miRNA expression profile of vulvar squamous cell carcinoma and identification of the oncogenic role of miR-590-5p
- Authors:
- Published online on: October 22, 2015 https://doi.org/10.3892/or.2015.4344
- Pages: 398-408
Abstract
Introduction
Vulvar tumours constitute 4% of all gynaecological malignancies and are critical carcinomas of the female reproductive system (1). According to the National Cancer Institute, the incidence of vulvar cancer has increased in recent years in the US (2). The early diagnosis of vulvar cancer results in a five-year survival greater than 70%. The prognosis of vulvar neoplasia depends on the clinical grade, tumour diameter and status of lymph node metastasis. Standard surgery can cause considerable morbidity and significant disfigurement. Patients require individualised therapy and less radical surgery to reduce the incidence of complications. At present, the majority of vulvar carcinomas are vulvar squamous cell carcinomas (VSCCs) (90%) (3), and recent studies have shown that the overall incidence of VSCC has risen steadily at a rate of 20% over the past 40 years (4). Previous studies have not completely explained the aetiology of this disease. Thus, the identification of new tumour markers for the early detection and prognostic monitoring of VSCC remains urgently needed.
MicroRNAs (miRNAs) are short non-coding RNAs that silence mRNAs at the post-transcriptional levels. The transcription of approximately one-third of mRNAs is regulated by miRNAs, which are considered important regulators in key biological processes, such as cell growth, differentiation, adhesion, angiogenesis and inflammation (5–7). Changes in miRNA levels can cause different types of cancers. The miRNA expression profiles in cancer have been used to identify early diagnostic markers and therapeutic targets. At present, little data are available regarding miRNA expression in vulvar cancer. de Melo Maia et al (8) identified 79 miRNAs that showed markedly different expression levels in vulvar cancer compared with control samples. Although many miRNAs have been found to be associated with vulvar cancer, the mechanism of action of miRNAs in vulvar tumourigenesis still requires further investigation.
In the present study, we compared the miRNA expression profiles of VSCC and adjacent non-cancerous samples and investigated the mechanism of action of miR-590-5p in the A431 human VSCC cell line. The target of miR-590-5p was identified to elucidate the possible function of miR-590-5p in VSCC.
Materials and methods
Tissue collection
We obtained three pairs of freshly frozen VSCC samples and adjacent non-cancerous tissues for our microarray study (Table I). For miRNA analysis and target gene validation step, 30 freshly frozen VSCC samples and adjacent non-cancerous tissues were collected. All of the tissues were obtained from the Department of Gynaecology at our hospital at the time of surgery between January 2011 and January 2015, and we snap-froze the samples rapidly for future use. We staged all of the lesions using the new vulvar cancer classification system (9). The pathology of the frozen specimens was analysed. Clinical records were retrospectively reviewed. We enrolled patients who had not undergone chemotherapy or radiation treatment prior to surgery. The ethics Committee of the First Affiliated hospital of China Medical University approved our research and we obtained the informed consent from patients.
miRNA microarray and bioinformatics
Kangchen Bio-tech Inc. (Shanghai, China) extracted the total RNA from the tissue samples and performed our microarray analysis using a miRCURY™ LNA array (v. 18.0; exiqon). After carefully reviewing the literature, we chose 25 upregulated and 25 down-regulated miRNAs for further study. Three web-based miRNA target prediction programs were used to explore potential target genes: TargetScan (https://www.targetscan.org/vert60/), MicroCosm (http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/) and miRanda (http://www.microrna.org/microrna/home.do). To improve the accuracy of our results, we further examined the putative genes that were identified by the three algorithms for further study. We conducted Gene Ontology (GO) and KEGG pathways analyses on these target genes.
Real-time quantitative PCR of miRNAs
We selected fragments of the differentially expressed miRNAs for further verification in 30 additional VSCC tissues and the corresponding adjacent non-cancerous vulvar samples. Total RNA was isolated from tissues using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. As previously described (10), we applied stem-loop RT-PCR to detect the miRNA levels. cDNA synthesis was performed using a Gene Amp PCR System 9700 (Applied Biosystems, Foster City, CA, USA). We performed RT-qPCR in triplicate following standard protocols. We calculated the miRNA expression levels using the 2−ΔΔCt method with U6 as the internal control. The PCR cycle parameters were the following: 95°C for 10 min followed by 40 cycles of 95°C for 10 sec and 60°C for 60 sec. The miRNA primers are shown in Table II.
Detection of mRNAs of TGFβ1, TGFβ2, TGFβRII and Smad4
We detected mRNAs of TGFβ1, TGFβ2, TGFβRII and Smad4 in the tissue samples by RT-qPCR. We quantified the amplified products using the SYBR-green method (Takara Bio, inc., Dalian, China) with gAPDh as the internal control. The fold-changes were quantified using the 2−ΔΔCt method. The primers were as follows: GAPDH forward, AAGGTGAAGGTCGGAGTCAAC and reverse, GGGTCATTGATGGCAACAATA; TGFβ1 forward, AAGGACCTCGGCTGGAAGTG and reverse, CCCGGGTTATGCTGGTTGTA; TGFβ2 forward, TGCCGCCCTTCTTCCCCTC and reverse, GGAGCACAAGCTGCCCACTGA; TGFβRII forward, AAGATGACCGCTCTGACATCA and reverse, CTTATAGACCTCAGCAAAGCGAC; and Smad4 forward, CGCTTTTGTTTGGGTCAACT and reverse, CCCAAACATCACCTTCACCT. The RT-qPCR parameters were the following: 95°C for 10 min followed by 40 cycles of 95°C for 5 sec and 60°C for 34 sec.
Western blotting
The total protein from the tissue samples and cells was prepared for western blot analysis. Seventy-two hours after transfection with the miRNA mimics or siRNA-TGFβRII, the total protein was collected for analysis (11). Immunoblotting was performed with monoclonal TGFβ1 (ab64715) (1:1,000), polyclonal TGFβ2 (ABE586; cat.) (1:1,000), polyclonal TGFβRII (ab78419) (1:1,000), monoclonal Smad4 (ab40759) (1:5,000) or gAPDh (ab181602) (1:5,000) antibody (all from Abcam, Cambridge, MA, USA). The membrane was washed and incubated with goat anti-rabbit (1:5,000; Invitrogen Life Technologies) or anti-mouse igg (h + L)-hRP conjugate (1:10,000; Invitrogen Life Technologies) antibody. The ImageJ software was used to determine the relative protein expression levels.
Cell culture and transfection
The A431 cell line was obtained from ATCC (Manassas, VA, USA) and cultured in RPMi-1640 medium containing 10% fetal bovine serum under standard conditions at 37°C and 5% Co2 in a humidified atmosphere. The cells were transfected with Dharmacon miRIDIAN miR-590-5p mimic (miR-590-5p) and the negative control (Thermo Fisher Scientific, Lafayette, Co, USA) at a final concentration of 100 nmol/l. A small interfering RNA targeting TGFβRII (siRNA-TgFβRII) was obtained from Santa Cruz Biotechnology, inc. (Santa Cruz, CA, USA) (sc-36657). The cells were transfected using Lipofectamine 2000 (Invitrogen Life Technologies) according to the manufacturer's recommendation.
MTT assay
We performed an MTT assay to evaluate cell proliferation. A431 cells were plated in 96-well sample culture plates at a density of 5×104 cells per well with the miR-590-5p mimics or siRNA-TGFβRII and the corresponding negative controls. The cells were cultured for 48 and 96 h, and the optical absorbance was read at 490 nm on a microplate reader. The experiments were conducted in triplicate.
Cell migration
A Transwell assay was performed to examine cell migration. Forty-eight hours after transfection, 5×104 cells were placed in the upper chambers of Transwell plates with an untreated membrane. After 24 h of incubation, the chambers were treated with 4% paraformaldehyde and then fixed with hematoxylin and eosin. The cells that passed through the membrane were counted. The migration assays were conducted in triplicate.
Analysis of cell cycle distribution
Cells transfected with the miR-590-5p mimics or siRNA-TGFβRII for 48 h were collected and placed in ethanol (70%) for 24 h. The cells were then treated with propidium iodide (40 µg/ml) for 30 min. Flow cytometry was used for the analysis, and the experiments were performed in triplicate.
Statistical analysis
The data are presented as the means ± SD, and SPSS 15.0 software (SPSS, Inc., Chicago, IL, USA) was used for all of the data analyses. The significance of differences in the mean values was analysed using the Student's t-test. A two-sided Fisher's exact test was used to determine the relationship between miR-590-5p expression and clinicopathological data. P<0.05 was considered to indicate a statistically significant difference.
Results
miRNA expression profile in VSCC
After confirming the quality of the RNA extracted from the tissue samples, we determined the miRNA expression profile of VSCC. We selected the miRNAs that were overexpressed or underexpressed by more than 2-fold for the bioinformatics analysis and identified 90 upregulated and 67 downregulated miRNAs in the cancer samples (Fig. 1, Tables III and IV).
Bioinformatics
In total, 1,350 genes were predicted. GO analysis and KEGG annotation showed that the transforming growth factor-β (TGF-β) pathway was an enriched pathway in VSCC (Fig. 2).
Confirmation of the microarray findings
To confirm our microarray findings, RT-qPCR analysis of miR-590-5p, miR-182-5p, miR-183-5p, miR-603, miR-103a-3p and miR-107 was conducted. The RT-qPCR results were in accordance with the microarray results (Fig. 3): in VSCC, miR-590-5p, miR-182-5p and miR-183-5p were upregulated, and miR-603, miR-103a-3p and miR-107 were downregulated.
Relationship between miR-590-5p and clinical pathology of vulvar cancer
We set the 75th percentile of the 2−ΔΔCt values as the cut-off value for samples with high or low levels of miR-590-5p (12). The miR-590-5p level was not correlated with patient age, tumour differentiation, vascular invasion, FIGO stage, tumour size and depth of invasion but was positively correlated with lymph node metastasis (P=0.009) (Table V). The results indicated that increased expression of miR-590-5p aids the distant spread of VSCC.
Putative target genes
According to the target prediction programs, TGFβ1 and TGFβ2 are both putative target genes for miR-590-5p (Table VI), TgFβRII is a target of miR-590-5p in human hepatocellular carcinoma (13), and miR-182-5p acts as an oncogene by knocking down Smad4 in bladder cancer (14). Since the results showed that miR-182-5p and miR-590-5p were upregulated in VSCC (Fig. 3), we detected the mRNA and protein levels of TGFβ1, TGFβ2, TGFβRII and Smad4. The RNA levels of TGFβ1 and TGFβ2 were significantly overexpressed in VSCC compared with control tissues by 2.95-fold and 3.25-fold, respectively (Fig. 4A). The protein levels of TGFβ1 and TGFβ2 were found to be markedly increased in VSCC (Fig. 4B and C). The RNA levels of TGFβRII and Smad4 were significantly underexpressed in VSCC compared with control tissues by 0.21-fold and 0.25-fold, respectively (Fig. 4A), and the protein levels of TGFβRII and Smad4 were markedly decreased in VSCC (Fig. 4B and C). Based on our results and the literature (13), we hypothesized that TGFβRII is a target gene of miR-590-5p in VSCC.
miR-590-5p promotes the proliferation, migration and the G1-to-S transition in A431 cells
A431 cells were transiently transfected with the miR-590-5p mimic at a concentration of 100 nM. At 96 h, the proliferation rate of the A431 cells transfected with the miR-590-5p mimic was markedly higher (P=0.001) than that of the cells transfected with the miRNA negative control (Fig. 5D). The miR-590-5p mimic significantly promoted A431 cell migration. The migration rate of the cells transfected with the miR-590-5p mimics was 40% higher than that of the cells transfected with the negative control (P=0.001) (Fig. 6A). An analysis of the cell cycle distribution by flow cytometry showed that the percentage of A431 cells in the G1 phase was significantly decreased from 58.89±1.69% before transfection to 47.73±1.23% at 48 h after transfection (P=0.001) and that the percentage of cells in the S phase was significantly increased from 27.80±1.95% before transfection to 43.41±1.22% at 48 h after transfection (P=2.998×10−4) (Fig. 7A).
Knockdown of TGFβRII increases the proliferation and migration of vulvar carcinoma cells
We used an siRNA that targets TGFβRII (siR-TgFβRII) to investigate the role of TGFβRII in the proliferation and migration of A431 cells. Forty-eight hours after the knockdown of TgFβRII in the A431 cells, the mRNA and protein expression levels of TGFβRII were reduced by 60.3±3.5% (P=0.001) (Fig. 8A) and 57.7±3.2% (P=0.001) (Fig. 8B and C), respectively. TGFβRII knockdown markedly decreased the percentage of A431 cells in the G1 phase from 57.05±1.26% before knockdown to 49.62±1.84% at 48 h after knockdown (P=0.005) (Fig. 7B) and promoted cell proliferation (P=0.003) (Fig. 8D) and cell migration (P=0.008) (Fig. 6B).
miR-590-5p targets TGFβRII
In the A431 cells, TGFβRII expression was significantly downregulated by the forced expression of miR-590-5p. TGFβRII mRNA expression was decreased by 28.7±6.8% (P=0.018) and TGFβRII protein expression was decreased by 37.7±5.1% (P=0.006) in the cells transfected with miR-590-5p compared to the cells transfected with the miRNA negative control (Fig. 5A–C).
Discussion
miRNAs are highly conserved small RNA molecules (18–24 bp in length) that block translation or promote mRNA degradation. Researchers use miRNA expression profiles to identify new early diagnostic markers and key pathways that are relevant to cancer and to predict outcomes (15). however, few miRNA studies have focused on VSCC. In the present study, we determined the miRNA expression profile of VSCC using a miRCURY™ LNA array. To confirm the reproducibility of the experiment, we determined the expression levels of 6 miRNAs in 30 pairs of tissues by RT-qPCR and found that the results of the two assays were consistent. This investigation of the miRNA profile of VSCC provides valuable information regarding the aetiology of VSCC. Computational approaches, such as GO and KEGG, provide high statistical power for confirming the biological relevance of the experimental data. Using bioinformatics, we found that the TGFβ signalling pathway is important in VSCC. The RNA and protein levels of key factors (TgFβ1, TGFβ2, TGFβRII and Smad4) were measured in tissue samples, and TGFβRII was selected for further research.
We observed the upregulation of miR-590-5p in VSCC. miR-590-5p has been reported to increase cardiac muscle cell growth in mammals (16) and has frequently been shown to be upregulated in tumours, which suggests that miR-590-5p promotes tumour progression. miR-590-5p has been shown to be overexpressed in patients with high-risk types of Wilms' carcinoma (17). The target mRNAs of miR-590-5p have been identified in certain studies. For example, miR-590-5p has been shown to exert oncogenic activity through targeting of the ChL1 gene in cervical carcinoma (18). in addition, upregulation of miR-590-5p has been shown to be induced by the downregulation of PBRM1 in renal cancer cell lines (19). Another research group showed that miR-590 is upregulated by TGFβRII in cardiosphere-derived cells during differentiation (20). however, Shan et al reported that miR-590-5p is downregulated in liver cancer and that miR-590-5p decreases the proliferation of carcinoma cells by targeting S100A100 (21). Our study showed that miR-590-5p is overexpressed in vulvar cancer tissues (Fig. 3). Thus, miR-590-5p may be a novel oncogenic miRNA in VSCC.
Our research also showed that TGFβRII is negatively regulated by miR-590-5p in VSCC. The TGF-β/Smad signalling pathway functions as an important regulator of the pathogenesis of many cancers, including colon cancer, oesophageal squamous cell carcinoma, breast cancer and lung cancer (22–25). Many studies have investigated the effect of TGF-β/Smad signalling on epithelial cell proliferation and carcinoma. In humans, the three TGFβ isoforms, TGFβ1, TGFβ2 and TGFβ3, exhibit high similarity and homology. The TGF-β pathway transfers signals to the inside of cells via TGF-β-specific receptors including TGFβRII, which plays a role in cell growth and carcinogenesis. Smad4 is a major transducer of intracellular signals of the TGF-β pathway. TGFβRII has been shown to play roles in tumour invasion and metastasis in several types of cancers. Ganapathy et al showed that TGFβRII is downregulated in haCaT cells and found that TGFβRII inhibits metastasis and progression of late-stage tumour cells (26). The overexpression of TGFβRII inhibits cell growth in cancer (27). Additionally, TGFβRII has also been found to be progressively lost in oral and skin SCC (28). However, the role of TGFβRII in VSCC is unknown, and our research showed that TGFβRII is underexpressed in vulvar carcinoma.
We conducted functional studies in A431 cells, which have previously been used for miRNA research. Alanazi et al found that some miRNAs (miR-663, miR-499-5p, miR-494, miR-602, miR-2861, miR-675 and miR-3185) may have crucial functions in A431 cell apoptosis through a process involving epidermal growth factor (EGF) involvement (29). In addition, miR-21 has been shown to promote the proliferation of A431 cells (30). In the present study, we transfected the miR-590-5p mimic into A431 cells, and after transfection, the endogenous level of miR-590-5p was upregulated. The MTT assay revealed that cell proliferation was markedly increased (Fig. 5D) and that TGFβRII was down-regulated (Fig. 5A–C). The Transwell assay results suggested that miR-590-5p induced cell migration (Fig. 6A). We also explored changes in cell cycle progression, which is an essential step in carcinogenesis. The FCM results indicated that the upregulation of miR-590-5p promoted the G1-to-S cell cycle transition in the A431 cells (Fig. 7A). Our results provide novel information regarding the roles of miR-590-5p in tumourigenesis. Moreover, we used siRNA to successfully block TGFβRII expression and obtained results that were similar to those obtained after the overexpression of miR-590-5p. We found that miR-590-5p exerted an oncogenic function in vulvar cancer. Based on our results, we hypothesize that miR-590-5p interferes with the TGF-β pathway to regulate cell growth and induce carcinogenesis.
The present study has some limitations. First, vulvar cancer is a rare disease; thus, the number of clinical samples in our study was relatively low, and more microarray studies on vulvar cancer are needed to obtain larger data sets. We did not conduct a dual luciferase reporter assay in our study since it was performed previously (13). We found that miR-590-5p, TGFβ1 and TGFβ2 were all upregulated in VSCC tissues, which suggests that miRNAs other than miR-590-5p may be responsible for the upregulation of TGFβ1 and TGFβ2 because miRNAs typically decrease the expression of their target mRNAs. however, some miRNAs have also been reported to increase the expression of target genes. For example, miR-373 increases the expression of its target gene, E-cadherin (31). Therefore, further assays need to be performed to determine the targets of miR-590-5p. The relationship between miR-182-5p and Smad4 in VSCC remains to be investigated.
In conclusion, we determined the miRNA expression profile in VSCC and evaluated the expression of a subset of miRNAs by microarray. Target prediction and functional analysis suggested that miR-590-5p is involved in the tumourigenesis of VSCC as the upregulation of miR-590-5p was found to be associated with lymphatic metastasis. Furthermore, the present investigation showed that miR-590-5p plays an oncogenic role in VSCC by promoting cell proliferation and migration as well as the G1-S transition through the manipulation of TGFβRII expression. These findings suggest that miR-590-5p may be a critical therapeutic target in VSCC.
Acknowledgments
We thank Tao Zhang for his invaluable technical assistance.
References
|
Pathak D, Agrawal S and Dhali TK: Prevalences of and risk factors for vulvar diseases in Nepal: A hospital-based study. Int J Dermatol. 50:161–167. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Akhtar-Danesh N, Elit L and Lytwyn A: Trends in incidence and survival of women with invasive vulvar cancer in the United States and Canada: A population-based study. Gynecol Oncol. 134:314–318. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Dittmer C, Katalinic A, Mundhenke C, Thill M and Fischer D: Epidemiology of vulvar and vaginal cancer in Germany. Arch Gynecol Obstet. 284:169–174. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Judson PL, Habermann EB, Baxter NN, Durham SB and Virnig BA: Trends in the incidence of invasive and in situ vulvar carcinoma. Obstet Gynecol. 107:1018–1022. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Chen CZ, Li L, Lodish HF and Bartel DP: MicroRNAs modulate hematopoietic lineage differentiation. Science. 303:83–86. 2004. View Article : Google Scholar | |
|
Sharma A, Kumar M, Aich J, Hariharan M, Brahmachari SK, Agrawal A and Ghosh B: Posttranscriptional regulation of interleukin-10 expression by hsa-miR-106a. Proc Natl Acad Sci USA. 106:5761–5766. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Ambros V: The functions of animal microRNAs. Nature. 431:350–355. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
de Melo Maia B, Lavorato-Rocha AM, Rodrigues LS, Coutinho-Camillo CM, Baiocchi G, Stiepcich MM, Puga R, de A Lima L, Soares FA and Rocha RM: microRNA portraits in human vulvar carcinoma. Cancer Prev Res (Phila). 6:1231–1241. 2013. View Article : Google Scholar | |
|
Pecorelli S: Revised FIGO staging for carcinoma of the vulva, cervix, and endometrium. Int J Gynaecol Obstet. 105:103–104. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, et al: Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33:e1792005. View Article : Google Scholar : PubMed/NCBI | |
|
Li Y, Wang F, Xu J, Ye F, Shen Y, Zhou J, Lu W, Wan X, Ma D and Xie X: Progressive miRNA expression profiles in cervical carcinogenesis and identification of hPV-related target genes for miR-29. J Pathol. 224:484–495. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Chen ZL, Zhao XH, Wang JW, Li BZ, Wang Z, Sun J, Tan FW, Ding DP, Xu XH, Zhou F, et al: microRNA-92a promotes lymph node metastasis of human esophageal squamous cell carcinoma via E-cadherin. J Biol Chem. 286:10725–10734. 2011. View Article : Google Scholar : | |
|
Jiang X, Xiang G, Wang Y, Zhang L, Yang X, Cao L, Peng H, Xue P and Chen D: MicroRNA-590–5p regulates proliferation and invasion in human hepatocellular carcinoma cells by targeting TGF-β RII. Mol Cells. 33:545–551. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Hirata H, Ueno K, Shahryari V, Tanaka Y, Tabatabai ZL, Hinoda Y and Dahiya R: Oncogenic miRNA-182-5p targets Smad4 and RECK in human bladder cancer. PLoS One. 7:e510562012. View Article : Google Scholar : PubMed/NCBI | |
|
Garzon R, Fabbri M, Cimmino A, Calin GA and Croce CM: MicroRNA expression and function in cancer. Trends Mol Med. 12:580–587. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Eulalio A, Mano M, Dal Ferro M, Zentilin L, Sinagra G, Zacchigna S and Giacca M: Functional screening identifies miRNAs inducing cardiac regeneration. Nature. 492:376–381. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Watson JA, Bryan K, Williams R, Popov S, Vujanic G, Coulomb A, Boccon-Gibod L, Graf N, Pritchard-Jones K and O'Sullivan M: miRNA profiles as a predictor of chemorespon-siveness in Wilms' tumor blastema. PLoS One. 8:e534172013. View Article : Google Scholar | |
|
Chu Y, Ouyang Y, Wang F, Zheng A, Bai L, Han L, Chen Y and Wang H: MicroRNA-590 promotes cervical cancer cell growth and invasion by targeting ChL1. J Cell Biochem. 115:847–853. 2014. View Article : Google Scholar | |
|
Xiao X, Tang C, Xiao S, Fu C and Yu P: Enhancement of proliferation and invasion by microRNA-590-5p via targeting PBRM1 in clear cell renal carcinoma cells. Oncol Res. 20:537–544. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Ekhteraei-Tousi S, Mohammad-Soltani B, Sadeghizadeh M, Mowla SJ, Parsi S and Soleimani M: Inhibitory effect of hsa-miR-590-5p on cardiosphere-derived stem cells differentiation through downregulation of TGFB signaling. J Cell Biochem. 116:179–191. 2015. View Article : Google Scholar | |
|
Shan X, Miao Y, Fan R, Qian H, Chen P, Liu H, Yan X, Li J and Zhou F: MiR-590-5P inhibits growth of hepg2 cells via decrease of S100A10 expression and Inhibition of the Wnt pathway. Int J Mol Sci. 14:8556–8569. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Ji Q, Liu X, Han Z, Zhou L, Sui H, Yan L, Jiang H, Ren J, Cai J and Li Q: Resveratrol suppresses epithelial-to-mesenchymal transition in colorectal cancer through TGF-β1/Smads signaling pathway mediated Snail/E-cadherin expression. BMC Cancer. 15:972015. View Article : Google Scholar | |
|
Guo W, Zhang M, Shen S, Guo Y, Kuang G, Yang Z and Dong Z: Aberrant methylation and decreased expression of the TGF-β/Smad target gene FBXO32 in esophageal squamous cell carcinoma. Cancer. 120:2412–2423. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Goto N, Hiyoshi H, Ito I, Iida K, Nakajima Y, Nagasawa K and Yanagisawa J: Identification of a novel compound that suppresses breast cancer invasiveness by inhibiting transforming growth factor-β signaling via estrogen receptor α. J Cancer. 5:336–343. 2014. View Article : Google Scholar | |
|
Ischenko I, Liu J, Petrenko O and Hayman MJ: Transforming growth factor-beta signaling network regulates plasticity and lineage commitment of lung cancer cells. Cell Death Differ. 21:1218–1228. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Ganapathy A, Paterson IC, Prime SS, Eveson JW, Pring M, Price N, Threadgold SP and Davies M: TGF-β inhibits metastasis in late stage human squamous cell carcinoma of the skin by a mechanism that does not involve Id1. Cancer Lett. 298:107–118. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Deacu E, Mori Y, Sato F, Yin J, Olaru A, Sterian A, Xu Y, Wang S, Schulmann K, Berki A, et al: Activin type II receptor restoration in ACVR2-deficient colon cancer cells induces transforming growth factor-beta response pathway genes. Cancer Res. 64:7690–7696. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Paterson IC, Matthews JB, Huntley S, Robinson CM, Fahey M, Parkinson EK and Prime SS: Decreased expression of TGF-beta cell surface receptors during progression of human oral squamous cell carcinoma. J Pathol. 193:458–467. 2001. View Article : Google Scholar : PubMed/NCBI | |
|
Alanazi I, Hoffmann P and Adelson DL: MicroRNAs are part of the regulatory network that controls EGF induced apoptosis, including elements of the JAK/STAT pathway, in A431 cells. PLoS One. 10:e01203372015. View Article : Google Scholar : PubMed/NCBI | |
|
Li X, Huang K and Yu J: Inhibition of microRNA-21 upregulates the expression of programmed cell death 4 and phosphatase tensin homologue in the A431 squamous cell carcinoma cell line. Oncol Lett. 8:203–207. 2014.PubMed/NCBI | |
|
Place RF, Li LC, Pookot D, Noonan EJ and Dahiya R: MicroRNA-373 induces expression of genes with complementary promoter sequences. Proc Natl Acad Sci USA. 105:1608–1613. 2008. View Article : Google Scholar : PubMed/NCBI |
