Sema4D was strongly correlated with distant metastasis (p=0.0008) and local recurrence (p=0.0003) in comparison to its expression in disease-free patients (Table I). The expression of plexin-B1 downregulation was significantly associated with disease-free survival. No significant association of the plexin-B2 and -B3 expression profiles with the clinical outcome and disease-free survival were observed in the breast cohort. The reduced expression of plexin-B2 was significantly correlated with local recurrence in comparison to the disease-free one (p=0.002) (Fig. 1).

Expression of Sema4D and the plexin-B family with overall survival

The effect of the altered expression pattern of these molecules on patient survival was also carried out using the Kaplan-Meier survival curve (Fig. 2). Patients with an increased expression of Sema4D showed an increased disease-free survival when compared with patients stating reduced or almost negative Sema4D (p=0.033). However, the plexin-B1-reduced expression was significantly associated with worst outcome in the cohort (p=0.006). No significant relationship of plexin-B2 and -B3 with overall survival was observed.

Effect of Sema4D and the plexin-B family on bone metastasis

A significant correlation of the Sema4D expression with bone metastasis was observed in the cohort (p=0.0013, Fig. 3A). Patients with bone metastasis showed a decreased Sema4D expression when compared with disease-free patients. However, no significant association between plexin-B1 and bone metastasis was seen, although the levels were much lower in patients with bone metastasis compared to disease-free patients (p=0.069, Fig. 3B). Of note, a reduction in plexin-B2 was significantly correlated with bone metastasis (p=0.039, Fig. 3C). Plexin-B3 upregulation was observed in patients with bone metastasis, but was not found to be statistically significant (p=0.66, Fig. 3D).

Relationship with oestrogen receptor

A significant increase in the Sema4D expression in ERα-positive ductal breast cancer patients (n=57) compared with ERα-negative ductal carcinoma patients (n=23) (p=0.044) was observed in the clinical cohort. Higher levels of plexin-B1 were also observed in the ERα-positive patients as compared to the ERα-negative patients (p=0.05). Although the expression of Sema4D and plexin-B1 appeared to be lower in the ERβ-positive tumours, no statistical difference was observed in the analysis. By contrast, the expression profiles of Sema4D and plexin-B1 and the expression levels of plexin-B2 were similar in the tumours of different ER status. Among the four genes, the plexin-B3 expression appeared to be inversely linked to ERα status, and its expression was upregulated in the ERβ-positive tumours (Fig. 4).

Regulation of Sema4D and plexin-B1 by SERMs

The expression of Sema4D and plexin-B1 was determined in MCF-7 and MDA-MB-231 cells following exposure to different SERMs. Increased transcription of Sema4D was observed in the MCF-7 cells treated with PPT (ERα agonist) compared to the control (Fig. 5A). Notably, the inverse correlation of Sema4D expression with ERβ041 (ERβ agonist) treatment was observed in the MDA-MB-231 cells (Fig. 5B). This finding was also in agreement with the correlation between the Sema4D and ER receptors observed in the breast cancer cohort. Similarly, the transcription of plexin-B1 was upregulated following exposure of the PPT (agonist)-treated MCF-7 cells when compared to the controls (Fig. 5C). Plexin-B1 transcription was also upregulated by the ERβ receptor agonist in the MDA-MB-231 cells (Fig. 5D). Although these findings were in agreement with cohort observations, this area requires further research to explore the oestrogen-regulated signaling pathways and its effects of semaphorin signalling.

Discussion

The dual role of semaphorins and plexins as oncogene or tumour-suppressor molecules has been previously reported in the literature. As in melanoma, the downregulation of plexin-B1 was strongly associated with cancer progression (36,37), while increased levels of this molecule have been observed in ovarian, prostate and breast cancer (38). In the present study, no significant association of the Sema4D, plexin-B1 and -B2 aberrant expression among normal and diseased patients was observed in the cohort. This result is similar to the findings by Yang et al, which show no significant difference in the plexin-B2 protein expression between breast carcinoma and epithelial cells of normal breast tissue (39). In the present study, upregulation of plexin-B3 was identified in breast cancer compared to the normal controls. These findings are also in concordance with the study on gastric cancer patients, the results of which showed an increased expression of plexin-B3 and its ligand (Sema5A) in gastric cancer (40).

The reduced expression of Sema4D did not show any significant relationship with tumour cell differentiation in the current cohort. However, the cognate receptor (plexin-B1) showed a strong inverse correlation with tumour cell differentiation. This result is contrary to previous observations reported on breast and ovarian cancer samples. In a previous study, the co-expression of plexin-B1 and Met was associated with worse grading and higher incidences of lymph node metastases (29). These variations are due to i) involvement and influence of other factors interacting with semaphorins and their cognate receptors and ii) heterogeneous tumour orientation. The role of plexin-B1 as a tumour suppressor was observed in melanoma and melanocytes, where B-Raf/MKK/ERK stimulation led to its suppression and tumour progression (36). Thus, plexin-B1-interacting molecules are also noteworthy. In another study, the mammary tumours showing the co-expression of plexin-B2 and her-2 were characterised as worse staging with higher incidences of lymph node metastases than those that express plexin-B2 alone. However, no significant association of plexin-B2 alone with the TNM stage and grade was observed in these tissues (39). A direct correlation of plexin-B3 with advanced tumour grading in breast cancer cohort was consistent with previous findings. In gastric cancer, a gradual increase in the expression of both receptor and ligand (plexin-B3 and Sema5A) from non-neoplastic mucosa, primary gastric and metastasis was reported (40).

The reduced expression of Sema4D was strongly associated with an unfavourable outcome when compared with the disease-free patients. A study conducted on invasive ductal breast cancers using microarray and qPCR data revealed that 888 genes were significantly (p≤0.05) differentially expressed between grade I and II tumours. A potentially protective effect of Sema4D, Sema4F and plexin-A2 on benign tumours towards growth and metastatic suppression has been reported (24). Those findings suggest Sema4D putative involvement as a clinical prognostic marker. However, apart from the aforementioned study a completely contrasting feature of Sema4D (acting as oncogene molecule) has also been reported (38,41). As in ovarian cancer, the overexpression of Sema4D together with HIF-1α and VEGF were associated with poor prognosis. An increased expression of Sema4D was also associated with histological grading, stages and lymph node metastasis (41). An increased expression of Sema4D between the cytoplasm and cell surface has also been reported in head and neck squamous cell carcinoma, oral, prostate, breast and lung cancer tissues (38). These disparities in findings are also adequately addressed in the literature. One of the main contributing factors in this regard is that the correlations of these molecules fluctuate strongly when measured over different subsets of patients (42). Loss of plexin-B1 is significantly associated with a worse outcome in patients and the present study was also in concordance with previously published studies (31). A higher expression of plexin-B1 in ER-positive was correlated with the disease-free and overall survival (43).

The expression of Sema4D and plexin-B2 was significantly associated with bone metastasis. Patients having a reduced level of Sema4D and plexin-B2 showed an increased tendency towards bone metastastic progression. This area requires further research to investigate the factors responsible for modulating these effects on bone marrows.

These findings collectively suggest aberrant expression and dysfunctions of these molecules occurring in certain malignancies, including breast cancer, as shown by results of the present study. Conflicting findings from different studies also suggest these molecules may play more complicated roles in cancer regarding the type of cancer, and some other non-clarified subgroups of a particular cancer. For example, in breast cancer the ERs status may be involved in such differences. In the present cohort, a significant increase in Sema4D and plexin-B1 was identified in relation to the ERα-positive tumour patients as compared to the ERα-negative ones. A similar trend regarding the expression of Sema4D and plexin-B1 was also observed in the MCF-7 and MD-MB-231 cancer cell lines following exposure to ERα and ERβ, respectively. These findings are in concordance with previously published studies where increased plexin-B1 levels in ER-positive are correlated with increased disease-free and overall survival (43). A direct expressional correlation of plexin-B1 with ER status was observed in only those cancer cells showing stem cell-like expression status, where proliferative activity was coupled with ER status (31). Thus, the regulation of Sema4D and plexin-B1 influenced by oestrogen receptors is an important domain to determine future therapeutic strategies.

In conclusion, the Sema4D and plexin-B1 reduced levels are associated with breast cancer progression and a poor outcome. Increased plexin-B3 is also a contributory factor for bone metastasis. Oestrogen receptors regulate the expressional profiling of semaphorins and plexins. Involvement of these molecules in bone metastasis and ERs require further investigations to provide a better understanding of the diseases and opportunities to improve personalised treatment according to the molecular signature.

Acknowledgments

We would like to thank the participants of the present study, as well as the Cancer Research Wales and the higher Education Commission of Pakistan (FAM) for providing funds for the present study.

References

1 

Singletary SE: Rating the risk factors for breast cancer. Ann Surg. 237:474–482. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Carmeliet P and Jain RK: Angiogenesis in cancer and other diseases. Nature. 407:249–257. 2000. View Article : Google Scholar : PubMed/NCBI

3 

Autiero M, Waltenberger J, Communi D, Kranz A, Moons L, Lambrechts D, Kroll J, Plaisance S, De Mol M, Bono F, et al: Role of PlGF in the intra- and intermolecular cross talk between the VEGF receptors Flt1 and Flk1. Nat Med. 9:936–943. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Zhou Y, Gunput RA and Pasterkamp RJ: Semaphorin signaling: Progress made and promises ahead. Trends Biochem Sci. 33:161–170. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Perälä N, Sariola H and Immonen T: More than nervous: The emerging roles of plexins. Differentiation. 83:77–91. 2012. View Article : Google Scholar

6 

Tamagnone L, Artigiani S, Chen H, He Z, Ming GI, Song H, Chedotal A, Winberg ML, Goodman CS, Poo M, et al: Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell. 99:71–80. 1999. View Article : Google Scholar : PubMed/NCBI

7 

Regev A, Goldman S and Shalev E: Semaphorin-4D (Sema-4D), the Plexin-B1 ligand, is involved in mouse ovary follicular develop ment. Reprod Biol Endocrinol. 5:122007. View Article : Google Scholar

8 

Pasterkamp RJ and Giger RJ: Semaphorin function in neural plasticity and disease. Curr Opin Neurobiol. 19:263–274. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Mizui M, Kumanogoh A and Kikutani H: Immune semaphorins: Novel features of neural guidance molecules. J Clin Immunol. 29:1–11. 2009. View Article : Google Scholar

10 

Wray NR, James MR, Mah SP, Nelson M, Andrews G, Sullivan PF, Montgomery GW, Birley AJ, Braun A and Martin NG: Anxiety and comorbid measures associated with PLXNA2. Arch Gen Psychiatry. 64:318–326. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Fujii T, Uchiyama H, Yamamoto N, Hori H, Tatsumi M, Ishikawa M, Arima K, Higuchi T and Kunugi H: Possible association of the semaphorin 3D gene (SEMA3D) with schizophrenia. J Psychiatr Res. 45:47–53. 2011. View Article : Google Scholar

12 

Negishi-Koga T, Shinohara M, Komatsu N, Bito H, Kodama T, Friedel RH and Takayanagi H: Suppression of bone formation by osteoclastic expression of semaphorin 4D. Nat Med. 17:1473–1480. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Hall KT, Boumsell L, Schultze JL, Boussiotis VA, Dorfman DM, Cardoso AA, Bensussan A, Nadler LM and Freeman GJ: Human CD100, a novel leukocyte semaphorin that promotes B-cell aggregation and differentiation. Proc Natl Acad Sci USA. 93:11780–11785. 1996. View Article : Google Scholar : PubMed/NCBI

14 

Ishida I, Kumanogoh A, Suzuki K, Akahani S, Noda K and Kikutani H: Involvement of CD100, a lymphocyte semaphorin, in the activation of the human immune system via CD72: Implications for the regulation of immune and inflammatory responses. Int Immunol. 15:1027–1034. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Deaglio S, Vaisitti T, Bergui L, Bonello L, Horenstein AL, Tamagnone L, Boumsell L and Malavasi F: CD38 and CD100 lead a network of surface receptors relaying positive signals for B-CLL growth and survival. Blood. 105:3042–3050. 2005. View Article : Google Scholar

16 

Bougeret C, Mansur IG, Dastot H, Schmid M, Mahouy G, Bensussan A and Boumsell L: Increased surface expression of a newly identified 150-kDa dimer early after human T lymphocyte activation. J Immunol. 148:318–323. 1992.PubMed/NCBI

17 

Ch’ng ES and Kumanogoh A: Roles of Sema4D and Plexin-B1 in tumor progression. Mol Cancer. 9:2512010. View Article : Google Scholar

18 

Nagase T, Ishikawa K, Nakajima D, Ohira M, Seki N, Miyajima N, Tanaka A, Kotani H, Nomura N and Ohara O: Prediction of the coding sequences of unidentified human genes. VII. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro. DNA Res. 4:141–150. 1997. View Article : Google Scholar : PubMed/NCBI

19 

Huang BS, Ahmad M, Deng AY and Leenen FH: Neuronal responsiveness to central Na+ in 2 congenic strains of Dahl saltsensitive rats. Hypertension. 49:1315–1320. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Artigiani S, Conrotto P, Fazzari P, Gilestro GF, Barberis D, Giordano S, Comoglio PM and Tamagnone L: Plexin-B3 is a functional receptor for semaphorin 5A. EMBO Rep. 5:710–714. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Kato S, Kubota K, Shimamura T, Shinohara Y, Kobayashi N, Watanabe S, Yoneda M, Inamori M, Nakamura F, Ishiguro H, et al: Semaphorin 4D, a lymphocyte semaphorin, enhances tumor cell motility through binding its receptor, plexinB1, in pancreatic cancer. Cancer Sci. 102:2029–2037. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Ch’ng E, Tomita Y, Zhang B, He J, Hoshida Y, Qiu Y, Morii E, Nakamichi I, Hamada K, Ueda T, et al: Prognostic significance of CD100 expression in soft tissue sarcoma. Cancer. 110:164–172. 2007. View Article : Google Scholar

23 

Sierra JR, Corso S, Caione L, Cepero V, Conrotto P, Cignetti A, Piacibello W, Kumanogoh A, Kikutani H, Comoglio PM, et al: Tumor angiogenesis and progression are enhanced by Sema4D produced by tumor-associated macrophages. J Exp Med. 205:1673–1685. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Gabrovska PN, Smith RA, Tiang T, Weinstein SR, Haupt LM and Griffiths LR: Semaphorin-plexin signalling genes associated with human breast tumourigenesis. Gene. 489:63–69. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Conrotto P, Corso S, Gamberini S, Comoglio PM and Giordano S: Interplay between scatter factor receptors and B plexins controls invasive growth. Oncogene. 23:5131–5137. 2004. View Article : Google Scholar : PubMed/NCBI

26 

Conrotto P, Valdembri D, Corso S, Serini G, Tamagnone L, Comoglio PM, Bussolino F and Giordano S: Sema4D induces angiogenesis through Met recruitment by Plexin B1. Blood. 105:4321–4329. 2005. View Article : Google Scholar : PubMed/NCBI

27 

Wong OG, Nitkunan T, Oinuma I, Zhou C, Blanc V, Brown RS, Bott SR, Nariculam J, Box G, Munson P, et al: Plexin-B1 mutations in prostate cancer. Proc Natl Acad Sci USA. 104:19040–19045. 2007. View Article : Google Scholar : PubMed/NCBI

28 

Qiang R, Wang F, Shi LY, Liu M, Chen S, Wan HY, Li YX, Li X, Gao SY, Sun BC, et al: Plexin-B1 is a target of miR-214 in cervical cancer and promotes the growth and invasion of HeLa cells. Int J Biochem Cell Biol. 43:632–641. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Valente G, Nicotra G, Arrondini M, Castino R, Capparuccia L, Prat M, Kerim S, Tamagnone L and Isidoro C: Co-expression of plexin-B1 and Met in human breast and ovary tumours enhances the risk of progression. Cell Oncol. 31:423–436. 2009.PubMed/NCBI

30 

Gómez Román JJ, Garay GO, Saenz P, Escuredo K, Sanz Ibayondo C, Gutkind S, Junquera C, Simón L, Martínez A, Fernández Luna JL, et al: Plexin B1 is downregulated in renal cell carcinomas and modulates cell growth. Transl Res. 151:134–140. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Rody A, Holtrich U, Gaetje R, Gehrmann M, Engels K, von Minckwitz G, Loibl S, Diallo-Danebrock R, Ruckhäberle E, Metzler D, et al: Poor outcome in estrogen receptor-positive breast cancers predicted by loss of plexin B1. Clin Cancer Res. 13:1115–1122. 2007. View Article : Google Scholar : PubMed/NCBI

32 

Rody A, Karn T, Ruckhäberle E, Hanker L, Metzler D, Müller V, Solbach C, Ahr A, Gätje R, Holtrich U, et al: Loss of Plexin B1 is highly prognostic in low proliferating ER positive breast cancers-results of a large scale microarray analysis. Eur J Cancer. 45:405–413. 2009. View Article : Google Scholar

33 

Zielonka M, Xia J, Friedel RH, Offermanns S and Worzfeld T: A systematic expression analysis implicates Plexin-B2 and its ligand Sema4C in the regulation of the vascular and endocrine system. Exp Cell Res. 316:2477–2486. 2010. View Article : Google Scholar : PubMed/NCBI

34 

Jiang WG, Douglas-Jones A and Mansel RE: Levels of expression of lipoxygenases and cyclooxygenase-2 in human breast cancer. Prostaglandins Leukot Essent Fatty Acids. 69:275–281. 2003. View Article : Google Scholar : PubMed/NCBI

35 

Malik FA, Sanders AJ, Jones AD, Mansel RE and Jiang WG: Transcriptional and translational modulation of KAI1 expression in ductal carcinoma of the breast and the prognostic significance. Int J Mol Med. 23:273–278. 2009.PubMed/NCBI

36 

Argast GM, Croy CH, Couts KL, Zhang Z, Litman E, Chan DC and Ahn NG: Plexin B1 is repressed by oncogenic B-Raf signaling and functions as a tumor suppressor in melanoma cells. Oncogene. 28:2697–2709. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Stevens L, McClelland L, Fricke A, Williamson M, Kuo I and Scott G: Plexin B1 suppresses c-Met in melanoma: A role for plexin B1 as a tumor-suppressor protein through regulation of c-Met. J Invest Dermatol. 130:1636–1645. 2010. View Article : Google Scholar : PubMed/NCBI

38 

Basile JR, Castilho RM, Williams VP and Gutkind JS: Semaphorin 4D provides a link between axon guidance processes and tumor-induced angiogenesis. Proc Natl Acad Sci USA. 103:9017–9022. 2006. View Article : Google Scholar : PubMed/NCBI

39 

Ye SM, Han M, Kan CY, Yang LL, Yang J, Ma QF and Wang SX: Expression and clinical significance of Sema4C in esophageal cancer, gastric cancer and rectal cancer. Zhonghua Yi Xue Za Zhi. 92:1954–1958. 2012.In Chinese. PubMed/NCBI

40 

Pan GQ, Ren HZ, Zhang SF, Wang XM and Wen JF: Expression of semaphorin 5A and its receptor plexin B3 contributes to invasion and metastasis of gastric carcinoma. World J Gastroenterol. 15:2800–2804. 2009. View Article : Google Scholar : PubMed/NCBI

41 

Chen Y, Zhang L, Pan Y, Ren X and Hao Q: Over-expression of semaphorin4D, hypoxia-inducible factor-1α and vascular endothelial growth factor is related to poor prognosis in ovarian epithelial cancer. Int J Mol Sci. 13:13264–13274. 2012. View Article : Google Scholar : PubMed/NCBI

42 

Ein-Dor L, Kela I, Getz G, Givol D and Domany E: Outcome signature genes in breast cancer: Is there a unique set? Bioinformatics. 21:171–178. 2005. View Article : Google Scholar

43 

van de Vijver MJ, He YD, van’t Veer LJ, Dai H, Hart AA, Voskuil DW, Schreiber GJ, Peterse JL, Roberts C, Marton MJ, et al: A gene-expression signature as a predictor of survival in breast cancer. N Engl J Med. 347:1999–2009. 2002. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

August 2015
Volume 34 Issue 2

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Malik, M.F., Ye, L., & Jiang, W.G. (2015). Reduced expression of semaphorin 4D and plexin-B in breast cancer is associated with poorer prognosis and the potential linkage with oestrogen receptor. Oncology Reports, 34, 1049-1057. https://doi.org/10.3892/or.2015.4015
MLA
Malik, M. F., Ye, L., Jiang, W. G."Reduced expression of semaphorin 4D and plexin-B in breast cancer is associated with poorer prognosis and the potential linkage with oestrogen receptor". Oncology Reports 34.2 (2015): 1049-1057.
Chicago
Malik, M. F., Ye, L., Jiang, W. G."Reduced expression of semaphorin 4D and plexin-B in breast cancer is associated with poorer prognosis and the potential linkage with oestrogen receptor". Oncology Reports 34, no. 2 (2015): 1049-1057. https://doi.org/10.3892/or.2015.4015