A novel, rapid point-of-care test for lung cancer patients to detect epidermal growth factor receptor gene mutations by using real-time droplet-PCR and fresh liquid cytology specimens
- Authors:
- Published online on: December 2, 2016 https://doi.org/10.3892/or.2016.5287
- Pages: 1020-1026
Abstract
Introduction
Lung cancer is the most common cause of cancer-related deaths worldwide, accounting for 1.8 million new cases and 1.6 million deaths in 2012 (1). During the past decade, major progress has been achieved in the treatment and management of non-small cell lung cancer (NSCLC), especially for adenocarcinomas (ADC), with the discovery of its biological and therapeutic importance of acquired genomic alterations, such as mutations in the epidermal growth factor receptor gene (EGFR) (2,3) or inversions involving the anaplastic lymphoma kinase gene (ALK) (4,5). EGFR encodes pharmacologically targetable tyrosine kinases and it has been recognized that NSCLC patients with EGFR mutations such as deletions in exon 19 and L858R in exon 21 show dramatic prolonged response to EGFR tyrosine kinase inhibitors (EGFR-TKIs), such as gefitinib or erlotinib, in clinical trials of advanced-stage lung cancer (6–8). The reliable detection of EGFR mutations is necessary for the personalized treatment of lung cancer patients.
A number of methods have been used to detect EGFR mutations in NSCLC patients (9). While the sensitivity of EGFR mutation assays has improved, the majority of these methods, however, need at least a few hours to detect EGFR mutations. In the case of obtaining EGFR test results from outside laboratories, it generally requires 7–14 days after tumor sampling. The turnaround time (TAT) for EGFR mutation testing has become increasingly important, especially for advanced-stage patients, in order to start EGFR-TKI therapy earlier. Therefore, a more rapid and simple EGFR mutation assay is needed.
Recently, we developed novel rapid assays using a real-time droplet-polymerase chain reaction (PCR) machine (Seiko Epson Corp. Head Office, Suwa, Japan) for the detection of the human influenza virus (10,11) and the promyelocytic leukemia (PML)-retinoic acid receptor α (RARA) fusion gene (12,13), for the genotyping of single nucleotide polymorphisms (14,15) and for the detection of bovine respiratory syncytial virus (16) and breakpoint cluster region (BCR)-Abelson murine leukemia viral oncogene (ABL) fusion mRNA (17). All of these assays provide a much shorter TAT than the conventional assays currently used in clinical settings while demonstrating almost the same reactivity.
The purpose of this study was to develop a novel rapid EGFR mutation assay in lung cancer patients by using a real-time droplet-PCR machine (EGFR d-PCR assay). In this study, we used fresh liquid cytology specimens, such as bronchial lavage fluid (BLF), pleural effusion (PE) and cardiac effusion (CE) from the patients, which are processed in more simple steps and a shorter time for DNA extraction than formalin-fixed paraffin-embedded (FFPE) specimens. To validate the performance of the EGFR d-PCR assay, we compared its reactivity and reaction time to a conventional real-time PCR assay. In addition, we validated the sensitivity of the EGFR d-PCR assay by using fresh liquid samples containing variable percentages of cell lines with EGFR mutations.
Materials and methods
Patients and samples
This study was reviewed and approved by the Medical Ethics Committee of Shinshu University School of Medicine (Nagano, Japan). BLF, PE and CE specimens were collected from 245 patients who were clinically diagnosed with lung cancer from January to December 2014 and the specimens provided were used for cytological diagnosis at the Department of Laboratory Medicine at the Shinshu University Hospital (Nagano, Japan). BLF specimens were obtained after transbronchial lung biopsies. PE and CE specimens were obtained by fine-needle aspiration from patients with advanced lung cancer. After cytological evaluation of the specimens from the 245 patients, we excluded the specimens that contained no malignant cells (146 patients) or cytologically diagnosed as malignant lymphoma (ML) (1 patient), metastasis of renal cell carcinoma (RCC) (1 patient), small cell carcinoma (SCC) (8 patients) and squamous cell carcinoma (SQCC) (9 patients) (Fig. 1). Specimens from the remaining 80 patients, who were cytologically diagnosed with primary lung ADC or NSCLC-not otherwise specified (NOS), were also evaluated (Fig. 2). The fresh liquid cytology specimens were centrifuged to create a cell pellet and after picking up enough of the cell pellet for the routine smear slide for cytological diagnosis, the remainder of the pellet was used for the samples in this study. DNA was extracted from the specimens using the QIAamp DNA Blood Mini kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturers instructions.
Conventional real-time PCR assay
For the reference, the conventional method to the EGFR d-PCR assay in this study, we used the Rotor-Gene Q 5plex HRM instrument with the therascreen® EGFR RGQ PCR kit (Qiagen, Inc.) (Therascreen assay). This assay is approved in the United States, Europe, Japan and China and the kit is based on the amplification-refractory mutation system (ARMS) and Scorpions PCR technologies, which enable sensitive and selective site-specific detection of 29 types of somatic mutations in the EGFR gene (18). The reaction conditions of the Therascreen assay were as follows: 95°C for 15 min for 1 cycle, 95°C for 30 sec and then 60°C for 60 sec for 40 cycles. Analysis was performed using the Rotor-Gene Q series software, version 2.0.2 (Qiagen, Inc.) and the manufacturer-supplied ΔCt thresholds were used to analyze the result of each EGFR mutation reaction. The reaction time was about 1 h and 45 min.
Real-time droplet-PCR machine used for the EGFR d-PCR assay
The real-time droplet-PCR machine has two connected heater blocks, which regulate the temperature of each end of the reaction tube (Fig. 3). The reaction temperature of the two heater blocks is consistently controlled during the denaturation and annealing/extension steps. To perform a rapid temperature transition, the reaction tube is filled with silicone oil, allowing the droplet of the PCR mixture to move easily in the tube during the mechanical rotation of the machine with the two connected heater blocks. Once the droplet transfers from the one end to the other owing to gravitation, the machine with the two heater blocks inverts to return the droplet. Therefore, the PCR mixture in the droplet is able to perform shuttle PCR in the reaction tube. The real-time droplet-PCR machine integrates a fluorescence detector and it allows monitoring of the amount of PCR products after each extension step.
Target mutations of EGFR
As for the target mutations of EGFR in this study, we selected the two most frequent mutations. One was the point mutation L858R (c.2573T>G) in exon 21 and the other was the 15-bp/5-amino acid deletion of E746_A750del (c.2235_2249del and c.2236_2250del) in exon 19. These two major mutations cover about 90% of oncogenic EGFR mutations (19). In addition, we also selected the point mutation of T790M (c.2369>T) in exon 20, which is the most common resistance mutation for EGFR-TKIs (20).
Reaction conditions of the EGFR d-PCR assay
We designed specific primers based on ARMS that induced a mutation- matched nucleotide in the 3-end and a template-mismatched nucleotide at the −2 position from the 3-end. The primers and probes used in this study are as follows (5′-3′): L858R forward, GCTTGGTGCACCGCGACCTG; reverse, CGCACCCAGCAGTTTGGCAC; probe, 6FAM-AGCCAGGAACGTACTGGTGAAAACACCGCA-BHQ-1; E746_A750del forward, GGCAGCATGTGGCACCATC; reverse, GTTGGCTTTCGGAGATGTAT; probe, 6FAM-TCTCACCTTCTGGGATCCAGAGTCCCT-BHQ-1; T790M forward, CCCCACGTGTGCCGCCTG; reverse, GCCGAAGGGCATGAGCTGTA; probe, 6FAM-TGGGCATCTGCCTCACCTCCACCGTG CA-BHQ-1.
The reaction mixture contained genomic DNA (10 ng/µl), Platinum® Taq DNA polymerase (Life Technologies, Grand Island, NY, USA), 800 nmol/l of primer designed as aforementioned, 300 nmol/l of TaqMan probe and reaction buffer composed of Tris-HCl pH 9.0, KCl and MgCl2, in a total volume of 10 µl. From the reaction mixtures, 1.6 µl was used for one reaction tube.
Each reaction condition was as follows: for L858R, 98°C for 10 sec, 40 cycles at 98°C for 5 sec and 60°C for 6 sec; for E746_A750del and T790M, 98°C for 10 sec, 40 cycles at 98°C for 5 sec and 55°C for 6 sec. The reaction time was 8 min and 10 sec.
Evaluation of the EGFR d-PCR assay results
To evaluate the PCR results as EGFR mutation-positive or -negative, we determined the arbitrary cut-off values of fluorescence level in 40 cycles, which were based on the receiver operating characteristic (ROC) curve analysis and using the Therascreen assay as ‘gold standard’. Each cut-off value was as follows: 4.7 for L858R, 4.7 for E746_A750del and 6.8 for T790M.
Compared to the EGFR d-PCR assay, which was designed to detect only E746_A750del in exon 19, the Therascreen assay can detect 19 types of deletions in exon 19 including E746_A750del, however, it cannot tell which mutation was detected among the 19 types. To examine the exact locus of the deletion in all the specimens determined as deletion positive by Therascreen assay, we performed direct sequencing for those specimens.
Sensitivity analysis of EGFR d-PCR assay
To evaluate the sensitivity of the EGFR d-PCR assay, we performed sensitivity assays using DNA mixtures extracted from the following cell lines: PC9 [E746_A750del (c.2235_2249del)], H1975 [L858R (c.2573T>G) and T790M (c.2369>T)] and A549 [EGFR wild-type]. The PC9 cell line was obtained directly from the RIKEN Cell Bank (Tsukuba, Japan). The H1975 cell line was obtained directly from the American Type Culture Collection (ATCC, Rockville, MD, USA). The A549 cell line was obtained directly from the Japanese Cancer Research Bank (Tokyo, Japan). PC9 and A549 and H1975 and A549 were mixed respectively in ratios of 1:0, 0.5:0.5, 0.1:0.9, 0.05:0.95, 0.01:0.99, 0.005:0.995, 0.001:0.999, 0.0005:0.9995, 0.0001:0.9999 and 0:1. As a result, each percentage of EGFR mutant cells in these mixtures was 100, 50, 10, 5, 1, 0.5, 0.1, 0.05, 0.01 and 0%. EGFR mutations of these mixtures were analyzed by the EGFR d-PCR assay.
Results
Characteristics of the patients and specimens
Fresh liquid cytology specimens from 80 lung cancer patients, including 77 BLF specimens, 2 PE specimens and 1 CE specimen were used in this study and the patient clinical characteristics are shown in Table I. The median age of the 80 patients was 68 years (range, 41–85 years); all of the patients were Japanese and 57 patients (71.3%) were men while 23 patients (28.7%) were women. Cytologically, 62 patients (77.5%) were diagnosed with ADC and 18 patients (22.5%) were diagnosed with NSCLC-NOS. Radiologically, the median diameter of the tumors was 34.2 mm (range, 7–132 mm). The distribution of the clinical stages at the time of diagnosis was as follows: 37 patients (46.3%) had stage I cancer, 5 patients (6.3%) had stage II, 9 patients (11.3%) had stage III and 27 patients (33.8%) had stage IV.
Comparison between the Therascreen assay and the EGFR d-PCR assay
Table II shows the comparison between the Therascreen assay and the EGFR d-PCR assay. Among the specimens from 80 patients, the Therascreen assay detected exon 21 L858R point mutations in 16 patients (20.0%), exon 19 deletions in 11 patients (13.8%), exon 20 insertion in one patient (1.3%) and exon 20 T790M point mutation in one patient (1.3%). In contrast, the EGFR d-PCR assay detected L858R in 16 patients (20.0%), E746_A750del in 8 patients (10.0%) and T790M in one patient (1.3%). The Therascreen assay but not the EGFR d-PCR assay detected exon 19 deletions in three specimens. Direct sequencing confirmed L747_S752del P753S mutation in one specimen and L747_S752del mutation in two specimens. As a result, in regards to the L858R, E746_A750del and T790M mutations, the results of the EGFR d-PCR assay were in complete concordance with those of the Therascreen assay.
Sensitivity of the novel EGFR d-PCR assay
With the EGFR d-PCR assay, the L858R mutation was detected in L858R-positive cell line mixtures (H1975 and A549) at 100, 50, 10, 5, 1 and 0.5% H1975 cells (Fig. 4A). Similarly, E746_A750del was detected in E746_A750del-positive cell line mixtures (PC9 and A549) at 100, 50, 10, 5, 1, 0.5, 0.1 and 0.05% PC9 cells (Fig. 4B). T790M was detected in T790M-positive cell line mixtures (H1975 and A549) at 100, 50, 10, 5, 1 and 0.5% H1975 cells (Fig. 4C). These results suggest that the detection limits of the EGFR d-PCR assay were 0.5% for L858R, 0.05% for E746_A750del and 0.5% for T790M.
Discussion
Numerous methods are available for EGFR mutation testing: direct sequencing, PCR-based assays such as single-strand conformation polymorphism (PCR-SSCP) (21), peptide nucleic acid-locked nucleic acid (PNA-LNA) PCR clamp assays (22), PCR-Invader (23), cycleave PCR (24), the Scorpions amplification-refractory mutation system (ARMS) (25), immunohistochemistry with EGFR mutation-specific antibodies (26), real-time PCR methods (27) and next generation sequencing (28). Each method has different sensitivity and specificity and they need at least a few hours to effectively detect EGFR mutations. In this study, we demonstrated that the EGFR d-PCR assay markedly reduced the detection time of major EGFR mutations with high sensitivity compared with conventional methods. To the best of our knowledge, the novel EGFR d-PCR assay is the most rapid detection method and a reliable test to assess the dynamics of key EGFR mutations.
In 2013, to establish an evidence-based recommendation of the molecular testing of EGFR and ALK for patients with lung cancer, three professional societies (the College of American Pathologists, the International Associations for the Study of Lung Cancer and the Association for Molecular Pathology) developed a guideline (29). The guideline recommends performing EGFR and ALK molecular testing for all patients with advanced-stage lung ADC or tumor with an ADC component. Regarding testing samples, the guideline suggested the use of cytology specimens for EGFR and ALK molecular testing, although FFPE, fresh frozen, or alcohol-fixed tissue specimens should be prioritized. In addition, it recommends that FFPE cell blocks were preferable than smear preparations when cytology specimens were used. However, it requires several days to prepare FFPE specimens for pathological diagnosis and several hours to extract DNA from those specimens because they need deparaffinization and reversal of formaldehyde-induced modification of nucleic acids. Some studies have reported the utility and the reliability of fresh cytology specimens for EGFR mutation genotyping in NSCLC patients and their detection sensitivity is similar to or even better than that of FFPE tissue or cell block samples (30–32). Thus, we attempted to use fresh liquid cytology specimens, such as BLF, PE and CE, for the detection of EGFR mutations in this study, because it can shorten the time to prepare smear slides for pathological diagnosis to 30 min and the time to extract DNA from the specimens to 30 min.
This study demonstrated that the EGFR d-PCR assay could markedly reduce the reaction time to 8 min and 10 sec, while the conventional method, the Therascreen assay, takes 1 h and 45 min. In the EGFR d-PCR assay, the volume of the droplet including the sample and reagents is only 1.6 µl and is surrounded by silicone oil, which has good heat conduction characteristics. Therefore, the temperature of the droplet can quickly reach the temperature regulated by the two heater blocks. In addition, the rapid transition of the droplet between the two set temperatures decreases the time for each cycle in PCR. Few studies have reported rapid assays for detecting EGFR gene mutations in lung cancer patients within 10 min. Sakamoto et al (33,34) developed a high-speed EGFR real-time PCR assay known as the ultra-rapid PCR assay, which can detect L858R and E746_A750del in <10 min. Our EGFR d-PCR assay is, however, more rapid and sensitive than the ultra-rapid PCR assay. Moreover, it can also detect the T790M mutation in addition to the L858R and E746_A750del mutations in the same reaction. As a result, the entire procedure of the EGFR d-PCR assay is accomplished within 1 h and 30 min; thus, EGFR gene mutational status can be reported on the day the specimens are obtained from the patients.
In addition to the benefit of shortening the testing time of EGFR mutations, the sample results of the EGFR d-PCR assay were highly concordant with those of the Therascreen assay and EGFR d-PCR had excellent detection limits. The sensitivity of the Therascreen assay is well documented (18,35) and its detectable mutation percentages are 1.26% for L858R, 1.64% for deletions and 7.02% for T790M according to the manufacturers database concerning performance characteristics. Our EGFR d-PCR assay had detection limits of 0.5% for L858R, 0.05% for E746_A750 and 1.0% for T790M of mutation-positive cells, respectively. These mutation-positive cell lines have two copies of the EGFR gene: one is mutated and the other is wild-type. Thus, the EGFR d-PCR assay may have much lower detectable mutation percentages than the Therascreen assay.
Regarding the cost of the EGFR d-PCR assay, the assay is a cost-effective method compared to conventional assays. This is due to the fact that the reaction mixture volume of EGFR d-PCR assay is only 1.6 µl in each reaction tube and it needs a smaller volume of primers and probes. Moreover, it also needs a smaller volume of samples from the patients, so the remnants from the cytology specimens for the diagnosis were sufficient and thus used for the assays in this study. This facet could lead to using the samples from patients for other additional molecular tests.
EGFR mutations detectable by the novel assay were limited to the two major EGFR mutations, L858R and E746_A750del and the most common resistance mutation for EGFR-TKIs, T790M. However, it has been reported that the response rates for EGFR-TKIs in patients with the two major mutations were higher than those with minor mutations such as insertions in exon 20 (36), L861Q in exon 21 and exon 19 deletions starting codon L747 (37); the effectiveness of EGFR-TKIs in patients with minor EGFR mutations is limited (38,39). Therefore, after examining the major EGFR mutations by EGFR d-PCR assay, we can examine the minor EGFR mutations by multiplex PCR assay or direct sequencing after the precise histological tumor evaluation. Thus, the EGFR d-PCR assay may help detect frequent and effective mutations for EGFR-TKI therapy right after obtaining specimens and contribute to a more rapid start of therapy for advanced-stage lung cancer patients. Although the EGFR d-PCR assay needs two PCR reactions for one sample at this point, once for L858R and once for E746_A750del and T790M, we are planning to adjust the PCR conditions to detect all three EGFR mutations simultaneously and currently apply newly designed primers to other EGFR mutations to increase the variety of the types it can detect in the future.
In conclusion, our EGFR d-PCR assay can detect major EGFR mutations rapidly, correctly, sensitively and cost-effectively with a small amount of specimen. By means of using fresh liquid cytology specimens, which require fewer and easier steps to obtain DNA, the TAT can be markedly reduced compared with conventional assays using FFPE specimens. This assay is expected to contribute to an expedited advent of EGFR-TKI therapy for NSCLC patients. Furthermore, this assay can be a point-of-care test for such patients in the very near future.
Acknowledgements
This study was supported by the Japan Society for the Promotion of Science (JSPS) Grants-in-Aid for Scientific Research, commonly called KAKENHI (grant no. 25460434). This study was also supported in-kind by the Seiko Epson Corporation (Suwa, Japan) and Akemi Yamaguchi, one of the authors in this study, was an employee of this company. The authors acknowledge Masayuki Uehara (Corporate Research and Development Div., Seiko Epson Corporation), Akane Sueki, Yukihiro Kobayashi and Mitsutoshi Sugano (Department of Laboratory Medicine, Shinshu University Hospital, Nagano, Japan) for the technical assistance. We would like to thank Editage (www.editage.jp) for the English language editing.
Glossary
Abbreviations
Abbreviations:
|
NSCLC |
non-small cell lung cancer |
|
ADC |
adenocarcinoma |
|
EGFR |
epidermal growth factor receptor gene |
|
ALK |
anaplastic lymphoma kinase gene |
|
EGFR-TKIs |
EGFR tyrosine kinase inhibitors |
|
TAT |
turnaround time |
|
PCR |
polymerase chain reaction |
|
PML |
promyelocytic leukemia |
|
RARA |
retinoic acid receptor α |
|
BCR |
breakpoint cluster region |
|
ABL |
Abelson murine leukemia viral oncogene |
|
EGFR d-PCR assay |
rapid EGFR mutation assay by using real-time droplet-PCR machine |
|
BLF |
bronchial lavage fluid |
|
PE |
pleural effusion |
|
CE |
cardiac effusion |
|
FFPE |
formalin-fixed paraffin-embedded |
|
ML |
malignant lymphoma |
|
RCC |
renal cell carcinoma |
|
SCC |
small cell carcinoma |
|
SQCC |
squamous cell carcinoma |
|
NOS |
not otherwise specified |
|
ARMS |
amplification-refractory mutation system |
|
ROC |
receiver operating characteristic |
|
PCR-SSCP |
PCR-based assays such as single-strand conformation polymorphism |
|
PNA-LNA |
peptide nucleic acid-locked nucleic acid |
References
|
Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J and Jemal A: Global cancer statistics, 2012. CA Cancer J Clin. 65:87–108. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Paez JG, Jänne PA, Lee JC, Tracy S, Greulich H, Gabriel S, Herman P, Kaye FJ, Lindeman N, Boggon TJ, et al: EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science. 304:1497–1500. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Lynch TJ, Bell DW, Sordella R, Gurubhagavatula S, Okimoto RA, Brannigan BW, Harris PL, Haserlat SM, Supko JG, Haluska FG, et al: Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med. 350:2129–2139. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, Fujiwara S, Watanabe H, Kurashina K, Hatanaka H, et al: Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature. 448:561–566. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Mano H: Non-solid oncogenes in solid tumors: EML4-ALK fusion genes in lung cancer. Cancer Sci. 99:2349–2355. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Mok TS, Wu YL, Thongprasert S, Yang CH, Chu DT, Saijo N, Sunpaweravon P, Han B, Margono B, Ichinose Y, et al: Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med. 361:947–957. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Maemondo M, Inoue A, Kobayashi K, Sugawara S, Oizumi S, Isobe H, Gemma A, Harada M, Yoshizawa H, Kinoshita I, et al: North-East Japan Study Group: Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR. N Engl J Med. 362:2380–2388. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Rosell R, Carcereny E, Gervais R, Vergnenegre A, Massuti B, Felip E, Palmero R, Garcia-Gomez R, Pallares C, Sanchez JM, et al: Spanish Lung Cancer Group in collaboration with Groupe Français de Pneumo-Cancérologie and Associazione Italiana Oncologia Toracica: Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): A multicentre, open-label, randomised phase 3 trial. Lancet Oncol. 13:239–246. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Pao W and Ladanyi M: Epidermal growth factor receptor mutation testing in lung cancer: Searching for the ideal method. Clin Cancer Res. 13:4954–4955. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Matsuda K, Yamaguchi A, Taira C, Sueki A, Koeda H, Takagi F, Sugano M and Honda T: A novel high-speed droplet-polymerase chain reaction can detect human influenza virus in less than 30 min. Clin Chim Acta. 413:1742–1745. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Sueki A, Matsuda K, Yamaguchi A, Uehara M, Sugano M, Uehara T and Honda T: Evaluation of saliva as diagnostic materials for influenza virus infection by PCR-based assays. Clin Chim Acta. 453:71–74. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Sueki A, Matsuda K, Taira C, Yamaguchi A, Koeda H, Takagi F, Kobayashi Y, Sugano M and Honda T: Rapid detection of PML-RARA fusion gene by novel high-speed droplet-reverse transcriptase-polymerase chain reaction: Possibility for molecular diagnosis without lagging behind the morphological analyses. Clin Chim Acta. 415:276–278. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Shigeto S, Matsuda K, Yamaguchi A, Sueki A, Uehara M, Sugano M, Uehara T and Honda T: Rapid diagnosis of acute promyelocytic leukemia with the PML-RARA fusion gene using a combination of droplet-reverse transcription-polymerase chain reaction and instant-quality fluorescence in situ hybridization. Clin Chim Acta. 453:38–41. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Taira C, Matsuda K, Yamaguchi A, Sueki A, Koeda H, Takagi F, Kobayashi Y, Sugano M and Honda T: Novel high-speed droplet-allele specific-polymerase chain reaction: Application in the rapid genotyping of single nucleotide polymorphisms. Clin Chim Acta. 424:39–46. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Taira C, Matsuda K, Yamaguchi A, Uehara M, Sugano M, Okumura N and Honda T: Rapid single nucleotide polymorphism based method for hematopoietic chimerism analysis and monitoring using high-speed droplet allele-specific PCR and allele-specific quantitative PCR. Clin Chim Acta. 445:101–106. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Uehara M, Matsuda K, Sugano M and Honda T: A new high-speed droplet-real-time polymerase chain reaction method can detect bovine respiratory syncytial virus in less than 10 min. J Vet Med Sci. 76:477–480. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Yamaguchi A, Matsuda K, Sueki A, Taira C, Uehara M, Saito Y and Honda T: Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine. Clin Chim Acta. 448:150–154. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Vallée A, Le Loupp AG and Denis MG: Efficiency of the Therascreen® RGQ PCR kit for the detection of EGFR mutations in non-small cell lung carcinomas. Clin Chim Acta. 429:8–11. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Mitsudomi T, Kosaka T and Yatabe Y: Biological and clinical implications of EGFR mutations in lung cancer. Int J Clin Oncol. 11:190–198. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Yu HA, Arcila ME, Rekhtman N, Sima CS, Zakowski MF, Pao W, Kris MG, Miller VA, Ladanyi M and Riely GJ: Analysis of tumor specimens at the time of acquired resistance to EGFR-TKI therapy in 155 patients with EGFR-mutant lung cancers. Clin Cancer Res. 19:2240–2247. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Marchetti A, Martella C, Felicioni L, Barassi F, Salvatore S, Chella A, Camplese PP, Iarussi T, Mucilli F, Mezzetti A, et al: EGFR mutations in non-small-cell lung cancer: Analysis of a large series of cases and development of a rapid and sensitive method for diagnostic screening with potential implications on pharmacologic treatment. J Clin Oncol. 23:857–865. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Nagai Y, Miyazawa H, Huqun Tanaka T, Udagawa K, Kato M, Fukuyama S, Yokote A, Kobayashi K, Kanazawa M, et al: Genetic heterogeneity of the epidermal growth factor receptor in non-small cell lung cancer cell lines revealed by a rapid and sensitive detection system, the peptide nucleic acid-locked nucleic acid PCR clamp. Cancer Res. 65:7276–7282. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Hall JG, Eis PS, Law SM, Reynaldo LP, Prudent JR, Marshall DJ, Allawi HT, Mast AL, Dahlberg JE, Kwiatkowski RW, et al: Sensitive detection of DNA polymorphisms by the serial invasive signal amplification reaction. Proc Natl Acad Sci USA. 97:8272–8277. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Yatabe Y, Hida T, Horio Y, Kosaka T, Takahashi T and Mitsudomi T: A rapid, sensitive assay to detect EGFR mutation in small biopsy specimens from lung cancer. J Mol Diagn. 8:335–341. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Kimura H, Kasahara K, Kawaishi M, Kunitoh H, Tamura T, Holloway B and Nishio K: Detection of epidermal growth factor receptor mutations in serum as a predictor of the response to gefitinib in patients with non-small-cell lung cancer. Clin Cancer Res. 12:3915–3921. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Kawahara A, Taira T, Azuma K, Tominaga M, Hattori S, Kawahara M, Abe H, Yamaguchi T, Akiba J, Takamori S, et al: A diagnostic algorithm using EGFR mutation-specific antibodies for rapid response EGFR-TKI treatment in patients with non-small cell lung cancer. Lung Cancer. 78:39–44. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Lewandowska MA, Jóźwicki W, Jochymski C and Kowalewski J: Application of PCR methods to evaluate EGFR, KRAS and BRAF mutations in a small number of tumor cells in cytological material from lung cancer patients. Oncol Rep. 30:1045–1052. 2013.PubMed/NCBI | |
|
Tuononen K, Mäki-Nevala S, Sarhadi VK, Wirtanen A, Rönty M, Salmenkivi K, Andrews JM, Telaranta-Keerie AI, Hannula S, Lagström S, et al: Comparison of targeted next-generation sequencing (NGS) and real-time PCR in the detection of EGFR, KRAS, and BRAF mutations on formalin-fixed, paraffin-embedded tumor material of non-small cell lung carcinoma - superiority of NGS. Genes Chromosomes Cancer. 52:503–511. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Lindeman NI, Cagle PT, Beasley MB, Chitale DA, Dacic S, Giaccone G, Jenkins RB, Kwiatkowski DJ, Saldivar JS, Squire J, et al: College of American Pathologists International Association for the Study of Lung Cancer and Association for Molecular Pathology: Molecular testing guideline for selection of lung cancer patients for EGFR and ALK tyrosine kinase inhibitors: Guideline from the College of American Pathologists, International Association for the Study of Lung Cancer, and Association for Molecular Pathology. J Mol Diagn. 15:415–453. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Smouse JH, Cibas ES, Jänne PA, Joshi VA, Zou KH and Lindeman NI: EGFR mutations are detected comparably in cytologic and surgical pathology specimens of nonsmall cell lung cancer. Cancer. 117:67–72. 2009.PubMed/NCBI | |
|
Reynolds JP, Tubbs RR, Minca EC, MacNamara S, Almeida FA, Ma PC, Pennell NA and Cicenia JC: EGFR mutational genotyping of liquid based cytology samples obtained via fine needle aspiration (FNA) at endobronchial ultrasound of non-small cell lung cancer (NSCLC). Lung Cancer. 86:158–163. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Lozano MD, Labiano T, Echeveste J, Gurpide A, Martín- Algarra S, Zhang G, Sharma A and Palma JF: Assessment of EGFR and KRAS mutation status from FNAs and core-needle biopsies of non-small cell lung cancer. Cancer Cytopathol. 123:230–236. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Sakamoto T, Kodani M, Takata M, Chikumi H, Nakamoto M, Nishii-Ito S, Ueda Y, Izumi H, Makino H, Touge H, et al: A novel point-of-care system for high-speed real-time polymerase chain reaction testing for epidermal growth factor receptor mutations in bronchial lavage fluids after transbronchial biopsy in patients with non-small cell lung cancer. Int J Oncol. 46:1473–1480. 2015.PubMed/NCBI | |
|
Takata M, Chikumi H, Matsunami K, Kodani M, Sakamoto T, Hashimoto K, Nakamoto M, Okada K, Kitaura T, Matsumoto S, et al: A new rapid method for detecting epidermal growth factor receptor mutations in non-small cell lung cancer. Oncol Rep. 33:1040–1048. 2015.PubMed/NCBI | |
|
Angulo B, Conde E, Suárez-Gauthier A, Plaza C, Martínez R, Redondo P, Izquierdo E, Rubio-Viqueira B, Paz-Ares L, Hidalgo M, et al: A comparison of EGFR mutation testing methods in lung carcinoma: Direct sequencing, real-time PCR and immunohistochemistry. PLoS One. 7:e438422012. View Article : Google Scholar : PubMed/NCBI | |
|
Naidoo J, Sima CS, Rodriguez K, Busby N, Nafa K, Ladanyi M, Riely GJ, Kris MG, Arcila ME and Yu HA: Epidermal growth factor receptor exon 20 insertions in advanced lung adenocarcinomas: Clinical outcomes and response to erlotinib. Cancer. 121:3212–3220. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Lee VHF, Tin VPC, Choy TS, Lam KO, Choi CW, Chung LP, Tsang JW, Ho PP, Leung DK, Ma ES, et al: Association of exon 19 and 21 EGFR mutation patterns with treatment outcome after first-line tyrosine kinase inhibitor in metastatic non-small-cell lung cancer. J Thorac Oncol. 8:1148–1155. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Wu JY, Yu CJ, Chang YC, Yang CH, Shih JY and Yang PC: Effectiveness of tyrosine kinase inhibitors on ‘uncommon’ epidermal growth factor receptor mutations of unknown clinical significance in non-small cell lung cancer. Clin Cancer Res. 17:3812–3821. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Otsuka T, Mori M, Yano Y, Uchida J, Nishino K, Kaji R, Hata A, Hattori Y, Urata Y, Kaneda T, et al: Effectiveness of tyrosine kinase inhibitors in Japanese patients with non-small cell lung cancer harboring minor epidermal growth factor receptor mutations: Results from a multicenter retrospective study (HANSHIN Oncology Group 0212). Anticancer Res. 35:3885–3891. 2015.PubMed/NCBI |
