Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
April-2016 Volume 35 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2016 Volume 35 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Chromosomal aberrations and prognosis in patients with concomitant chemoradiotherapy for resected head and neck cancer

  • Authors:
    • Sung‑Won Park
    • Young‑Hoon Joo
    • Seung‑Hyun Jung
    • Seon‑Hee Yim
    • In‑Chul Nam
    • Kwang‑Jae Cho
    • Min‑Sik Kim
    • Yeun‑Jun Chung
  • View Affiliations / Copyright

    Affiliations: Integrated Research Center for Genome Polymorphism College of Medicine, The Catholic University of Korea, Seocho-gu, Seoul 137‑701, Republic of Korea, Department of Otolaryngology‑Head and Neck Surgery, College of Medicine, The Catholic University of Korea, Seocho-gu, Seoul 137‑040, Republic of Korea
  • Pages: 2207-2215
    |
    Published online on: January 26, 2016
       https://doi.org/10.3892/or.2016.4595
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Although concomitant chemoradiotherapy (CCRT) has recently become a mainstay of a primary treatment modality in advanced head and neck squamous cell carcinoma (HNSCC), some of the patients experience CCRT failure. If we can predict the CCRT outcomes, we can reduce unnecessary CCRT avoiding risk of CCRT‑related complication. We aimed to identify genetic alteration markers related to treatment failure in HNSCC patients who underwent radical surgery and CCRT. Genome‑wide copy number alterations (CNAs) were analyzed in 18 HNSCC patients with (n=9) or without (n=9) recurrence using oligoarray‑comparative genomic hybridization and candidate CNAs were validated by quantitative RT‑PCR. A total of 15 recurrently altered regions (RARs) were identified in the 18 HNSCC cases. Among them, two RARs were significantly associated with CCRT‑failure: copy number gained RARs of 7p11.2 harboring EGFR (P=0.029) and 18p11.32 harboring TYMS gene (P=0.029). Three RARs (7p11.2, 9p21.3 and 18p11.32) were significantly associated with poor disease‑specific survival in univariate analysis, and 7p11.2 was consistently significant in the multivariate analysis (HR 40.68, P=0.003). In conclusion, we defined novel genomic alterations associated with CCRT‑failure: 7p11.2 (EGFR) and 18p11.32 (TYMS). Our results provide useful clues for the elucidation of the molecular pathogenesis of HNSCC and to predict CCRT‑failure.

Introduction

Head and neck squamous cell carcinoma (HNSCC) is one of the aggressive malignancies and a majority of the HNSCC patients belong to advanced stage with less than 50% of long-term survival (1). Treatment of advanced-stage HNSCC has undergone substantial changes in recent years. Combined modality treatments including radical surgery and various regimens of concomitant chemoradiotherapy (CCRT) have been used to improve locoregional control and distant metastases of the cancer (1). However, even though CCRT has recently become a mainstay of a primary treatment modality in advanced HNSCC, some of the patients may experience cancer recurrence and CCRT protocols can lead to some serious complications such as swallowing dysfunction resulting in permanent gastrostomy tube dependence (2). Therefore, if we can distinguish the patients who would benefit from CCRT after the surgery, from those that will not, before applying it, we would reduce unnecessary CCRT thus avoiding risk of CCRT-related complication.

Several molecular-genetic factors have been suggested to be potentially contributing to the resistance to CCRT. For example, CCRT-resistant HNSCCs showed a high rate of p53 aberrations and increased expression of MDM2, which confers tumor cell survival after CCRT-induced cytotoxic stress (3,4). Expression levels of hMLH1 and RKIP were also reported to be predictive of responsiveness to CCRT in head and neck cancers (5,6). Clinical factors such as the serum LDH and hemoglobin levels have been suggested as prognostic factors after CCRT (7,8).

Chromosomal copy number alteration (CNA), both amplification and deletion, is one of the hallmarks of cancer including HNSCC. Amplifications of the genes involved in detoxification of chemotherapeutic agents or deletions of the genes involved in DNA repair have been reported to be associated with CCRT-resistance (9). More specifically, gains of 3q11-q13, 3q21-q26.1 and 6q22-q27, and losses of 3p11-pter and 4p11-pter were reported to be significantly associated with CCRT resistance in HNSCC by comparative genomic hybridization (CGH) analysis (10). However, due to its limited resolution, the information from CGH analyses has not been detailed enough to identify the causative genes. Two genome-wide analyses, microarray based CGH (array-CGH) and next generation sequencing (NGS), are currently the best tools with much improved resolution for detecting CNAs precisely. In terms of detecting CNAs, it is widely accepted that array-CGH is relatively more matured and cost-effective technology than NGS (11). However, there has been no report exploring CNA profiles in HNSCCs with CCRT and their prognostic implications through high resolution array-CGH.

To explore genetic alterations predicting the responsiveness to radical surgery plus postoperative CCRT in HNSCC patients, we analyzed the CNAs across the whole genome using oligoarray-CGH for the HNSCC patients who had been administered postoperative CCRT.

Materials and methods

Patients and tumor samples

We retrospectively selected 18 patients who were diagnosed with HNSCC and underwent primary tumor resection and neck dissection followed by CCRT at the Department of Otolaryngology-Head and Neck Surgery from April 2008 to June 2012. Tumor stage was determined according to the standard tumor-node-metastasis classification of AJCC guidelines (7th edition). Frozen tissues (tumor and adjacent normal tissue pairs) were obtained from the patients with previously untreated HNSCC. Indications for adjuvant CCRT are as follows: positive or close margins found on the resection, advanced T stage, lymphovascular invasion, perineural invasion, multiple nodal metastasis, or extracapsular spread. All 18 HNSCC patients received postoperative radiotherapy (RT) that consisted of conventionally fractionated doses of 1.8–2 Gy each in five weekly sessions. A volume including the primary tumor site and all the draining lymph nodes at risk received a dose of 50–55 Gy. Regions that had an inadequate resection margin, extracapsular nodal spread or the initially involved lymph node area were boosted up to 65 Gy. The patients received chemotherapy that consisted of 100 mg cisplatin/m2 of body-surface area on days 1, 22 and 43 during RT or weekly 30 mg cisplatin/m2 of body surface area. The Institutional Review Board of Seoul St. Mary's Hospital approved the retrospective review of the medical records and the use of archived tumor specimens.

Array comparative genomic hybridization

For array-CGH analysis, 10-µm-thick frozen sections of tumor cell-rich areas (>60%) were microdissected. Genomic DNA was extracted from these sections using a DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany). The Agilent SurePrint G3 Human CGH Microarray kit, 4×180K (Agilent technologies, Santa Clara, CA, USA) was used for the array-CGH analysis. This array contains 180,880 probes with a median probe spacing of 13 kb. The array hybridization procedure was performed as described elsewhere (12). In brief, 1 µg of genomic DNA (gDNA) from tumor tissue was labeled with Cy5-dCTP and 1 µg of gDNA from paired normal tissue with Cy3-dCTP. After purifying the labeled product by using Amicon Ultra-0.5 centrifugal Filter Device (Millipore, Billerica, MA, USA), the labeled DNA was applied on the Agilent 4×180K array with the blocking agent (Agilent technologies, Santa Clara, CA, USA) containing 50 µg of human Cot-1 DNA (HybMasker, ConnectaGen, Korea). Array slides were incubated for 24 h at 65°C in the hybridization oven. After the hybridization, the arrays were washed with wash buffer 1 and 2 according to the manufacturer's protocol and scanned using High-Resolution Microarray Scanner (Agilent technologies).

Determination of CNAs and recurrently altered regions

Microarray hybridization images were analyzed with Feature Extraction Software version 10.7.3.1 using CGH-107-Sep09 protocol for normalization as described previously (12). Data quality was assessed using CGH_QCTM_Sep09 QC metric set. Only the data that passed the quality check (in good or excellent range) was used for CNA calling. CNAs of samples were defined using the ADM-2 algorithm in Agilent Genomic Workbench Lite Edition 6.0 software (Agilent technologies). CNAs were defined using the following criteria; a minimum number of probes in region=3, a maximum number of probes in aberrant region=100,000, a signal intensity ratio of >0.3 in log2 scale for gains, and of <−0.3 in log2 scale for losses. High-level amplification was defined as a probe signal intensity ratio of 1 or higher in log2 scale. Likewise, a homozygous deletion (HD) was defined as a ratio of -1 or lower in log2 scale. After defining CNAs, recurrently altered regions (RAR) were defined using the CNVRuler program as chromosomal segments consisting of multiple overlapping CNAs found in ≥30% of the samples (13).

Real-time quantitative PCR (qPCR) analysis

We performed qPCR validation of candidate RARs using the gDNA extracted from 18 pairs of head and neck cancer/normal tissues. As a diploid internal control, we used a genomic region on chromosome 13 (13q32.1) which was observed to have no genomic alteration in the array-CGH data. Sequence and location of primers used for the genomic qPCR experiment are as follows. RAR-G2 (7p12.1-p11.2 containing EGFR) forward, TTTGCCAAGGCACGAGTAA and reverse, CAAGGACCACCTCACAGTTATT; RAR-G8 (18p11.32 containing TYMS) forward, ATGTGGTGAACAGTGAGCTGTCCT and reverse, AATCA TGTACGTGAGCAGGGCGTA; RAR-L4 (9p21.3 containing CDKN2A/B) forward, TTTGGAGGACAAGCTGGTGCA ATG and reverse, TCCCAGATGAGGACAATGAGGCAA; Diploid control (16p12.2), forward, GACCTACCCACTTTCAACTCTG and reverse, CTCTCCAAGCGCAAGGTATT. Genomic qPCR were performed using ViiA 7 Real-Time PCR System and ViiA 7 RUO software (Applied Biosystems, Foster City, CA, USA) as described previously (14). In brief, qPCR mixture of 10 µl contains 10 ng of gDNA, Maxima® SYBR-Green qPCR Master Mix (2X), ROX solution provided (Fermentas, Foster, CA, USA), and 5 pmol primers. Thermal cycling conditions consist of one cycle of 10 min at 95°C, followed by 40 cycles of 5 sec at 95°C, 10 sec at 61°C and 20 sec at 72°C. The dissociation value of the amplified PCR product was measured as the temperature inched up at a rate of 0.1°C/sec from 55°C to 95°C. All qPCR experiments were triplicated and relative quantification was performed by the 2−ΔΔCT (15). Relative ratios were used to determine whether the status of a CNA is copy number gain (>2) or loss (<0.5).

Statistical analysis

To explore associations of chromosomal copy number changes and clinicopathologic phenotypes, phenotype variables were treated as categorical variables, that is, age, gender, primary site, histologic grade, T stage, cervical lymph node metastasis, presence or absence of lymphovascular invasion, extracapsular spread and recurrence. Differences in the distributions of RARs for each categorical variable were tested using two-sided Fisher's exact test. Disease-specific survival was determined using the Kaplan-Meier method. The Cox proportional hazards model with likelihood ratio statistics was used to identify variables significantly and independently related to survival. P<0.05 was considered to indicate a statistically significant difference, and all calculations were performed using SPSS version 16.0 (SPSS, Chicago, IL, USA).

Results

Clinicopathological characteristics

The median age was 59.2 years (range, 49–77 years) and all patients were males. The sites of the original primary tumor were oral cavity (11.1%), oropharynx (44.4%), larynx (16.7%) and hypopharynx (27.8%). A majority of them (17/18, 94.4%) were stage T2 and T3, and sixteen patients (89.0%) were cervical lymph node positives. Thirteen patients (72.2%) were lymphovascular invasion positives and nine (50.0%) had extracapsular spread of a metastatic neck node. A total of nine patients (50.0%) had tumor recurrence after CCRT. There was no clinicopathological factors significantly associated with the treatment failure defined as tumor recurrence. Details of clinicopathological characteristics of the study subjects are summarized in Table I.

Table I

Clinicopathological characteristics of the 18 HNSCC patients.

Table I

Clinicopathological characteristics of the 18 HNSCC patients.

ParameterNo. of patients (%)
Age (years)
 ≥607 (38.9)
 <6011 (61.1)
Gender
 Male18 (100)
 Female0 (0)
Primary tumor
 Oral cavity2 (11.1)
 Oropharynx8 (44.4)
 Larynx3 (16.7)
 Hypopharynx5 (27.8)
T stage
 T11 (5.6)
 T211 (61.1)
 T36 (33.3)
Cervical lymph node stage
 N02 (11.1)
 N14 (22.2)
 N211 (61.1)
 N31 (5.6)
Histologic grade
 Well differentiated2 (11.1)
 Moderate differentiated15 (83.3)
 Poorly differentiated1 (5.6)
Lymphovascular invasion
 Yes13 (72.2)
 No5 (27.8)
Extracapsular spread
 Yes9 (50.0)
 No9 (50.0)
Margin involvement
 Yes3 (16.7)
 No15 (83.3)
Recurrence
 Yes9 (50.0)
 No9 (50.0)
Copy number alteration profiles in HNSCC

The overall frequency plot of the CNAs detected in the 18 HNSCCs (9 with and 9 without recurrence) showed that CNAs were not randomly distributed but rather clustered in certain chromosomal segments across the genome (Fig. 1A). The mean number of CNAs per each HNSCC genome was 41.3±18.6. Patients with recurrence had more CNAs than those without recurrence (mean frequency 57.3±24.9 vs. 25.3±7.2), but the difference did not reach statistical significance. As a whole, 8 chromosomal arms were recurrently (appeared in ≥2 cases) gained on: 2p (11%), 3q (28%), 5p (11%), 7p (11%), 8q (11%), 12p (11%), 18p (11%) and 22q (11%). Also, 8 chromosomal arms were recurrently deleted: 1p (11%), 3p (22%), 4p (11%), 5q (22%), 10p (17%), 13q (17%), 14q (11%) and 21q (17%). Of the recurrent chromosomal arm changes, copy number gains on 7p, 8q and 18p were observed only in the treatment failure group but these differences were not statistically significant.

Figure 1

Genome-wide profiles and frequency plot of chromosomal alterations and number of CNAs in 18 HNSCC. Total frequencies of copy number gains and losses in 18 HNSCCs (A) and frequency of alteration in recurrence (upper plot) or non-recurrence (lower plot) after CCRT (B). The green bars denote the copy number gains and the red bars denote the copy number losses. Boundaries of individual chromosomes are indicated by vertical bars.

Recurrently altered chromosomal regions

In addition to the entire chromosomal arm changes, many of the CNAs were regional changes. Some of them were observed recurrently, suggesting their potential contribution to tumorigenesis and progression. To identify the commonly implicated CNAs, we defined RARs. In the present study, chromosomal segments as the union of overlapping CNAs in ≥20% of the 18 HNSCCs were defined as RARs (RAR-G for gains and RAR-L for losses, respectively). A total of 15 RARs (8 RAR-Gs and 7 RAR-Ls) were identified in the 18 HNSCC patients (Table II). Fig. 2 illustrates the RAR-G on 7p11.2 and RAR-L on 9p21.3 as examples. Of the 15 RARs, a RAR-G on 7p11.2 (RAR-G2: 4.22 Mb-sized, 55.6% in recurrence group vs. 0% in non-recurrence group, P=0.029), and a RAR-G on 18p11.32 (RAR-G8: 4.35 Mb-sized, 44.4% in recurrence group vs. 0% in non-recurrence group, P=0.029) were significantly more common in the HNSCC with recurrence group than in the HNSCC without recurrence group. The well-known oncogene EGFR (7p11.2) and the potential oncogene TYMS (18p11.32) are located in the recurrence-group dominant RAR-Gs. A RAR-L on 9p21.3 (0.42 Mb-sized RAR-L4), where CDKN2A/B are located, more commonly occurred in the HNSCC with recurrence group (44.4%) than in non-recurrence group (22.2%) but it was not statistically significant. To validate the three recurrence group dominant RARs identified by array-CGH, we performed genomic qPCR validations for those loci (7p11.2, 9p21.3 and 18p11.32). All the CNAs identified by array-CGH were consistently detected by the qPCR and as a whole 93.9% (46/49) of the qPCR results were consistent with the copy number status by array-CGH (data not shown).

Figure 2

Examples of recurrently altered regions. RAR-G on 7p11.2 (A) and RAR-L on 9p21.3 (B). Upper plot illustrates the recurrence group and lower plot illustrates non-recurrence group after CCRT. Black bars, CNAs of each HNSCC. Gray areas, RARs on 7p11.2 and 9p21.3. Yellow areas, EGFR and CDKN2A/B gene loci in those RARs.

Table II

Recurrently altered regions in 18 HNSCC.

Table II

Recurrently altered regions in 18 HNSCC.

RARsChrPosition (Mb)Size (Mb)CytobandRecur n (%)Non-re n (%)Total n (%)P-valueCancer-related genes
RAR-G13134.3–197.863.533q22.2-q293 (33.3)5 (55.5)8 (44.4)0.347PIK3CA, PIK3CB, BCL6, EIF4A2, ETV5, FOXL2, LPP, MLF1, PIK3CA, SOX2, TBL1XR1, TFRC, WWTR1
RAR-G2753.3–57.64.227p12.1-p11.25 (55.6)0 (0)5 (27.8) 0.029*EGFR
RAR-G38128.2–128.90.678q24.213 (33.3)3 (33.3)6 (33.3)1.000MYC
RAR-G48142.7–146.33.648q24.33 (33.3)4 (44.4)7 (38.9)0.637RECQL4
RAR-G51170.5–70.90.4411q13.43 (33.3)1 (11.1)4 (22.2)0.576-
RAR-G6120.2–7.37.11 12p13.33-p13.313 (33.3)1 (11.1)4 (22.2)0.576FGF23, FGF6, CCND2, ZNF384
RAR-G71220.1–20.60.5712p12.23 (33.3)1 (11.1)4 (22.2)0.576PIK3C2G
RAR-G8180.1–4.54.35 18p11.32-p11.314 (44.4)0 (0)4 (22.2)0.029TYMS, YES1
RAR-L1359.4–71.111.743p14.2-p131 (11.1)3 (33.3)4 (22.2)0.294FHIT, MITF, ADAMTS9
RAR-L2564.1–70.76.525q12.3-q13.23 (33.3)1 (11.1)4 (22.2)0.576PIK3R1, ADAMTS6, CDK7, CENPH, CENPK, ERBB2IP, MAST4, OCLN, PIK3R1, PPWD1, RAD17, TRIM23
RAR-L384.4–4.80.468p23.23 (33.3)1 (11.1)4 (22.2)0.576-
RAR-L4921.7–22.10.429p21.34 (44.4)2 (22.2)6 (33.3)0.620 CDKN2A/B
RAR-L5100.1–3.73.5410p15.3-p15.23 (33.3)1 (11.1)4 (22.2)0.576-
RAR-L611104.6–105.91.2411q22.31 (11.1)3 (33.3)4 (22.2)0.294-
RAR-L71320.1–21.00.9313p12.113 (33.3)1 (11.1)4 (22.2)0.576-

[i] Recur, recurrence group; Non-re, non-recurrence group.

High-level CNAs in HNSCC

Of the CNAs identified in the 18 HNSCCs, 25 loci were found to be high-level CNAs (defined as ≥1 for amplification or ≤−1 for HD on the log2 scale), with 15 amplifications and 10 HDs (Table III). Five high-level CNAs were detected in >20% of the samples; amplifications on 7p11.2 and 11q13.3, and HDs on 1p31.1, 4q13.2 and 9p21.3, respectively (Table III). Well-known oncogenes (EGFR and CCND1) and tumor suppressor gene (CDKN2A/B) are located in the recurrent (>20%) high-level CNA regions.

Table III

High-level copy number changes in HNSCC.

Table III

High-level copy number changes in HNSCC.

CNAsChrPosition (MP)Size (Mb)CytobandFreq % (Recur)Freq % (Non-re)Freq % (Total)Cancer-related genes
Amp1159.96–61.931.97p32.1-p31.311.10.011.1–
Amp23181.62–183.181.56q26.33-q27.111.10.011.1–
Amp37 54.87–56.571.70p11.222.20.022.2 EGFR
Amp4764.10–66.632.53q11.2111.10.011.1SBDS
Amp51035.15–36.000.85p11.210.011.111.1–
Amp61055.04–55.130.09q21.111.10.011.1–
Amp711 69.48–69.570.09q13.322.211.133.3 CCND1
Amp81184.35–84.550.20q14.10.011.111.1–
Amp911100.89–101.440.55q22.10.011.111.1–
Amp101364.76–67.462.70q21.31-q21.3211.10.011.1–
Amp111373.64–74.370.73q22.111.10.011.1–
Amp121377.48–78.100.62q22.311.10.011.1–
Amp131651.03–53.372.34q12.1-q12.20.011.111.1–
Amp141746.30–46.990.69q21.3211.10.011.1–
Amp15180.12–4.474.35p11.3211.10.011.1–
HD11 72.77–72.800.03p31.111.111.122.2–
HD22141.17–141.270.10q22.111.10.011.1–
HD334.13–4.490.36p26.111.10.011.1–
HD43162.51–162.620.10q26.111.10.011.1–
HD54 69.39–69.460.07q13.211..111.122.2–
HD6581.35–81.520.17q14.1-q14.20.011.111.1–
HD782.76–3.180.42p23.211.10.011.1–
HD89 21.96–22.030.07p21.322.211.133.3 CDKN2A
HD91088.47–90.752.28q23.2-q23.3111.10.011.1BMPR1A, PTEN
HD101112.32–12.940.62p15.3-p15.20.011.111.1–

[i] Amp, amplification; HD, homozygous deletion; Recur, recurrence group; Non-re, non-recurrence group. Bold, total frequency >20%.

RARs associated with the prognosis in HNSCC

Univariate survival analysis was performed to assess the implications of the RARs on patient survival. Univariate analysis was also performed to identify clinicopathologic features (age, gender, primary site, histologic grade, T stage, cervical lymph node metastasis, lymphovascular invasion, extracapsular spread and recurrence) for inclusion as covariates for Cox regression. Five-year disease-specific survival rates (DSSR) in our cohort were 66%. Among the RARs and clinicopathologic factors, cervical lymph node metastasis (P=0.008), recurrence (P=0.003), RAR-G2 (P<0.001), RAR-G8 (P<0.001), and RAR-L4 (P=0.037) were significantly associated with poor DSSR in the univariate analysis (Fig. 3). Multivariate analysis with the three significant RARs and two clinical variables identified on univariate analysis revealed that RAR-G2 [hazard ratio (HR)=40.68, 95% confidence interval (CI): 3.56–464.69, P=0.003] and cervical metastasis (HR=16.38, 95% CI: 1.20–223.11, P=0.036) were significantly associated with poor DSSR (Table IV).

Figure 3

Kaplan-Meier curves by RAR status in the univariate analysis. RAR-G on 7p11.2 harboring EGFR gene (A), RAR-G on 18p11.32 harboring TYMS gene (B) and RAR-L on 9p21.3 harboring CDKN2A/B (C).

Table IV

Results of multivariate analysis.

Table IV

Results of multivariate analysis.

VariablesHR95% CI
P-value
LowerUpper
Cervical metastasis16.381.20223.110.036
Recurrence0.9400.0017.300.332
RAR-G0240.683.56464.690.003
RAR-G082.160.1622.460.142
RAR-L041.210.007.760.217

[i] HR, hazard ratio; CI, confidence interval.

Discussion

Despite the various treatment modalities, the poor prognosis of HNSCC has not improved significantly over the last four decades (16). The lack of success in HNSCC treatment may be primarily due to lack of understanding on the etiology and heterogeneous nature of HNSCC. In the present study, we aimed to explore CNA profiles associated with the resistance after CCRT in HNSCCs. For this, we analyzed the CNAs using high-resolution array-CGH (180K oligoarray) and delineated RARs under the assumption that commonly altered chromosomal segments in CCRT-resistant subgroup may contain essential genes contributing to CCRT resistance. Through this approach, we identified the genetic markers predicting the responsiveness to CCRT following surgery in HNSCC patients.

The key alterations identified in the present study, such as amplifications of PIK3CA, EGFR and MYC and deletions of CDKN2A/B and FHIT, were consistent with previous observations in HNSCC, suggesting the reliability of our study (10,12,17,18). We also identified several novel RARs which have not been reported to be associated with HNSCC previously; RAR-Gs in 12p13 and 12p12 harboring FGF6, FGF23 and PIK3C2G genes and a RAR-L in 8p23.2 harboring CSMD1 gene. To validate the array-CGH results, we performed genomic qPCR validation for the three interesting RARs (RAR-G2, RAR-G8 and RAR-L4) identified by array-CGH and all of the CNAs were consistently defined in the qPCR, suggesting the reliability of our array-CGH analysis and advantage of higher resolution array analysis.

Two RARs, RAR-G2 (7p11.2 encompassing EGFR) and RAR-G8 (18p11.32 encompassing TYMS), were significantly more common in the HNSCC patients with recurrence (CCRT non-responders) than in those without recurrence (CCRT-responders). In the observations of Gao et al, EGFR overexpression was associated with poor survival in HNSCC patients receiving CCRT (19). Szabó et al examined expression and genetic alteration of EGFR gene by FISH with 71 HNSCC patients and observed that increased copy number and overexpression of the EGFR gene was associated with poor prognosis in HNSCC (20). However, neither group examined the CNAs involving the responsiveness to CCRT in terms of recurrence. To our knowledge, this is the first report which explored the CNA profiles across the whole genome in HNSCC using high-resolution array-CGH and demonstrated that the copy number gain of 17p11.2 containing EGFR was significantly associated with the CCRT failure. When we assessed the prognostic implications of RARs, the RAR-G2 containing EGFR was the only significantly associated with poor DSSR in multivariate analysis. Previously, increased copy number of EGFR gene was also strongly associated with poorer survival, both overall and recurrence-free, in HNSCC (21).

In addition to the EGFR, the copy number gain of TYMS (RAR-G8), which codes thymidylate synthase, was also found to be significantly more common in the CCRT non-responders. TYMS catalyzes the conversion of dUMP to dTMP, which is essential for DNA biosynthesis (22). Consistent with our finding, overexpression of TYMS, caused by gene amplification, has been reported to be associated with poor prognosis and resistance to chemotherapeutic agents that target thymidylate biosynthesis such as 5-FU (23–25). In the study of Yasumatsu et al exploring the effect of TYMS knockdown in a HNSCC cell line (YCU-N), repressed expression of TYMS increased the cytotoxicity of 5-FU and inhibited cell proliferation (26). These data consistently suggest the implication of copy number gain of TYMS in acquiring resistance to 5-FU, which may contribute to the resistance to CCRT.

In this study, a copy number loss of 0.46 Mb-sized locus in 8p23.2, where CSMD1 gene is located, were recurrently observed in the HNSCC patients. The deletion of 8p23 locus has been frequently reported in HNSCCs and through the deletion mapping analysis, CSMD1 gene in this locus has been suggested as a tumor suppressor (27–29). The deletion of CSMD1 has been also frequently reported in diverse solid tumors and the underexpression of CSMD1 was reported to be associated with poor prognosis or higher tumor grade (30–32). Although copy number loss of CSMD1 gene did not show significant association with CCRT-resistance in our study, there was a tendency of non-responder dominance (3 in non-responders vs. 1 in responders). To our knowledge, this is the first report to identify the frequent copy number loss of CSMD1 gene in HNSCC with CCRT resistance. Larger scale analysis will be required to verify this possibility.

In spite of the interesting findings, there were several limitations to the present study. First of all, due to the limited number of patients treated with primary surgery plus CCRT, some potential CCRT-associated CNAs could be missed. Second, the median follow-up period of this study was relatively short. Prospective, randomized studies using a larger sample will be required to assess the implications of the CNAs identified in the present study on clinical results following different treatment modalities.

In conclusion, we successfully defined novel recurrent genomic alteration regions and known copy number changes in 18 HNSCC with a well-designed high-resolution array CGH. Copy number gain of EGFR (RAR-G2) and TYMS (RAR-G8) were associated with CCRT failure and RAR-G2 was also found to be an independent factor of poor DSSR in HNSCC. Our results and the strategy of analysis will provide useful clues for further studies to elucidate the molecular pathogenesis of HNSCC and to develop biomarkers for designing personalized treatment by predicting the prognosis.

Acknowledgments

The present study was supported by the Cancer Evolution Research Center (grant no. 2012R1A5A2047939) and the Institute of Clinical Medicine Research of Bucheon St. Mary's Hospital Research Fund, 2015.

References

1 

Pignon JP, Bourhis J, Domenge C and Designé L: Chemotherapy added to locoregional treatment for head and neck squamous-cell carcinoma: Three meta-analyses of updated individual data. MACH-NC Collaborative Group Meta-Analysis of Chemotherapy on Head and Neck Cancer. Lancet. 355:949–955. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Smith RV, Kotz T, Beitler JJ and Wadler S: Long-term swallowing problems after organ preservation therapy with concomitant radiation therapy and intravenous hydroxyurea: Initial results. Arch Otolaryngol Head Neck Surg. 126:384–389. 2000. View Article : Google Scholar : PubMed/NCBI

3 

Cinelli M, Magnelli L and Chiarugi V: Redundant down-regulation pathways for p53. Pharmacol Res. 37:83–85. 1998. View Article : Google Scholar : PubMed/NCBI

4 

Osman I, Sherman E, Singh B, Venkatraman E, Zelefsky M, Bosl G, Scher H, Shah J, Shaha A, Kraus D, et al: Alteration of p53 pathway in squamous cell carcinoma of the head and neck: Impact on treatment outcome in patients treated with larynx preservation intent. J Clin Oncol. 20:2980–2987. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Nam TK, Lee JH, Cho SH, Chung IJ, Ahn SJ, Song JY, Yoon MS, Chung WK and Nah BS: Low hMLH1 expression prior to definitive chemoradiotherapy predicts poor prognosis in esophageal squamous cell carcinoma. Cancer Lett. 260:109–117. 2008. View Article : Google Scholar

6 

Li SW, Wang H, Liu ML, Zhang HB, Xiang YQ, Lv X, Xia WX, Zeng MS, Mai HQ, Hong MH, et al: Positive effect of high RKIP expression on reduced distant metastasis by chemotherapy when combined with radiotherapy in locoregionally advanced nasopharyngeal carcinoma: A prospective study. Med Oncol. 30:3222013. View Article : Google Scholar

7 

Cheng SH, Jian JJ, Tsai SY, Chan KY, Yen LK, Chu NM, Tan TD, Tsou MH and Huang AT: Prognostic features and treatment outcome in locoregionally advanced nasopharyngeal carcinoma following concurrent chemotherapy and radiotherapy. Int J Radiat Oncol Biol Phys. 41:755–762. 1998. View Article : Google Scholar : PubMed/NCBI

8 

Chen C, Chen S, Le QT, Chen J, Chen Z and Li D, Zhou M and Li D: Prognostic model for distant metastasis in locally advanced nasopharyngeal carcinoma after concurrent chemoradiotherapy. Head Neck. 37:209–214. 2015. View Article : Google Scholar

9 

Wang TL, Diaz LA Jr, Romans K, Bardelli A, Saha S, Galizia G, Choti M, Donehower R, Parmigiani G, Shih IeM, et al: Digital karyotyping identifies thymidylate synthase amplification as a mechanism of resistance to 5-fluorouracil in metastatic colorectal cancer patients. Proc Natl Acad Sci USA. 101:3089–3094. 2004. View Article : Google Scholar : PubMed/NCBI

10 

van den Broek GB, Wreesmann VB, van den Brekel MW, Rasch CR, Balm AJ and Rao PH: Genetic abnormalities associated with chemoradiation resistance of head and neck squamous cell carcinoma. Clin Cancer Res. 13:4386–4391. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Przybytkowski E, Aguilar-Mahecha A, Nabavi S, Tonellato PJ and Basik M: Ultradense array CGH and discovery of micro-copy number alterations and gene fusions in the cancer genome. Methods Mol Biol. 973:15–38. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Joo YH, Park SW, Jung SH, Lee YS, Nam IC, Cho KJ, Park JO, Chung YJ and Kim MS: Recurrent loss of the FHIT gene and its impact on lymphatic metastasis in early oral squamous cell carcinoma. Acta Otolaryngol. 133:992–999. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Kim JH, Hu HJ, Yim SH, Bae JS, Kim SY and Chung YJ: CNVRuler: A copy number variation-based case-control association analysis tool. Bioinformatics. 28:1790–1792. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Jung SH, Yim SH, Hu HJ, Lee KH, Lee JH, Sheen DH, Lim MK, Kim SY, Park SW, Kim SH, et al: Genome-wide copy number variation analysis identifies deletion variants associated with ankylosing spondylitis. Arthritis Rheumatol. 66:2103–2112. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

16 

Oddone N, Morgan GJ, Palme CE, Perera L, Shannon J, Wong E, Gebski V and Veness MJ: Metastatic cutaneous squamous cell carcinoma of the head and neck: The Immunosuppression, Treatment, Extranodal spread, and Margin status (ITEM) prognostic score to predict outcome and the need to improve survival. Cancer. 115:1883–1891. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Bernaldo de Quirós S, Merlo A, Secades P, Zambrano I, de Santa María IS, Ugidos N, Jantus-Lewintre E, Sirera R, Suarez C and Chiara MD: Identification of TRPC6 as a possible candidate target gene within an amplicon at 11q21-q22.2 for migratory capacity in head and neck squamous cell carcinomas. BMC Cancer. 13:1162013. View Article : Google Scholar : PubMed/NCBI

18 

Shi ZZ, Shang L, Jiang YY, Hao JJ, Zhang Y, Zhang TT, Lin DC, Liu SG, Wang BS, Gong T, et al: Consistent and differential genetic aberrations between esophageal dysplasia and squamous cell carcinoma detected by array comparative genomic hybridization. Clin Cancer Res. 19:5867–5878. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Gao Z, Meng X, Mu D, Sun X and Yu J: Prognostic significance of epidermal growth factor receptor in locally advanced esophageal squamous cell carcinoma for patients receiving chemoradiotherapy. Oncol Lett. 7:1118–1122. 2014.PubMed/NCBI

20 

Szabó B, Nelhubel GA, Kárpáti A, Kenessey I, Jóri B, Székely C, Peták I, Lotz G, Hegedus Z, Hegedus B, et al: Clinical significance of genetic alterations and expression of epidermal growth factor receptor (EGFR) in head and neck squamous cell carcinomas. Oral Oncol. 47:487–496. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Chung CH, Ely K, McGavran L, Varella-Garcia M, Parker J, Parker N, Jarrett C, Carter J, Murphy BA, Netterville J, et al: Increased epidermal growth factor receptor gene copy number is associated with poor prognosis in head and neck squamous cell carcinomas. J Clin Oncol. 24:4170–4176. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Wilson PM, Danenberg PV, Johnston PG, Lenz HJ and Ladner RD: Standing the test of time: Targeting thymidylate biosynthesis in cancer therapy. Nat Rev Clin Oncol. 11:282–298. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Johnston PG, Fisher ER, Rockette HE, Fisher B, Wolmark N, Drake JC, Chabner BA and Allegra CJ: The role of thymidylate synthase expression in prognosis and outcome of adjuvant chemotherapy in patients with rectal cancer. J Clin Oncol. 12:2640–2647. 1994.PubMed/NCBI

24 

Murata S, Adachi M, Kioi M, Torigoe S, Ijichi K, Hasegawa Y, Ogawa T, Bhayani MK, Lai SY, Mitsudo K, et al: Etodolac improves 5-FU sensitivity of head and neck cancer cells through inhibition of thymidylate synthase. Anticancer Res. 31:2893–2898. 2011.PubMed/NCBI

25 

Yeh KH, Shun CT, Chen CL, Lin JT, Lee WJ, Lee PH, Chen YC and Cheng AL: High expression of thymidylate synthase is associated with the drug resistance of gastric carcinoma to high dose 5-fluorouracil-based systemic chemotherapy. Cancer. 82:1626–1631. 1998. View Article : Google Scholar : PubMed/NCBI

26 

Yasumatsu R, Nakashima T, Uryu H, Ayada T, Wakasaki T, Kogo R, Masuda M, Fukushima M and Komune S: Correlations between thymidylate synthase expression and chemosensitivity to 5-fluorouracil, cell proliferation and clinical outcome in head and neck squamous cell carcinoma. Chemotherapy. 55:36–41. 2009. View Article : Google Scholar

27 

Sunwoo JB, Sun PC, Gupta VK, Schmidt AP, El-Mofty S and Scholnick SB: Localization of a putative tumor suppressor gene in the sub-telomeric region of chromosome 8p. Oncogene. 18:2651–2655. 1999. View Article : Google Scholar : PubMed/NCBI

28 

Ishwad CS, Shuster M, Bockmühl U, Thakker N, Shah P, Toomes C, Dixon M, Ferrell RE and Gollin SM: Frequent allelic loss and homozygous deletion in chromosome band 8p23 in oral cancer. Int J Cancer. 80:25–31. 1999. View Article : Google Scholar : PubMed/NCBI

29 

Toomes C, Jackson A, Maguire K, Wood J, Gollin S, Ishwad C, Paterson I, Prime S, Parkinson K, Bell S, et al: The presence of multiple regions of homozygous deletion at the CSMD1 locus in oral squamous cell carcinoma question the role of CSMD1 in head and neck carcinogenesis. Genes Chromosomes Cancer. 37:132–140. 2003. View Article : Google Scholar : PubMed/NCBI

30 

Ma C, Quesnelle KM, Sparano A, Rao S, Park MS, Cohen MA, Wang Y, Samanta M, Kumar MS, Aziz MU, et al: Characterization CSMD1 in a large set of primary lung, head and neck, breast and skin cancer tissues. Cancer Biol Ther. 8:907–916. 2009. View Article : Google Scholar : PubMed/NCBI

31 

Zhang R and Song C: Loss of CSMD1 or 2 may contribute to the poor prognosis of colorectal cancer patients. Tumour Biol. 35:4419–4423. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Kamal M, Shaaban AM, Zhang L, Walker C, Gray S, Thakker N, Toomes C, Speirs V and Bell SM: Loss of CSMD1 expression is associated with high tumour grade and poor survival in invasive ductal breast carcinoma. Breast Cancer Res Treat. 121:555–563. 2010. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Park SW, Joo YH, Jung SH, Yim SH, Nam IC, Cho KJ, Kim MS and Chung YJ: Chromosomal aberrations and prognosis in patients with concomitant chemoradiotherapy for resected head and neck cancer. Oncol Rep 35: 2207-2215, 2016.
APA
Park, S., Joo, Y., Jung, S., Yim, S., Nam, I., Cho, K. ... Chung, Y. (2016). Chromosomal aberrations and prognosis in patients with concomitant chemoradiotherapy for resected head and neck cancer. Oncology Reports, 35, 2207-2215. https://doi.org/10.3892/or.2016.4595
MLA
Park, S., Joo, Y., Jung, S., Yim, S., Nam, I., Cho, K., Kim, M., Chung, Y."Chromosomal aberrations and prognosis in patients with concomitant chemoradiotherapy for resected head and neck cancer". Oncology Reports 35.4 (2016): 2207-2215.
Chicago
Park, S., Joo, Y., Jung, S., Yim, S., Nam, I., Cho, K., Kim, M., Chung, Y."Chromosomal aberrations and prognosis in patients with concomitant chemoradiotherapy for resected head and neck cancer". Oncology Reports 35, no. 4 (2016): 2207-2215. https://doi.org/10.3892/or.2016.4595
Copy and paste a formatted citation
x
Spandidos Publications style
Park SW, Joo YH, Jung SH, Yim SH, Nam IC, Cho KJ, Kim MS and Chung YJ: Chromosomal aberrations and prognosis in patients with concomitant chemoradiotherapy for resected head and neck cancer. Oncol Rep 35: 2207-2215, 2016.
APA
Park, S., Joo, Y., Jung, S., Yim, S., Nam, I., Cho, K. ... Chung, Y. (2016). Chromosomal aberrations and prognosis in patients with concomitant chemoradiotherapy for resected head and neck cancer. Oncology Reports, 35, 2207-2215. https://doi.org/10.3892/or.2016.4595
MLA
Park, S., Joo, Y., Jung, S., Yim, S., Nam, I., Cho, K., Kim, M., Chung, Y."Chromosomal aberrations and prognosis in patients with concomitant chemoradiotherapy for resected head and neck cancer". Oncology Reports 35.4 (2016): 2207-2215.
Chicago
Park, S., Joo, Y., Jung, S., Yim, S., Nam, I., Cho, K., Kim, M., Chung, Y."Chromosomal aberrations and prognosis in patients with concomitant chemoradiotherapy for resected head and neck cancer". Oncology Reports 35, no. 4 (2016): 2207-2215. https://doi.org/10.3892/or.2016.4595
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team