Somatic mutational spectrum analysis in a prospective series of 104 gastrointestinal stromal tumors

  • Authors:
    • David Guenat
    • Olivier Deroo
    • Sandrine Magnin
    • Loïc Chaigneau
    • Franck Monnien
    • Christophe Borg
    • Christiane Mougin
    • Jean-François Emile
    • Jean-Luc Prétet
  • View Affiliations

  • Published online on: January 17, 2017     https://doi.org/10.3892/or.2017.5384
  • Pages: 1671-1681
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Gastrointestinal stromal tumors (GISTs) are mesenchymal tumors distinguished by driver mutations in proto-oncogenes KIT or PDGFRA in 85-90% of cases. These mutations have been linked to the response to imatinib, a multikinase inhibitor, and have independent prognostic impact. Here, we describe the prospective study of the molecular characteristics of 104 GISTs from French adult patients analyzed routinely through the National Hospital Program of Molecular Cancer Diagnosis. All patients with GISTs diagnosed at the University Hospital of Besançon between August 2005 and October 2014 were prospectively included in the present study. KIT, PDGFRA and KRAS-codons 12 and 13 as well as BRAF codon 600 mutations were analyzed by Sanger sequencing or SNaPshot. KIT and PDGFRA mutations were detected in 71.2 and 19.2% of the cases, respectively. A total of 43 different mutations were detected of which 13 had never been described. As expected, KIT exon 9 and PDGFRA exon 18 mutations were associated with small bowel and gastric localizations respectively. No mutation was found in KRAS and BRAF. Molecular studies are critical to improve the management of GISTs. Our study enhances the current knowledge by describing 13 new mutations in KIT. A common molecular pattern in all KIT exon 11 substitutions is also described for the first time in this study but its significance remains unknown since genetic and environmental risk factors favoring the development of GISTs such as DNA repair defects and exposure to carcinogens are not currently known.

Introduction

Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors and account for 18% of all sarcomas (1).

GISTs develop from a small subset of interstitial cells named Cajal cells and may arise anywhere in the gastrointestinal tract (60–70% in the stomach and 20–30% in the small intestine) and more rarely (less than 5%) in the omentum or mesentery (2). GISTs usually occur in adults with a median age of 55–60 years. The annual incidence of GISTs worldwide is estimated to be between 11 and 19.6 per million inhabitants, corresponding to 500–600 new cases per year in France (3,4).

During the past decade, GISTs have emerged as a distinct group of gastrointestinal tumors with the discovery of the oncogenic role of the tyrosine kinase receptor KIT (also called stem cell factor receptor) whose expression is observed by immunohistochemical staining in more than 90% of GISTs (5). In 75% of GISTs expressing the proto-oncogene KIT, a gain-of-function mutation in the tyrosine kinase domain of KIT leads to its constitutive activation (6). Alternatively, somatic mutations in platelet-derived growth factor receptor α (PDGFRA), another tyrosine kinase receptor encoding gene can drive the development of GISTs in 15% of cases (7,8). In approximately 85% of pediatric GISTs and in a small subset of adult GISTs (10–15%), KIT and PDGFRA mutations have not been identified (9). Mutations of BRAF have been reported in 3.5–13% of KIT/PDGFRA wild-type tumors but the pathogenic significance of such mutations still remains unknown (1012).

The vast majority of GISTs are sporadic but genetic predispositions have also been described. Thus, 7% of patients with neurofibromatosis type I develop GISTs, mostly multiple GISTs without KIT mutations. More rarely, germline mutations in succinate dehydrogenase complex, subunit B (SDHB), KIT or PDGFRA have been observed in familial forms of GIST (1316).

The prognosis of GISTs varies widely. Since GISTs generally evolve without symptoms, more than 10% are diagnosed at the metastatic state. Complete surgical resection is the current standard of care in most localized GISTs. After resection, the estimated 15-year recurrence-free survival is 59.9%. Older age, a tumor size larger than 10 cm, a high mitotic count, non-gastric localization, presence of tumor rupture and male gender are independent adverse prognostic factors (17,18). For localized GISTs, the risk of relapse can be evaluated using Armed Forces Institute of Pathology (AFIP) or National Institutes of Health (NIH) classifications that are based on localization, tumor size, mitotic index and presence of rupture of the primary tumor (19,20). These classifications are critical for the management of adjuvant treatment in patients with GISTs and are likely to be enhanced by incorporating the mutational status of GISTs (21).

Indeed, the rapid evolution in understanding the oncogenesis of GISTs leads to the use of effective targeted therapies. Most GISTs with KIT or PDGFRA mutations respond to imatinib, a multikinase inhibitor (2225). Better responses are observed in GISTs with KIT exon 11 mutations than in patients with KIT exon 9 mutations, PDGFRA mutations or without mutations (26). Unfortunately, around half of the patients who initially respond to imatinib develop resistance after a long period of treatment. Resistance to imatinib has been linked to secondary mutations involving mostly the same gene as the primary driver mutation (2732). Alternative tyrosine kinase inhibitors that target KIT and PDGFRA such as sunitinib, nilotinib, sorafenib, regorafenib as well as other investigational inhibitors are currently being evaluated to treat imatinib-resistant GISTs (3336).

The KIT and PDGFRA mutational spectrums have been well characterized in population-based studies in France (4), Norway (37) and Switzerland (38). These studies have shown that 50–60% of primary GISTs present mutations in KIT exon 11 (encoding the transmembrane domain), 5–10% in KIT exon 9 (extracellular domain), 1–3% in KIT exon 13 (tyrosine kinase domain 1), <1% in KIT exon 17 (tyrosine kinase domain 2), 2–5% in PDGFRA exon 12 (transmembrane domain) and 2–12% in PDGFRA exon 18 (tyrosine kinase domain 2). Mutations in KIT exon 11 are the most heterogeneous mutations observed in GISTs with about 50% deletions, 34% substitutions, 6% duplications/insertions and 11% complex mutations.

We provide here a prospective study of the molecular characteristics of a series of 104 GISTs in hospital-based French adult patients.

Materials and methods

Study design and patients

All GIST cases diagnosed between August 2005 and October 2014 in the University Hospital of Besançon, France (n=104) were prospectively identified through the Department of Pathology and the Regional Molecular Genetics Centre of Besançon.

All patients with GIST during this period had routinely benefited from a molecular diagnosis according to the French National Public Cancer Program managed by the National Institute of Cancer (Institut National du Cancer, INCa) (39). All specimens used in the present study were primary tumors except for 4 specimens corresponding to metastasis.

Ethics statement

All procedures followed were in accordance with the ethical standards of the committee responsible for human experimentation (institutional and national) and with the Helsinki Declaration of 1964 and later versions. According to the French legislation (Public Health Code modified by the law no. 2004–806, August 9, 2004 and the Huriet-Serusclat act 88–1138, December 20, 1988) and as this study only involved data extracted from medical records and stored histological specimens, no informed consent from the patients was necessary. Data collected from the Department of Pathology were strictly anonymous. The collection of specimens and their use for research were approved by the Ethics Committee of the University Hospital of Besançon.

Histopathological evaluation

The diagnosis of GIST was based on histological examination and confirmed using KIT/CD117 (clone 104D2, dilution 1/300; Dako, Les Ulis, France) and DOG-1 (clone SP31, dilution 1/150; Thermo Fisher Scientific, Villebon-sur-Yvette, France) immunostaining when appropriate. In each case, the largest diameter of the tumor was measured. Mitotic index was evaluated on 12.5 mm2 of tumor and then converted to the number of mitoses/5 mm2. For localized GISTs, the potential risk of relapse was evaluated according to Miettinen criteria (20).

DNA extraction

Tumor genomic DNA was extracted from formalin-fixed and paraffin-embedded (FFPE) or frozen tissues using QIAmp DNA Mini kit (Qiagen, Courtabeuf, France) according to the manufacturer's instructions. Prior to DNA extraction, separate hematoxylin and eosin stained slides were reviewed by a pathologist and manually microdissected when appropriate to ensure tumor content greater than 20%. Depending on the size of the fixed tissue, between 3 and 8 FFPE tissue sections of 10 µm thickness were processed for DNA extraction. DNA and tissue samples were collected by the Biobank BB-0033-00024 ‘Tumorothèque Régionale de Franche-Comté (TRFC)’.

KIT and PDGFRA mutations analysis by direct sequencing

A sequential strategy analysis was adopted for the screening of KIT and PDGFRA mutations by Sanger sequencing. The most frequent sites of mutations (exons 9 and 11 of KIT and exon 18 of PDGFRA) were first analyzed. When no mutation was detected in the former exons, exons 13 and 17 of KIT and exon 12 of PDGFRA were subsequently sequenced. Genomic sequences of KIT (ENST00000288135) and PDGFRA (ENST00000257290) were obtained from Ensembl database (www.ensembl.org). Specific primers were designed using the online Primer-BLAST software (www.ncbi.nlm.nih.gov/tools/primer-blast/) (40). Table I shows the details of the primer sequences and their annealing temperatures. Targeted sequences were amplified by PCR using the Qiagen Multiplex PCR kit (Qiagen). PCR conditions were as follows: 94°C for 15 min, 40 cycles of 92°C for 1 min, specific annealing temperature for 30 sec, 72°C for 45 sec and finally 7 min at 72°C. PCR products were purified using the gel extraction kit NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, Hoerdt, France). Bidirectional sequencing reaction was performed using the DTCS Quick Start kit (SCIEX, Les Ulis, France). Reactions were run according to the following protocol: one cycle at 96°C for 1 min; 15 cycles at 96°C for 10 sec, 50°C for 5 sec, 60°C for 1 min 15 sec; 5 cycles of 96°C for 10 sec, 50°C for 5 sec, 60°C for 1 min 30 sec; 5 cycles of 96°C for 10 sec, 50°C for 5 sec and 60°C for 2 min. After purification with a NucleoSEQ kit (Macherey-Nagel), samples were run and analyzed on a CEQ 8000 sequencer (SCIEX). Finally, the sequences obtained were compared with the reference sequence of KIT or PDGFRA using CEQ 8000 analysis software. Our procedure included a systematic double review by two independent biologists.

Table I.

PCR primers used for sequencing of KIT and PDGFRA.

Table I.

PCR primers used for sequencing of KIT and PDGFRA.

Gene/exonPrimer sequences (5′→3′)Annealing temperature (°C)Product size (bp)
KIT 9F: ATGCTCTGCTTCTGTACTG56234
R: GCCTAAACATCCCCTTAAATTGG
KIT 11F: CTCTCCAGAGTGCTCTAATGAC56219
R: AGCCCCTGTTTCATACTGACC
KIT 13F: GCTTGACATCAGTTTGCCAG56294
R: GAGAACAACAGTCTGGGTAA
KIT 17F: TCTCCTCCAACCTAATAGTGTAT56173
R: GCAGGACTGTCAAGCAGAGAAT
PDGFRA 12F: AAGCTCTGGTGCACTGGGACTT65251
R: ATTGTAAAGTTGTGTGCAAGGGA
PDGFRA 18F: TACAGATGGCTTGATCCTGAGT60212
R: AGTGTGGGAGGATGAGCCTG

[i] PDGFRA, platelet-derived growth factor receptor α; F, forward; R, reverse.

KRAS and BRAF mutational analysis

Furthermore, all KIT/PDGFRA wild-type samples (n=10) were tested for Kirsten rat sarcoma (KRAS) codons 12 and 13 and BRAF codon 600 using a SNaPshot assay as previously described (41). The sensitivity of the SNaPshot assay that we developed was previously evaluated using plasmid dilutions and ranged between 1–5% of mutant alleles (Magnin et al, 2011; supplemental Figs. S1-S7) (41). In comparison, the Sanger assay that we used had a slightly higher level of detection that ranged between 5 and 10% of mutant alleles.

Statistical analysis

Mean values and frequencies were used for the description of continuous and categorical variables, respectively. The proportions were compared using the Chi-squared test (or Fisher's exact test, if appropriate). All statistical tests were two-sided, and P-values <0.05 were considered as significant.

Results

Clinicopathological characteristics

Overall, samples from 104 GISTs corresponding to 103 patients including 60 males and 43 females were available for the present study. The main clinical and pathological characteristics of the GISTs are shown in Fig. 1. The mean age at the time of diagnosis was 66.2 years ranging from 29 to 92 years. Primary tumors were localized within the stomach (66%), small bowel (29%), colon (2%), rectum (<1%), esophagus (<1%) and epiploon (<1%). A majority of GISTs (65%) had a tumor size between 2 and 10 cm and the mitotic index was <5/50 mm2 in the majority of cases (65%). Morphologically, spindle cell type represented 56%, epithelioid 12.5% and mixed cell type 17.5% of the GISTs. At the time of diagnosis, 11% of the GISTs had synchronous metastasis. Thirty-six percent of localized GISTs were intermediate to high risk according to AFIP classification.

Mutational analysis

Characterization of the mutational status for KIT and PDGFRA was performed in all GISTs. KIT and PDGFRA mutations were detected in 90.4% cases, 71.2% in KIT and 19.2% in PDGFRA while no mutation was found in 9.6% specimens. A total of 43 different mutations were detected. Among them 36 were localized in KIT exon 11 of which 13 were not referenced in the COSMIC database (Table II).

Table II.

Novel KIT exon 11 mutations observed in our series of GISTs.

Table II.

Novel KIT exon 11 mutations observed in our series of GISTs.

Mutations
c.1649_1675del; p.Lys550_Lys558delinsIle
c.1668_1692delinsA; p.Trp557_Asn564del
c.1670_1720del; p.Trp557_Thr574delinsSer
c.1676_1681del; p.Val560_Glu561del
c.1676_1696del; p.Val560_Asn566delinsAsp
c.1703_1726del; p.Tyr568_Leu576delinsPhe
c.1708_1719dup; p.Tyr570_Thr574dup
c.1709_1735dup; p.Ile571_Asp579dup
c.1717_1737dupinsCCA; p.Asp572_Asp579dupinsPro
c.1718_1771dup; p.Thr574_Phe590dupinsSer
c.1723_1758dup; p.Gln575_Asn586dup
c.1726_1738delinsG; p.Leu576_Asp579del
c.1711_1758dup; p.Asp572_Asn586dup

[i] GISTs, gastrointestinal stromal tumors.

Altogether mutations in exon 9 and 11 of KIT and exon 18 of PDGFRA accounted for 93% of all mutations. Overall, the 9 most frequent mutations represented 55.2% of all mutations (Table III).

Table III.

The 9 most frequent KIT and PDGFRA mutations in our series of GISTs.

Table III.

The 9 most frequent KIT and PDGFRA mutations in our series of GISTs.

MutationsPercentage
1. PDGFRA ex 18 p.Asp842Val13.95
2. KIT ex 9 p.Ala502_Tyr503dup9.60
3. KIT ex 11 p.Val560Asp7.69
4. KIT ex 11 p.Trp557Arg5.76
5. KIT ex 11 p.Leu576Pro4.80
6. KIT ex 11 p.Trp557_Lys558del4.80
7. KIT ex 11 p.Val559Asp2.88
8. KIT ex 11 p.Trp557Gly2.88
9. PDGFRA ex 18 p.Ile843_Asp846del2.88

[i] PDGFRA, platelet-derived growth factor receptor α; GISTs, gastrointestinal stromal tumors.

In KIT exon 9, the classical duplication (p.Ala502_Tyr503dup) was the only mutation identified.

As expected, KIT exon 11 mutations were more heterogeneous. The most frequent types of KIT exon 11 mutations were substitutions in 44.4% cases followed by deletions in 33.3% cases, complex mutations including insertions in 14.3% cases and tandem duplications in 7.9% cases. The detailed frequency of codon alterations is shown in Fig. 2. KIT exon 11 deletions were predominantly clustered in the 5′-end of exon 11. The most frequently mutated codons of KIT exon 11 were 557 (in 39.6% of KIT exon 11 mutants), 558 and 560 (25.4% both). The most common deletion p.Trp557_Lys558del was found in 5 cases (8% of KIT exon 11 mutants). By contrast, all tandem duplications (n=5) occurred in the 3′-end of exon 11. The length of the duplications varied from 3 to 51 bp, mostly involving codons 573–579.

No mutation was found in KIT exon 17 and only one mutation was found in KIT exon 13 (p.Lys642Glu).

Regarding PDGFRA, all mutations observed in exon 18 corresponded to the classical p.Asp842Val, except for 2 deletions (p.Asp842_His845del and p.Ile843_Asp846del). Only one mutation was found in exon 12 (p.Val561Asp). Of note, a patient was diagnosed with double synchronous primary GISTs localized in the stomach. Both tumors had the same histological characteristics but, interestingly, they harbored 2 different mutations in PDGFRA (p.Asp842Val and p.Val561Asp).

Distribution of patients in our series according to the mutated exon was compared with that of patients from different geographical origins included in population-based studies and clinical trials (Fig. 3) (4,21,37,38,4252). It appeared that the distribution of mutations greatly varied according to the population studied. In comparison with other studies, more PDGFRA exon 18 mutations and less KIT/PDGFRA wild-type GISTs were found in the present study. For KIT exons 9, 11, 13 and 17 and for PDGFRA exon 12, our results were however in the same range.

In addition, all KIT/PDGFRA wild-type tumors (n=10) were tested for the presence of BRAF codon 600 and KRAS codon 12 and 13 mutations. No mutation was detected. Of note, one patient with wild-type GIST has been diagnosed with type I neurofibromatosis.

Association of tumor genotype with clinicopathological characteristics

Detailed distribution of patients according to mutations and clinicopathological characteristics is shown in Table IV.

Table IV.

Distribution of patients according to mutations and clinicopathological characteristics.

Table IV.

Distribution of patients according to mutations and clinicopathological characteristics.

KIT-mutated tumors

Exon 11

All patientsAll KIT/PDGFRA-mutated tumors n(%) KIT/PDGFRA wild-type tumors n(%)All n(%)Exon 9 n(%)All n(%)Deletion n(%)Substitution n(%)Duplication n(%)Complex mutations n(%)Exon 13 n(%)All PDGFRA- mutated tumors n(%)
Gender
  Male60 (57.7)52 (55.3)8 (80)39 (52.7)6 (60)32 (50.8)12 (57.1)13 (46.4)3 (60)4 (44.4)1 (100)13 (65)
  Female44 (42.3)42 (44.7)2 (20)35 (47.3)4 (40)31 (49.2)9 (42.9)15 (53.6)2 (40)5 (55.6)0 (0)7 (35)
Age (years)
  Median66.3766.465.866.666.666.363.669.56463.96368.85
  Range29–9229–9227–8039.839–8829–8841–8429–8839–8256–7644–8046–92
Primary tumor site
  Stomach67 (64.4)61 (64.9)6 (60)44 (55.4)0 (0)41 (65.1)16 (76.2)16 (57.1)4 (80)5 (55.6)0 (0)20 (100)
  Small bowel32 (30.8)29 (30.9)3 (30)29 (39.2)10 (100)18 (28.6)3 (14.3)10 (35.7)1 (20)4 (44.4)1 (100)0 (0)
  Other5 (4.8)4 (4.3)1 (10)4 (5.4)0 (0)4 (6.3)2 (9.5)2 (7.1)0 (0)0 (0)0 (0)0 (0)
Synchronous metastases
  Localized tumor93 (89.4)85 (90.4)8 (80)65 (87.8)8 (80)56 (88.9)19 (90.5)26 (92.9)3 (60)8 (88.9)1 (100)20 (100)
  Metastatic11 (10.6)9 (9.6)2 (20)9 (12.2)2 (20)7 (11.1)2 (9.5)2 (7.1)2 (40)1 (11.1)0 (0)0 (0)
Cell type
  Spindle cell58 (55.8)52 (55.3)6 (60)47 (63.5)7 (70)39 (61.9)14 (66.7)18 (64.3)3 (60)4 (44.4)1 (100)5 (25)
  Epithelioid13 (12.5)13 (13.8)0 (0)8 (10.8)1 (10)7 (11.1)3 (14.3)0 (0)1 (20)3 (33.3)0 (0)5 (25)
  Mixed18 (17.3)15 (16)3 (30)8 (10.8)1 (10)7 (11.1)0 (0)7 (25)0 (0)0 (0)0 (0)7 (35)
  NA15 (14.4)14 (14.9)1 (10)11 (14.9)1 (10)10 (15.9)4 (19)3 (10.7)1 (20)2 (22.2)0 (0)3 (15)
Mitotic index
  ≤5/5068 (65.4)62 (66)6 (60)47 (63.5)4 (40)42 (66.7)10 (47.6)24 (85.7)3 (60)5 (55.6)1 (100)15 (75)
  >5/5027 (26)24 (25.5)3 (30)22 (29.7)5 (50)17 (27)9 (42.9)3 (10.7)2 (40)3 (33.3)0 (0)2 (10)
  NA9 (8.7)8 (8.5)1 (10)5 (6.8)1 (10)4 (6.3)2 (9.5)1 (3.6)0 (0)1 (11.1)0 (0)3 (15)
Tumor size (cm)
  ≤215 (14.4)13 (13.8)2 (20)10 (13.5)1 (10)9 (14.3)4 (19)4 (14.3)0 (0)1 (11.1)0 (0)3 (15)
  >2 to ≤535 (33.7)31 (33)4 (40)27 (36.5)2 (20)24 (38.1)4 (19)14 (50)2 (40)4 (44.4)1 (100)4 (20)
  5–1026 (25)26 (27.7)0 (0)17 (23)5 (50)12 (19)4 (19)5 (17.9)1 (20)2 (22.2)0 (0)9 (45)
  >1018 (17.3)15 (16)3 (30)14 (18.9)2 (20)12 (19)6 (28.6)4 (14.3)1 (20)1 (11.1)0 (0)1 (5)
  NA10 (9.6)9 (9.6)1 (10)6 (8.1)0 (0)6 (9.5)3 (14.3)1 (3.6)1 (20)1 (11.1)0 (0)3 (15)
Risk
  None19 (18.3)17 (18.1)2 (20)13 (17.6)1 (10)12 (19)4 (19)5 (17.9)0 (0)3 (33.3)0 (0)4 (20)
Very low21 (20.2)18 (19.1)3 (30)15 (20.3)0 (0)15 (23.8)3 (14.3)9 (32.1)2 (40)1 (11.1)0 (0)3 (15)
  Low16 (15.4)15 (16)1 (10)9 (12.2)2 (20)6 (9.5)0 (0)5 (17.9)0 (0)1 (11.1)1 (100)6 (30)
  Intermediate14 (13.5)13 (13.8)1 (10)12 (16.2)1 (10)11 (17.5)4 (19)5 (17.9)1 (20)1 (11.1)0 (0)1 (5)
  High23 (22.1)21 (22.3)2 (20)19 (25.7)5 (50)14 (22.2)7 (33.3)3 (10.7)2 (40)2 (22.2)0 (0)2 (10)
  n.a.11 (10.6)10 (10.6)1 (10)6 (8.1)1 (10)5 (7.9)3 (14.3)1 (3.6)0 (0)1 (11.1)0 (0)4 (20)
Other malignancies
  Synchronous13 (12.5)11 (11.7)2 (20)6 (8.1)0 (0)5 (7.9)2 (9.5)3 (10.7)0 (0)0 (0)1 (100)5 (25)
  Before GIST2 (1.9)2 (2.1)0 (0)2 (2.7)1 (10)1 (1.6)0 (0)1 (3.6)0 (0)0 (0)0 (0)0 (0)
  After GIST0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)0 (0)

[i] PDGFRA, platelet-derived growth factor receptor α; GIST, gastrointestinal stromal tumor. NA, not available.

It can be noted that GISTs with PDGFRA exon 18 mutations (n=18) were associated with primary gastric localization (18/18), tumors with KIT exon 9 mutations (n=10) were exclusively localized in the small bowel (10/10) while tumors with KIT exon 11 were respectively localized in the stomach (41/63), small bowel (18/63) and other sites (4/63) (p<0.001).

No other significant association was observed between KIT and PDGFRA mutations and the clinicopathological features of the GISTs. Furthermore, spindle cell type and mitotic index >5/50 mm2 was less frequent in tumors harboring PDGFRA exon 18 mutation than in the whole series. Despite a tumor size greater than other GISTs, the estimated risk of relapse was more frequently very low/low in this subset of tumors (Table IV).

Advanced GISTs were diagnosed in 11 cases in our series and no association with a specific mutation was found. Finally, 15 patients (14%) also presented another malignancy of which 13 were synchronous. Of note, 25% of patients with PDGFRA mutations had other malignancies.

Molecular pattern of KIT exon 11 substitutions

Single substitutions in KIT exon 11 occurred, in decreased frequency, at codons 557 (n=9; p.Trp557Gly, p.Trp557Arg), 560 (n=8; p.Val560Asp), 559 (n=6; p.Val559Gly, p.Val559Asp) and 576 (n=5; p.Leu576Pro). Strikingly, all KIT exon 11 substitutions (n=28) shared the same T>N molecular pattern. These substitutions occurred at nucleotides 1669, 1676, 1679 and 1727. Half of these point mutations involved T>A transversion, 8 T>C transition and 6 T>G transversion (Table V and Fig. 4). No significant association was found between KIT exon 11 substitution and clinicopathological characteristics. However, patients with such mutation tended to be older than other patients of the present series (median age 69.5 vs. 66.37 in the whole cohort). Of note, in comparison with all patients, no epithelioid tumor was observed in patients with KIT exon 11 substitution, mitotic index was ≤5/50 mm2 in 86 vs. 65% and tumor size was ≤5 cm in 66% in this subset of patients vs. 54% in all cases (Table IV).

Table V.

Detailed clinicopathological features of GISTs with KIT exon 11 substitutions.

Table V.

Detailed clinicopathological features of GISTs with KIT exon 11 substitutions.

No.Age (years)GenderMetastasesMorphologyTumor siteMitotic indexRiskOther malignanciesNucleotide changeAmino acid change
  166F0Spindle cellStomach≤51Prostate cancer1669T>ATrp557Arg
  272M0MixedStomach≤51NA1669T>ATrp557Arg
  385M0MixedStomach≤5101669T>ATrp557Arg
  443FSynchronousSpindle cellSmall bowel≤5201669T>CTrp557Arg
  562F0Spindle cellStomach≤5101669T>CTrp557Arg
  685F0MixedSmall bowel>5301669T>CTrp557Arg
  763M0Spindle cellStomach≤5201669T>GTrp557Gly
  879F0NASmall bowel>5301669T>GTrp557Gly
  981F0Spindle cellStomach>5201669T>GTrp557Gly
1070FSynchronousMixedStomach≤5201676T>AVal559Asp
1176M0Spindle cellSmall bowel≤51Gastric adenocarcinoma1676T>AVal559Asp
1279F0Spindle cellStomach≤51NA1676T>AVal559Asp
1329F0Spindle cellStomach≤5101676T>GVal559Gly
1477F0Spindle cellSmall bowel≤5201676T>GVal559Gly
1583M0Spindle cellSmall bowel≤5101676T>GVal559Gly
1649F0Spindle cellStomach≤51Ovarian adenocarcinoma1679T>AVal560Asp
1758F0Spindle cellStomach≤5101679T>AVal560Asp
1863M0Spindle cellStomach≤5101679T>AVal560Asp
1969M0MixedStomach≤5101679T>AVal560Asp
2077M0NASmall bowel≤5101679T>AVal560Asp
2178F0MixedStomach≤5101679T>AVal560Asp
2279M0NAColonn.a. NA1679T>AVal560Asp
2388M0Spindle cellSmall bowel≤5101679T>AVal560Asp
2460M0MixedRectum≤51Rectal adenocarcinoma1727T>CLeu576Pro
2563M0Spindle cellSmall bowel≤5301727T>CLeu576Pro
2666M0Spindle cellSmall bowel≤5101727T>CLeu576Pro
2772F0Spindle cellStomach≤5101727T>CLeu576Pro
2874F0Spindle cellStomach≤51NA1727T>CLeu576Pro

[i] GISTs, gastrointestinal stromal tumors; F, female; M, male. NA, not available.

Discussion

Here, we provide a prospective study of clinicopathological and molecular characteristics of 104 GISTs from a Northeastern French population.

All patients with GISTs diagnosed between August 2005 and October 2014 at the University Hospital of Besançon benefited from a routine molecular diagnosis as recommended by the French National Cancer Institute (INCa). Thus, our study reflects the distribution of clinicopathological and molecular features of GISTs in real life with the accuracy and the management of quality from a clinical laboratory.

The detailed molecular characterization of GISTs has become of great prognosis and therapeutic value in the past few years.

Indeed, treatment with the tyrosine kinase inhibitor imatinib led to significant improvement of survival of patients with KIT and PDGFRA mutated GISTs. Imatinib has been approved as the first line treatment of patients with advanced GISTs and substantially increased survival of these patients (10–20 vs. 51–57 months median survival) (5355). Subsequently, it has been shown that the position of KIT or PDGFRA mutations influences the response to imatinib. Thus, GISTs with KIT exon 11 mutant genotype are imatinib-responsive whereas mutations in PDGFRA exon 18 (mostly Asp842Val) are associated with resistance to imatinib. GISTs with a mutation in KIT exon 9 (mostly Ala-Tyr502-503 duplications) are imatinib-responsive but doubling the dose of imatinib (400 mg twice daily) increases the progression-free survival significantly (56). Treatment of KIT/PDGFRA wild-type tumors is not currently standardized and the administration of imatinib in these patients remains controversial.

Additionally, tumor genotype has been shown to have an independent prognostic relevance in patients with GISTs. KIT exon 9 duplications and KIT exon 11 deletions are known to be associated with aggressive tumor behavior and poor prognosis whereas patients with PDGFRA Asp842Val mutant GISTs usually have a favorable outcome (57,58). Recently, Joensuu et al have shown that patients with PDGFRA mutations and those with KIT exon 11 duplication or deletion of one codon have favorable relapse-free survival (RFS) with surgery alone (47). Thus, KIT and PDGFRA mutation analysis provides important information to estimate the risk of recurrence in patients with localized GISTs and deserve to be investigated to select candidates for adjuvant therapy.

The distribution of somatic mutations in GISTs has previously been characterized in large population-based studies and varies widely from one region of the globe to another but the reasons for these variations still remain unknown.

Thus, KIT and PDGFRA mutations are found respectively in 70 and 10% of cases in the USA (59), 70.7 and 20% in France (4), 67.9 and 1% in China (60), and 72.4 and 6.5% in South Africa (61). Notably, the variation of the genotype mainly involves the proportion of PDGFRA-mutated tumors. Such variations may be explained by several factors. First, it may be the result of variable diagnosis delays. PDGFRA-mutated tumors are known to evolve more slowly than KIT-mutated tumors. Consequently, the series that comprised a higher proportion of advanced GISTs had less PDGFRA-mutated tumors. Secondly, the technical procedures used to assess the mutational status of GISTs can influence the proportion of mutations in these different series. The Sanger sequencing probably allows a more extensive detection of rare variants compared with targeted methods. Thus, it may be assumed that the implementation of next-generation sequencing in clinical laboratories will change the current molecular epidemiology of GISTs. Finally, PDGFRA mutations may vary with the ethnic origins of patients with GISTs as shown in non-small cell lung cancer in which a higher proportion of somatic epidermal growth factor receptor (EGFR) mutations has been observed in the Asian population. In our series the distribution of KIT and PDGFRA mutations was quite similar to those of the MolecGIST study that reviewed tumor samples from 596 patients from all over France during a 24-month period. Notably, we observed a higher proportion of KIT exon 11 substitutions in the present study compared with MolecGIST (44.4 vs. 34.1%). A focused analysis of these substitutions has displayed a common molecular pattern consisting in all cases of a T>N point mutation located at codons 557, 559, 560 and 576. Analysis of the molecular pattern of KIT exon 11 substitutions in the MolecGIST cohort showed the same distribution with 97.9% mutations affecting a thymine at 4 different loci. Surprisingly, a recent Indian study of 70 GISTs revealed a different distribution with only 40% thymine substitutions among all KIT exon 11 point mutations (49). Thus, we suggest that environment and/or genetic background may affect the distribution of point mutations in GISTs.

Environmental risks of cancer usually include exposure to carcinogens. Characteristic mutations in KIT exon 11 in GISTs may be mutational signatures that are linked to specific mutagens. Despite an increasing number of studies, little is known about the natural history of GISTs. Notably, the role of non-genetic risk factors, such as exposure to carcinogens, is not currently known.

Genetics risks include constitutional genomic instability and DNA repair defects. Such alterations have already been suggested to play a role in the oncogenesis of GISTs. Thus, methylation of mutL homolog 1 and MGMT have been observed in 60 and 49% of GISTs respectively and single-nucleotide polymorphisms (SNPs) in two other DNA repair genes, RAD23B and ERCC2, were associated with KIT exon 11 mutations (59,62).

Despite the advent of targeted therapies, the prognosis of GISTs, especially in advanced stages, is still poor and a better comprehension of genetic and environmental risk factors may allow the development of preventive and/or screening strategies for GISTs.

In conclusion, this study confirms existing data and enriches the knowledge of the genotypes of GISTs which is essential for therapeutic innovation. By describing 13 novel mutations in KIT, our data contribute to widen the spectrum of known mutations in GISTs and to confirm the most frequently altered regions underlying GIST development. It also confirms that KRAS exon 2 and BRAF V600 mutations are very scarce since no mutation was found in the wild-type GISTs in our series.

Finally, this study highlights the importance of taking into consideration the genetic and environmental risk factors favoring GIST development since the current scientific knowledge on this topic is still poor.

Acknowledgements

We would like to thank Alice Brunier, Evelyne Chezy, Laurence Madoz and Lise Rognon for the achievement of the technical procedures used in this study. We also acknowledge the Institut National du Cancer (INCa) for the financial support of the molecular diagnosis of GISTs in France. Finally, we thank the pathologists who participated in this study: Séverine Valmary Degano, Isabelle Bedgedjian, Franck Vitte, Yannick Jeffredo and Alain Petitjean.

Glossary

Abbreviations

Abbreviations:

AFIP

Armed Forces Institute of Pathology

COSMIC

Catalogue of Somatic Mutations in Cancer

EGFR

epidermal growth factor receptor

FFPE

formalin-fixed paraffin-embedded

GISTs

gastrointestinal stromal tumors

KRAS

Kirsten rat sarcoma

MLH1

mutL homolog 1

DNA

deoxyribonucleic acid

NIH

National Institutes of Health

PDGFRA

platelet-derived growth factor receptor α

SDHB

succinate dehydrogenase complex, subunit B

SNP

single-nucleotide polymorphism

References

1 

Corless CL, Barnett CM and Heinrich MC: Gastrointestinal stromal tumours: Origin and molecular oncology. Nat Rev Cancer. 11:865–878. 2011.PubMed/NCBI

2 

Joensuu H, Hohenberger P and Corless CL: Gastrointestinal stromal tumour. Lancet. 382:973–983. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Monges G, Bisot-Locard S, Blay JY, Bouvier AM, Urbieta M, Coindre JM and Scoazec JY: The estimated incidence of gastrointestinal stromal tumors in France. Results of PROGIST study conducted among pathologists. Bull Cancer. 97:E16–E22. 2010.PubMed/NCBI

4 

Emile JF, Brahimi S, Coindre JM, Bringuier PP, Monges G, Samb P, Doucet L, Hostein I, Landi B, Buisine MP, et al: Frequencies of KIT and PDGFRA mutations in the MolecGIST prospective population-based study differ from those of advanced GISTs. Med Oncol. 29:1765–1772. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Sarlomo-Rikala M, Kovatich AJ, Barusevicius A and Miettinen M: CD117: A sensitive marker for gastrointestinal stromal tumors that is more specific than CD34. Mod Pathol. 11:728–734. 1998.PubMed/NCBI

6 

Hirota S, Isozaki K, Moriyama Y, Hashimoto K, Nishida T, Ishiguro S, Kawano K, Hanada M, Kurata A, Takeda M, et al: Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors. Science. 279:577–580. 1998. View Article : Google Scholar : PubMed/NCBI

7 

Heinrich MC, Corless CL, Duensing A, McGreevey L, Chen CJ, Joseph N, Singer S, Griffith DJ, Haley A, Town A, et al: PDGFRA activating mutations in gastrointestinal stromal tumors. Science. 299:708–710. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Hirota S, Ohashi A, Nishida T, Isozaki K, Kinoshita K, Shinomura Y and Kitamura Y: Gain-of-function mutations of platelet-derived growth factor receptor α gene in gastrointestinal stromal tumors. Gastroenterology. 125:660–667. 2003. View Article : Google Scholar : PubMed/NCBI

9 

Nannini M, Biasco G, Astolfi A and Pantaleo MA: An overview on molecular biology of KIT/PDGFRA wild type (WT) gastrointestinal stromal tumours (GIST). J Med Genet. 50:653–661. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Agaimy A, Terracciano LM, Dirnhofer S, Tornillo L, Foerster A, Hartmann A and Bihl MP: V600E BRAF mutations are alternative early molecular events in a subset of KIT/PDGFRA wild-type gastrointestinal stromal tumours. J Clin Pathol. 62:613–616. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Agaram NP, Wong GC, Guo T, Maki RG, Singer S, Dematteo RP, Besmer P and Antonescu CR: Novel V600E BRAF mutations in imatinib-naive and imatinib-resistant gastrointestinal stromal tumors. Genes Chromosomes Cancer. 47:853–859. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Hostein I, Faur N, Primois C, Boury F, Denard J, Emile JF, Bringuier PP, Scoazec JY and Coindre JM: BRAF mutation status in gastrointestinal stromal tumors. Am J Clin Pathol. 133:141–148. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Miettinen M, Killian JK, Wang Z-F, Lasota J, Lau C, Jones L, Walker R, Pineda M, Zhu YJ, Kim SY, et al: Immunohistochemical loss of succinate dehydrogenase subunit A (SDHA) in gastrointestinal stromal tumors (GISTs) signals SDHA germline mutation. Am J Surg Pathol. 37:234–240. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Jones DH, Caracciolo JT, Hodul PJ, Strosberg JR, Coppola D and Bui MM: Familial gastrointestinal stromal tumor syndrome: Report of 2 cases with KIT exon 11 mutation. Cancer Control. 22:102–108. 2015.PubMed/NCBI

15 

Janeway KA, Kim SY, Lodish M, Nosé V, Rustin P, Gaal J, Dahia PL, Liegl B, Ball ER, Raygada M, et al: NIH Pediatric and Wild-Type GIST Clinic: Defects in succinate dehydrogenase in gastrointestinal stromal tumors lacking KIT and PDGFRA mutations. Proc Natl Acad Sci USA. 108:314–318. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Pantaleo MA, Astolfi A, Urbini M, Nannini M, Paterini P, Indio V, Saponara M, Formica S, Ceccarelli C, Casadio R, et al: GIST Study Group: Analysis of all subunits, SDHA, SDHB, SDHC, SDHD, of the succinate dehydrogenase complex in KIT/PDGFRA wild-type GIST. Eur J Hum Genet. 22:32–39. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Joensuu H, Vehtari A, Riihimäki J, Nishida T, Steigen SE, Brabec P, Plank L, Nilsson B, Cirilli C, Braconi C, et al: Risk of recurrence of gastrointestinal stromal tumour after surgery: An analysis of pooled population-based cohorts. Lancet Oncol. 13:265–274. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Bischof DA, Kim Y, Dodson R, Jimenez MC, Behman R, Cocieru A, Fisher SB, Groeschl RT, MH III Squires, Maithel SK, et al: Conditional disease-free survival after surgical resection of gastrointestinal stromal tumors: A multi-institutional analysis of 502 patients. JAMA Surg. 150:299–306. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Fletcher CDM, Berman JJ, Corless C, Gorstein F, Lasota J, Longley BJ, Miettinen M, O'Leary TJ, Remotti H, Rubin BP, et al: Diagnosis of gastrointestinal stromal tumors: A consensus approach. Hum Pathol. 33:459–465. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Miettinen M and Lasota J: Gastrointestinal stromal tumors: Pathology and prognosis at different sites. Semin Diagn Pathol. 23:70–83. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Wozniak A, Rutkowski P, Piskorz A, Ciwoniuk M, Osuch C, Bylina E, Sygut J, Chosia M, Rys J, Urbanczyk K, et al: Polish Clinical GIST Registry: Prognostic value of KIT/PDGFRA mutations in gastrointestinal stromal tumours (GIST): Polish Clinical GIST Registry experience. Ann Oncol. 23:353–360. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Mol CD, Dougan DR, Schneider TR, Skene RJ, Kraus ML, Scheibe DN, Snell GP, Zou H, Sang BC and Wilson KP: Structural basis for the autoinhibition and STI-571 inhibition of c-Kit tyrosine kinase. J Biol Chem. 279:31655–31663. 2004. View Article : Google Scholar : PubMed/NCBI

23 

Tuveson DA, Willis NA, Jacks T, Griffin JD, Singer S, Fletcher CD, Fletcher JA and Demetri GD: STI571 inactivation of the gastrointestinal stromal tumor c-KIT oncoprotein: Biological and clinical implications. Oncogene. 20:5054–5058. 2001. View Article : Google Scholar : PubMed/NCBI

24 

Heinrich MC, Griffith DJ, Druker BJ, Wait CL, Ott KA and Zigler AJ: Inhibition of c-kit receptor tyrosine kinase activity by STI 571, a selective tyrosine kinase inhibitor. Blood. 96:925–932. 2000.PubMed/NCBI

25 

Demetri GD, von Mehren M, Blanke CD, van den Abbeele AD, Eisenberg B, Roberts PJ, Heinrich MC, Tuveson DA, Singer S, Janicek M, et al: Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors. N Engl J Med. 347:472–480. 2002. View Article : Google Scholar : PubMed/NCBI

26 

Heinrich MC, Corless CL, Demetri GD, Blanke CD, von Mehren M, Joensuu H, McGreevey LS, Chen CJ, van den Abbeele AD, Druker BJ, et al: Kinase mutations and imatinib response in patients with metastatic gastrointestinal stromal tumor. J Clin Oncol. 21:4342–4349. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Heinrich MC, Maki RG, Corless CL, Antonescu CR, Harlow A, Griffith D, Town A, McKinley A, Ou WB, Fletcher JA, et al: Primary and secondary kinase genotypes correlate with the biological and clinical activity of sunitinib in imatinib-resistant gastrointestinal stromal tumor. J Clin Oncol. 26:5352–5359. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Chen LL, Trent JC, Wu EF, Fuller GN, Ramdas L, Zhang W, Raymond AK, Prieto VG, Oyedeji CO, Hunt KK, et al: A missense mutation in KIT kinase domain 1 correlates with imatinib resistance in gastrointestinal stromal tumors. Cancer Res. 64:5913–5919. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Heinrich MC, Corless CL, Blanke CD, Demetri GD, Joensuu H, Roberts PJ, Eisenberg BL, von Mehren M, Fletcher CD, Sandau K, et al: Molecular correlates of imatinib resistance in gastrointestinal stromal tumors. J Clin Oncol. 24:4764–4774. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Wardelmann E, Thomas N, Merkelbach-Bruse S, Pauls K, Speidel N, Büttner R, Bihl H, Leutner CC, Heinicke T and Hohenberger P: Acquired resistance to imatinib in gastrointestinal stromal tumours caused by multiple KIT mutations. Lancet Oncol. 6:249–251. 2005. View Article : Google Scholar : PubMed/NCBI

31 

Liegl B, Kepten I, Le C, Zhu M, Demetri GD, Heinrich MC, Fletcher CD, Corless CL and Fletcher JA: Heterogeneity of kinase inhibitor resistance mechanisms in GIST. J Pathol. 216:64–74. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Nishida T, Kanda T, Nishitani A, Takahashi T, Nakajima K, Ishikawa T and Hirota S: Secondary mutations in the kinase domain of the KIT gene are predominant in imatinib-resistant gastrointestinal stromal tumor. Cancer Sci. 99:799–804. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Demetri GD, van Oosterom AT, Garrett CR, Blackstein ME, Shah MH, Verweij J, McArthur G, Judson IR, Heinrich MC, Morgan JA, et al: Efficacy and safety of sunitinib in patients with advanced gastrointestinal stromal tumour after failure of imatinib: A randomised controlled trial. Lancet. 368:1329–1338. 2006. View Article : Google Scholar : PubMed/NCBI

34 

George S, Wang Q, Heinrich MC, Corless CL, Zhu M, Butrynski JE, Morgan JA, Wagner AJ, Choy E, Tap WD, et al: Efficacy and safety of regorafenib in patients with metastatic and/or unresectable GI stromal tumor after failure of imatinib and sunitinib: A multicenter phase II trial. J Clin Oncol. 30:2401–2407. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Guo T, Agaram NP, Wong GC, Hom G, D'Adamo D, Maki RG, Schwartz GK, Veach D, Clarkson BD, Singer S, et al: Sorafenib inhibits the imatinib-resistant KITT670I gatekeeper mutation in gastrointestinal stromal tumor. Clin Cancer Res. 13:4874–4881. 2007. View Article : Google Scholar : PubMed/NCBI

36 

Cullinane C, Natoli A, Hui Y, Conus N, Jackson S, Brüggen J, Manley PW and McArthur GA: Preclinical evaluation of nilotinib efficacy in an imatinib-resistant KIT-driven tumor model. Mol Cancer Ther. 9:1461–1468. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Steigen SE, Eide TJ, Wasag B, Lasota J and Miettinen M: Mutations in gastrointestinal stromal tumors - a population-based study from Northern Norway. APMIS. 115:289–298. 2007. View Article : Google Scholar : PubMed/NCBI

38 

Mazzola P, Spitale A, Banfi S, Mazzucchelli L, Frattini M and Bordoni A: Epidemiology and molecular biology of gastrointestinal stromal tumors (GISTs): A population-based study in the South of Switzerland, 1999–2005. Histol Histopathol. 23:1379–1386. 2008.PubMed/NCBI

39 

Nowak F, Soria JC and Calvo F: Tumour molecular profiling for deciding therapy-the French initiative. Nat Rev Clin Oncol. 9:479–486. 2012. View Article : Google Scholar : PubMed/NCBI

40 

Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S and Madden TL: Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13:1342012. View Article : Google Scholar : PubMed/NCBI

41 

Magnin S, Viel E, Baraquin A, Valmary-Degano S, Kantelip B, Pretet JL, Mougin C, Bigand M, Girardo B, Borg C, et al: A multiplex SNaPshot assay as a rapid method for detecting KRAS and BRAF mutations in advanced colorectal cancers. J Mol Diagn. 13:485–492. 2011. View Article : Google Scholar : PubMed/NCBI

42 

Cassier PA, Ducimetière F, Lurkin A, Ranchère-Vince D, Scoazec JY, Bringuier PP, Decouvelaere AV, Méeus P, Cellier D, Blay JY, et al: A prospective epidemiological study of new incident GISTs during two consecutive years in Rhône A lpes region: Incidence and molecular distribution of GIST in a European region. Br J Cancer. 103:165–170. 2010. View Article : Google Scholar : PubMed/NCBI

43 

Mendoza Y, Singh C, Mewa J Castillo, Fonseca E, Smith R and Pascale JM: Beginning of personalized medicine in Panama: Molecular and pathological characteristics of gastrointestinal stromal tumors from archival paraffin-embedded tissue. Oncol Lett. 2:941–947. 2011.PubMed/NCBI

44 

Heinrich MC, Owzar K, Corless CL, Hollis D, Borden EC, Fletcher CD, Ryan CW, von Mehren M, Blanke CD, Rankin C, et al: Correlation of kinase genotype and clinical outcome in the North American Intergroup Phase III Trial of imatinib mesylate for treatment of advanced gastrointestinal stromal tumor: CALGB 150105 Study by Cancer and Leukemia Group B and Southwest Oncology Group. J Clin Oncol. 26:5360–5367. 2008. View Article : Google Scholar : PubMed/NCBI

45 

Sciot R, Debiec-Rychter M, Daugaard S, Fisher C, Collin F, van Glabbeke M, Verweij J, Blay JY; Hogendoorn PCEORTC Soft Tissue and Bone Sarcoma Group, ; et al: Australasian Trials Group: Distribution and prognostic value of histopathologic data and immunohistochemical markers in gastrointestinal stromal tumours (GISTs): An analysis of the EORTC phase III trial of treatment of metastatic GISTs with imatinib mesylate. Eur J Cancer. 44:1855–1860. 2008. View Article : Google Scholar : PubMed/NCBI

46 

Kang HJ, Ryu MH, Kim KM, Park YS, Choi J, Ryoo BY, Kim WH, Im SA, Bang YJ, Park SH, et al: Imatinib efficacy by tumor genotype in Korean patients with advanced gastrointestinal stromal tumors (GIST): The Korean GIST Study Group (KGSG) study. Acta Oncol. 51:528–536. 2012. View Article : Google Scholar : PubMed/NCBI

47 

Joensuu H, Rutkowski P, Nishida T, Steigen SE, Brabec P, Plank L, Nilsson B, Braconi C, Bordoni A, Magnusson MK, et al: KIT and PDGFRA mutations and the risk of GI stromal tumor recurrence. J Clin Oncol. 33:634–642. 2015. View Article : Google Scholar : PubMed/NCBI

48 

Origone P, Gargiulo S, Mastracci L, Ballestrero A, Battistuzzi L, Casella C, Comandini D, Cusano R, Dei Tos AP, Fiocca R, et al: Liguria GIST Unit: Molecular characterization of an Italian series of sporadic GISTs. Gastric Cancer. 16:596–601. 2013. View Article : Google Scholar : PubMed/NCBI

49 

Ahmad F, Lad P, Bhatia S and Das BR: Molecular spectrum of c-KIT and PDGFRA gene mutations in gastro intestinal stromal tumor: Determination of frequency, distribution pattern and identification of novel mutations in Indian patients. Med Oncol. 32:4242015. View Article : Google Scholar : PubMed/NCBI

50 

Wang M, Xu J, Zhao W, Tu L, Qiu W, Wang C, Shen Y, Liu Q and Cao H: Prognostic value of mutational characteristics in gastrointestinal stromal tumors: A single-center experience in 275 cases. Med Oncol. 31:8192014. View Article : Google Scholar : PubMed/NCBI

51 

Minárik G, Plank L, Lasabová Z, Szemes T, Burjanivová T, Szépe P, Buzalková V, Porubský D and Sufliarsky J: Spectrum of mutations in gastrointestinal stromal tumor patients - a population-based study from Slovakia. APMIS. 121:539–548. 2013. View Article : Google Scholar : PubMed/NCBI

52 

Tryggvason G, Hilmarsdottir B, Gunnarsson GH, Jónsson JJ, Jónasson JG and Magnússon MK: Tyrosine kinase mutations in gastrointestinal stromal tumors in a nation-wide study in Iceland. APMIS. 118:648–656. 2010. View Article : Google Scholar : PubMed/NCBI

53 

Blanke CD, Rankin C, Demetri GD, Ryan CW, von Mehren M, Benjamin RS, Raymond AK, Bramwell VH, Baker LH, Maki RG, et al: Phase III randomized, intergroup trial assessing imatinib mesylate at two dose levels in patients with unresectable or metastatic gastrointestinal stromal tumors expressing the kit receptor tyrosine kinase: S0033. J Clin Oncol. 26:626–632. 2008. View Article : Google Scholar : PubMed/NCBI

54 

Blanke CD, Demetri GD, von Mehren M, Heinrich MC, Eisenberg B, Fletcher JA, Corless CL, Fletcher CD, Roberts PJ, Heinz D, et al: Long-term results from a randomized phase II trial of standard- versus higher-dose imatinib mesylate for patients with unresectable or metastatic gastrointestinal stromal tumors expressing KIT. J Clin Oncol. 26:620–625. 2008. View Article : Google Scholar : PubMed/NCBI

55 

Joensuu H, Fletcher C, Dimitrijevic S, Silberman S, Roberts P and Demetri G: Management of malignant gastrointestinal stromal tumours. Lancet Oncol. 3:655–664. 2002. View Article : Google Scholar : PubMed/NCBI

56 

Gastrointestinal Stromal Tumor Meta-Analysis Group (MetaGIST), . Comparison of two doses of imatinib for the treatment of unresectable or metastatic gastrointestinal stromal tumors: A meta-analysis of 1,640 patients. J Clin Oncol. 28:1247–1253. 2010. View Article : Google Scholar : PubMed/NCBI

57 

Wardelmann E, Losen I, Hans V, Neidt I, Speidel N, Bierhoff E, Heinicke T, Pietsch T, Büttner R and Merkelbach-Bruse S: Deletion of Trp-557 and Lys-558 in the juxtamembrane domain of the c-kit protooncogene is associated with metastatic behavior of gastrointestinal stromal tumors. Int J Cancer. 106:887–895. 2003. View Article : Google Scholar : PubMed/NCBI

58 

Andersson J, Bümming P, Meis-Kindblom JM, Sihto H, Nupponen N, Joensuu H, Odén A, Gustavsson B, Kindblom LG and Nilsson B: Gastrointestinal stromal tumors with KIT exon 11 deletions are associated with poor prognosis. Gastroenterology. 130:1573–1581. 2006. View Article : Google Scholar : PubMed/NCBI

59 

O'Brien KM, Orlow I, Antonescu CR, Ballman K, McCall L, DeMatteo R and Engel LS: Gastrointestinal stromal tumors, somatic mutations and candidate genetic risk variants. PLoS One. 8:e621192013. View Article : Google Scholar : PubMed/NCBI

60 

He HY, Fang WG, Zhong HH, Li Y, Zheng J, Du J, Heng WJ and Wu BQ: Status and clinical implication of c-kit and PDGFRA mutations in 165 cases of gastrointestinal stromal tumor (GIST). Zhonghua Bing Li Xue Za Zhi. 35:262–266. 2006.(In Chinese). PubMed/NCBI

61 

Baker G, Babb C, Schnugh D, Nayler S, Louw M, Goedhals J, Bringuier PP, Blay JY and Willem P: Molecular characterisation of gastrointestinal stromal tumours in a South African population. Oncol Lett. 5:155–160. 2013.PubMed/NCBI

62 

Saito K, Sakurai S, Sano T, Sakamoto K, Asao T, Hosoya Y, Nakajima T and Kuwano H: Aberrant methylation status of known methylation-sensitive CpG islands in gastrointestinal stromal tumors without any correlation to the state of c-kit and PDGFRA gene mutations and their malignancy. Cancer Sci. 99:253–259. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

March 2017
Volume 37 Issue 3

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Guenat, D., Deroo, O., Magnin, S., Chaigneau, L., Monnien, F., Borg, C. ... Prétet, J. (2017). Somatic mutational spectrum analysis in a prospective series of 104 gastrointestinal stromal tumors. Oncology Reports, 37, 1671-1681. https://doi.org/10.3892/or.2017.5384
MLA
Guenat, D., Deroo, O., Magnin, S., Chaigneau, L., Monnien, F., Borg, C., Mougin, C., Emile, J., Prétet, J."Somatic mutational spectrum analysis in a prospective series of 104 gastrointestinal stromal tumors". Oncology Reports 37.3 (2017): 1671-1681.
Chicago
Guenat, D., Deroo, O., Magnin, S., Chaigneau, L., Monnien, F., Borg, C., Mougin, C., Emile, J., Prétet, J."Somatic mutational spectrum analysis in a prospective series of 104 gastrointestinal stromal tumors". Oncology Reports 37, no. 3 (2017): 1671-1681. https://doi.org/10.3892/or.2017.5384