miR‑24 may be a negative regulator of menin in lung cancer

  • Authors:
    • Yunhu Pan
    • Hongmei Wang
    • Debin Ma
    • Zhiyu Ji
    • Limin Luo
    • Fangyu Cao
    • Fangfang Huang
    • Yangyang Liu
    • Yushu Dong
    • Yitan Chen
  • View Affiliations

  • Published online on: March 20, 2018     https://doi.org/10.3892/or.2018.6327
  • Pages: 2342-2350
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The incidence of lung cancer in China increases annually, and effective targets for the diagnosis and treatment of lung cancer are urgently needed. miRNAs are currently considered to be involved in the regulation of tumor development and growth. miR‑24 has been found to contribute to the development of several tumors. Menin is a key tumor suppressor gene, and its expression is generally low in lung cancer. The effects of miR‑24 on the biological behavior of lung cancer cells were detected by MTT and Transwell assays. In the present study, miR‑24 was found to be associated with menin, affecting the activity of the SMAD3 pathway in lung cancer by inhibiting menin expression. miR‑24 may promote the growth and metastasis and inhibit the apoptosis of lung cancer cells by targeting menin. Therefore, the aim of the present study was to provide a new theoretical basis for the targeted therapy of lung cancer.

Introduction

According to WHO statistics, the incidence of lung cancer in China increases annually by ~25% (1,2). Mutations of key proto-oncogenes, such as K-ras, ALK and EGFR, and tumor-suppressor genes, such as p53, are important molecular mechanisms underlying the occurrence of lung cancer (37).

In recent years, miRNAs have been attracting increasing attention in the research of tumor pathogenesis, (810) and their sensitivity and specificity for the diagnosis of lung cancer have been found to be relatively high (11,12).

Men1, a critical tumor-suppressor gene in multiple endocrine neoplasia type 1, encodes a recently identified protein, menin, of which the emerging roles in cancer development have been attracting increasing attention (13). It has also been reported that menin plays a role in suppressing hyperplasia or tumor development in several other organs, such as the lung, prostate and breast, and it exacerbates diabetes in mouse models (14). However, the molecular mechanisms underlying the role of menin in lung cancer remain unclear.

miR-24 is reportedly able to promote the development of several types of tumors. For example, miR-24 promoted the proliferation and inhibited the apoptosis of HeLa cells (15,16), and has also been found to be highly expressed in Hodgkin's lymphoma (1721). However, the association between miR-24 and menin has not yet been fully elucidated.

In the present study, the RNA expression of miR-24 and menin in lung cancer and adjacent tissues were observed, and it was demonstrated that miR-24 also promotes cell growth and metastasis by targeting menin.

Materials and methods

Tissue samples and cell lines

A total of 70 samples of tumor tissues and adjacent tissues (≥2 cm from the tumor) from patients with lung cancer who were diagnosed and treated at the General Hospital of Shenyang Military Command were obtained between May 2013 and June 2015. The study protocols were approved by the Ethics Committee of the General Hospital of Shenyang Military Command. Patient consent was obtained in writing according to institutional regulations.

A549 and NCI-H446 cells (obtained from the Wuhan Cell Bank) were maintained in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (HyClone; GE Healthcare Life Sciences, Chicago, IL, USA), 1% penicillin/streptomycin, 1% L-glutamine, under 5% CO2 at 37°C.

Transfections

A549 and NCI-H 446 cells (1×105) were plated in 6-well plates and transfected with 100 nM of miR-24 mimic (UGGCUCAGUUCAGCAGGAACAG)/ mimic or control (UCACAACCUCCUAGAAAGAGUAGA) and miR-24 inhibitor (CUGUUCCUGCUGAACUGAGCCA)/inhibitor or control (CAGUACUUUUGUGUAGUACAA) (Guangzhou RiboBio Co., Ltd., Guangzhou, China) after 24 h by Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific) according to the manufacturer's protocol. Menin and menin-del were transfected into cells with Lipofectamine 2000, and the experiments were conducted after 24 h.

MTT assays

Cells were seeded at a density of 1×103 cells/well in 96-well plates, and transfected with different miRNAs. The MTT assay was performed 24 h later, using a microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA) to evaluate cell proliferation. The optical densities of the samples were measured at 490 nm.

Hoechst 33258 assay

After transfection for 24 h, washing with PBS, and addition of 1 µl (1 mg/ml) Hoechst 33258 for 10 min, the samples were examined using fluorescence microscopy.

Transwell assay

Modified Boyden chambers with polycarbonate Nuclepore membranes (Corning Inc., Corning, NY, USA) were used to perform metastasis assays according to the manufacturer's protocol. After 24 h, the transfected cells were seeded in Transwell chambers in serum-free media with or without Matrigel coating, while medium containing 30% fetal bovine serum was placed in the lower well. After 24 h, the cells were washed with PBS, fixed with methanol for 20 min, stained with crystal violet dye for 10 min and then counted under a light microscope.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RNA was extracted from tissue samples or cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. cDNA synthesis was performed with the High-Capacity cDNA synthesis kit (Takara Bio, Inc., Otsu, Japan). RT-qPCR analysis was performed on an Applied Biosystems 7500 Real-Time PCR System according to the manufacturer's instructions (33). The primer sequences are shown in Table I. All the reactions were performed as previously described (34).

Table I.

Primer sequences for the detection of RNA expression.

Table I.

Primer sequences for the detection of RNA expression.

NameForward primer (5′->3′)Reverse primer (5′->3′)
miR-24 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTC GGACTGTCTTGGCATCCATGTAG
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
Menin GCACACAGACAACCTGATCTTTT TCGGGAACGTTGGTAGGGAT
Cyclin D1 CCGAGGAGCTGCTGCAAATGG GAAATCGTGCGGGGTCATTGCG
Bcl-2 GGTGAACTGGGGGAGGATTG GGCAGGCATGTTGACTTCAC
Bax AGCTGAGCGAGTGTCTCAAG GTCCAATGTCCAGCCCATGA
MMP2 TGATCTTGACCAGAATACCATCG GGCTTGCGAGGGAAGAAGTT
GAPDH AACGACCCCTTCATTGAC TCCACGACATACTCAGGGACAAC
Western blot analysis

Tissues and cells were scraped and lysed in RIPA buffer (Sigma-Aldrich; Merck KGAa, Darmstadt, Germany). To determine the levels of different proteins, 30 µg of protein from each sample was subjected to 10% SDS-PAGE and transferred onto a nitrocellulose membrane (Corning Inc.). Target proteins were probed with specific antibodies against menin (1:1,000; cat. no. sc-374371), SMAD3 (1:1,000; cat. no. sc-4709), cyclin D1 (1:1,000; cat. no. sc-4074), Bax (1:1,000; cat. no. sc-4239), Bcl-2 (1:1,000; cat. no. sc-56015), MMP2 (1:1,000; cat. no. sc-13594) and GAPDH (1:5,000; cat. no. sc-365062) (all from Santa Cruz Biotechnology, Inc., Dallas, TX, USA).

Dual-luciferase reporter assay

Dual-luciferase activity assays were performed as previously described (35). The menin 3′-untranslated region (UTR) was PCR-amplified and cloned into the pMIR-REPORT™ vector (Ambion; Thermo Fisher Scientific). The sequences were as follows: menin-wt forward, 5′-TGCACACAGACAACCTGATCT-3′ and reverse, 5′-ACACCGGAGCTGTCCAATTT-3′; and menin-del forward, 5′-CTGCACACAGACAACCTGATCT-3′ and reverse, 5′-GCCATGGGGTACCTTTCCAG-3′. A549 cells were co-transfected with menin-wt or -del reporter vector and control plasmid in miR-24 mimic and miR-24 AS (antisense). Luciferase activity was determined with the Dual-Luciferase Reporter Assay System (Promega Corp., Madison, WI, USA) after 36 h of transfection.

Statistical analysis

All experiments were repeated at least three times. A correlation analysis with the log-rank test was used to evaluate the differences in the levels of possible prognostic factors. Statistical significance was evaluated with the two-tailed Student's t-test comparing two groups of data. Asterisks indicate significant differences of experimental groups compared with the corresponding control condition. Statistical analysis was performed using GraphPad Prism software (GraphPad, Inc. Inc., La Jolla, CA, USA) and statistical significance was defined as P<0.05.

Results

Association of miR-24 and menin in lung cancer

The results revealed that the expression of miR-24 in the tumor tissues was found to be higher compared with that in the adjacent tissues of 70 lung cancer patients as determined by qPCR (Fig. 1A). The results of the Kaplan-Meier analysis demonstrated that patients with high miR-24 expression had a significantly decreased overall survival (Fig. 1B). Next, we observed that miR-24 was closely associated with the development of lung cancer. There was a correlation between miR-24 and the size of the tumor (Table II). Biological software (miRDB) predicted that miR-24 may target menin. Based on that finding, we analyzed the expression of menin in cancer tissues and adjacent tissues in the patients by qPCR (Fig. 1C). The results revealed that the expression level of menin was lower in tumor tissues than in adjacent normal tissues. In the Kaplan-Meier analysis, we observed that patients with a high expression of menin survived longer (Fig. 1D). It was also observed that miR-24 and menin were negatively correlated in these patients (Fig. 1E). Using the miRDB software, we identified a binding site in the 3′-UTR region of menin for miR-24 (Fig. 1F). The luciferase reporter assay demonstrated that the activity of menin was significantly inhibited following co-transfection with miR-24. This inhibitory effect was eliminated when the 3′-UTR region of menin was mutated. Furthermore, transfection with the miR-24 antisense strand did not inhibit the activity of menin (Fig. 1G).

Table II.

The relationship between miR-24 and lung cancer.

Table II.

The relationship between miR-24 and lung cancer.

miR-24 expression

ParametersDescriptionNo. of patientsLowHighχ2P-value
SexMale441727   0.3810.537
Female261214
Age (years)<40221012   0.2140.643
≥40481929
Typenon-small cell602733   2.2080.137
Small cell10  2  8
Tumor size (cm)<5321814   5.3370.021a
≥5381127
Depth of invasion (pT)T1, T242113110.0480.002a
T3, T4281810
Lymph node metastasis (pN)Yes421329   4.7490.029a
No281612
Distant metastasis (pM)Yes  9  1  8   3.9120.048a
No6128  3
TNM stageI–II372116   7.5990.006b
III–IV33  825

a P<0.05 There is a difference in miR-24 between two groups.

b P<0.05 There is a significant difference in miR-24 between two groups.

miR-24 promotes the proliferation of lung cancer cells

The miR-24 mimic/inhibitor was transfected into lung cancer cells, and the effect of miR-24 on proliferation was then evaluated by MTT assay (Fig. 2A and B). It was observed that the proliferation of lung cancer cells was stimulated when miR-24 was overexpressed. Menin, SMAD3 and cyclin D1 were assessed when miR-24 was overexpressed in A549 cells (Fig. 2C and D). The results demonstrated that miR-24 inhibited the expression of menin, and it also upregulated SMAD3 and cyclin D1 expression. In turn, when miR-24 was inhibited in A549 cells, menin expression was increased (Fig. 2E and F), whereas SMAD3 and cyclin D1 expression levels in A549 cells were decreased.

miR-24 inhibits the apoptosis of lung cancer cells

Since miR-24 affects menin to regulate the proliferation of lung cancer cells, it was hypothesized that the apoptosis of lung cancer cells may also be affected by targeting menin. miR-24 mimics/controls or miR-24 inhibitors/controls were transfected into A549 cells to observe the effect of miR-24 on the apoptosis of A549 cells (Fig. 3A and B). Hoechst 33258 staining revealed that miR-24 significantly inhibited the apoptosis of A549 cells. Next, we examined the protein and mRNA levels of menin, SMAD3, Bcl-2 and Bax in A549 cells overexpressing miR-24 (Fig. 3C and D). The results demonstrated that Bcl-2 expression was increased, whereas Bax expression was inhibited when miR-24 was overexpressed. It was then observed that the expression of Bcl-2 was inhibited and that of Bax was promoted at both the protein and mRNA levels after miR-24 inhibitor was transfected into A549 cells (Fig. 3E and F).

miR-24 promotes the metastasis of lung cancer cells

Transwell assays (with or without Matrigel) were used to investigate whether miR-24 is involved in the metastasis of lung cancer cells (Fig. 4A-D). A miR-24 mimic or miR-24 inhibitor was transfected into A549 and NCI-H446 cells. Subsequently, the Transwell results demonstrated that the migration and invasion of A549 and NCI-H446 cells were significantly enhanced when miR-24 was overexpressed; however, the migration and invasion of A549 and NCI-H446 cells were inhibited when miR-24 expression was decreased. Furthermore, the protein and mRNA levels of menin, SMAD3 and MMP2 were assessed by western blotting and qPCR when the expression of miR-24 was up- or downregulated in A549 cells (Fig. 4E-H). The results indicated that menin was significantly downregulated, whereas SMAD3 and MMP2 were significantly upregulated by miR-24.

Discussion

Despite the continuous development of early diagnostic and treatment methods for lung cancer, the 5-year survival rate of lung cancer remains <50% according to the WHO (22,23). Thus, early detection and timely treatment are crucial for lung cancer patients.

miRNAs are endogenous, small, non-coding, regulatory RNAs that have attracted attention in recent years. A number of reports have indicated that the expression of miRNAs is closely associated with cancer development.

miR-24 has been demonstrated to promote the development of several tumors. In hepatocellular carcinoma (HCC), miR-24 functions as an oncogene, at least in part by promoting cell invasion through downregulation of p53 (24), and miR-24-3p plays an important role in the initiation and progression of HCC by targeting metallothionein 1M (25). It has also been demonstrated that exosomal miR-24-3p is involved in tumor pathogenesis by mediating T-cell suppression via repression of FGF11, and may serve as a potential prognostic biomarker in nasopharyngeal cancer (NPC) (26). Additionally, it was reported that miR-24-3p significantly inhibited N87 cell growth, migration and invasion, and promoted apoptosis (27). Zhao et al reported that miR-24 may serve as a novel potential biomarker for the prognosis of TSCC patients through targeting FBXW7 (28). It was also demonstrated that miR-24 acts as a tumor suppressor in NPC through targeting FSCN1 (29). In lung cancer, miR-24 may promote cell proliferation by targeting NAIF1 (19). Downregulation contributes to VP16-DDP resistance by targeting ATG4A (21) and enhances tumor invasion and metastasis by targeting PTPN9 and PTPRF to promote EGF signaling (30). All these findings indicate that miR-24 may play an important role in the regulation of lung cancer.

Menin regulates cell proliferation, apoptosis, metastasis and gene transcription. Menin mutations have been detected in 35% of tumors. One of the proteins interacting with menin is β-catenin, which acts as a transcription factor, and its dysregulation may be associated with the development and progression of several tumors (31). It has also been reported that menin can interact with K-Ras, SMAD3 and TGF-β to exert a biological effect. In human studies, menin expression was found to be lower in lung adenocarcinoma samples, and it may mediate repression of lung cancer and provide a novel potential target for treating menin-negative and Ras-active lung adenocarcinoma (32).

In our experiments, tumor tissues and adjacent tissues from 70 patients with lung cancer were analyzed. The analysis results revealed that miR-24 expression in the tumor tissues was significantly higher compared with that in adjacent tissues, whereas menin expression in the tumor tissues was lower compared with that in the adjacent tissues. In addition, we observed that patients with higher expression of miR-24 had a shorter 5-year survival. By comparison, patients with a higher content of menin survived longer. Thus, it was inferred that miR-24 may be associated with the expression of menin. miR-24 and menin were found to be negatively correlated, and the correlation formula was y=−1.014x+1.246, R2=0.4353. Through the biological software and luciferase reporter assay, it was demonstrated that miR-24 could directly target menin and significantly inhibit its activity, thereby promoting the growth and metastasis of lung cancer cells. The regulatory effect of miR-24 on the growth of lung cancer cells was at least partially realized by targeting menin. The regulatory role of miR-24 in lung cancer was demonstrated through experiments in vitro, and in future experiments our results may be further confirmed in vivo. For the in vivo experiments, a nude mice tumor-bearing model may be constructed, followed by expressing miR-24 in nude mice to detect the proliferation of tumor cells. A mouse lung cancer model may also be constructed to detect the invasion of lung cancer cells overexpressing miR-24.

In summary, we demonstrated that the promotion of the growth and metastasis of lung cancer cells by miR-24 is at least partly mediated by the regulation of menin. Our findings provide a new theoretical basis for the diagnosis and treatment of lung cancer.

Acknowledgements

Not applicable.

References

1 

Lin J, Wang Y, Zou YQ, Chen X, Huang B, Liu J, Xu YM, Li J, Zhang J, Yang WM, et al: Differential miRNA expression in pleural effusions derived from extracellular vesicles of patients with lung cancer, pulmonary tuberculosis, or pneumonia. Tumour Biol. Oct 14–2016. View Article : Google Scholar

2 

Perepelyuk M, Maher C, Lakshmikuttyamma A and Shoyele SA: Aptamer-hybrid nanoparticle bioconjugate efficiently delivers miRNA-29b to non-small-cell lung cancer cells and inhibits growth by downregulating essential oncoproteins. Int J Nanomedicine. 11:3533–3544. 2016. View Article : Google Scholar : PubMed/NCBI

3 

Aghanoori MR, Mirzaei B and Tavallaei M: MiRNA molecular profiles in human medical conditions: Connecting lung cancer and lung development phenomena. Asian Pac J Cancer Prev. 15:9557–9565. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Chen Y, Du M, Wang J, Xing P, Zhang Y, Li F and Lu X: MiRNA-200a expression is inverse correlation with hepatocyte growth factor expression in stromal fibroblasts and its high expression predicts a good prognosis in patients with non-small cell lung cancer. Oncotarget. 7:48432–48442. 2016.PubMed/NCBI

5 

Zhang X, Wang C, Shan S, Liu X, Jiang Z and Ren T: TLR4/ROS/miRNA-21 pathway underlies lipopolysaccharide instructed primary tumor outgrowth in lung cancer patients. Oncotarget. 7:42172–42182. 2016.PubMed/NCBI

6 

Zhao C, Lu F and Chen H, Zhao F, Zhu Z, Zhao X and Chen H: Clinical significance of circulating miRNA detection in lung cancer. Med Oncol. 33:412016. View Article : Google Scholar : PubMed/NCBI

7 

Zhou Z, Niu X, Li C, Sheng S and Lu S: Inhibition of the growth of non-small cell lung cancer by miRNA-1271. Am J Transl Res. 7:1917–1924. 2015.PubMed/NCBI

8 

Bianchi F, Nicassio F, Marzi M, Belloni E, Dall'olio V, Bernard L, Pelosi G, Maisonneuve P, Veronesi G and Di Fiore PP: A serum circulating miRNA diagnostic test to identify asymptomatic high-risk individuals with early stage lung cancer. EMBO Mol Med. 3:495–503. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Chen Y, Min L, Zhang X, Hu S, Wang B, Liu W, Wang R, Gu X, Shen W, Lv H, et al: Decreased miRNA-148a is associated with lymph node metastasis and poor clinical outcomes and functions as a suppressor of tumor metastasis in non-small cell lung cancer. Oncol Rep. 30:1832–1840. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Chen Z, Zeng H, Guo Y, Liu P, Pan H, Deng A and Hu J: miRNA-145 inhibits non-small cell lung cancer cell proliferation by targeting c-Myc. J Exp Clin Cancer Res. 29:1512010. View Article : Google Scholar : PubMed/NCBI

11 

Gao W, Lu X, Liu L, Xu J, Feng D and Shu Y: MiRNA-21: A biomarker predictive for platinum-based adjuvant chemotherapy response in patients with non-small cell lung cancer. Cancer Biol Ther. 13:330–340. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Sestini S, Boeri M, Marchianò A, Silva M, Calareso G, Galeone C, Sozzi G and Pastorino U: Lung cancer screening in high-risk subjects: Early detection with LDCT and risk stratification using miRNA-based blood test. Epidemiol Prev. 40 1 Suppl 1:S42–S50. 2016.(In Italian).

13 

Feng ZJ, Gao SB, Wu Y, Xu XF, Hua X and Jin GH: Lung cancer cell migration is regulated via repressing growth factor PTN/RPTP β/ζ signaling by menin. Oncogene. 29:5416–5426. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Matkar S, Thiel A and Hua X: Menin: A scaffold protein that controls gene expression and cell signaling. Trends Biochem Sci. 38:394–402. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Duan Y, Hu L, Liu B, Yu B, Li J, Yan M, Yu Y, Li C, Su L, Zhu Z, et al: Tumor suppressor miR-24 restrains gastric cancer progression by downregulating RegIV. Mol Cancer. 13:1272014. View Article : Google Scholar : PubMed/NCBI

16 

Martin EC, Elliott S, Rhodes LV, Antoon JW, Fewell C, Zhu Y, Driver JL, Jodari-Karimi M, Taylor CW, Flemington EK, et al: Preferential star strand biogenesis of pre-miR-24-2 targets PKC-alpha and suppresses cell survival in MCF-7 breast cancer cells. Mol Carcinog. 53:38–48. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Lynch SM, McKenna MM, Walsh CP and McKenna DJ: miR-24 regulates CDKN1B/p27 expression in prostate cancer. Prostate. 76:637–648. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Zhang H, Duan J, Qu Y, Deng T, Liu R, Zhang L, Bai M, Li J, Ning T, Ge S, et al: Onco-miR-24 regulates cell growth and apoptosis by targeting BCL2L11 in gastric cancer. Protein Cell. 7:141–151. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Zhao G, Liu L, Zhao T, Jin S, Jiang S, Cao S, Han J, Xin Y, Dong Q, Liu X and Cui J: Upregulation of miR-24 promotes cell proliferation by targeting NAIF1 in non-small cell lung cancer. Tumour Biol. 36:3693–3701. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Gao Y, Liu Y, Du L, Li J, Qu A, Zhang X, Wang L and Wang C: Down-regulation of miR-24-3p in colorectal cancer is associated with malignant behavior. Med Oncol. 32:3622015. View Article : Google Scholar : PubMed/NCBI

21 

Pan B, Chen Y, Song H, Xu Y, Wang R and Chen L: Mir-24-3p downregulation contributes to VP16-DDP resistance in small-cell lung cancer by targeting ATG4A. Oncotarget. 6:317–331. 2015. View Article : Google Scholar : PubMed/NCBI

22 

Yoshida T, Hida T and Yatabe Y: Rapid and dramatic response to alectinib in an anaplastic lymphoma kinase rearranged non-small-cell lung cancer patient who is critically ill. Anticancer Drugs. 27:573–575. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Huang ZL, Cao X, Luo RZ, Chen YF, Zhu LC and Wen Z: Analysis of ERCC1, BRCA1, RRM1 and TUBB3 as predictors of prognosis in patients with non-small cell lung cancer who received cisplatin-based adjuvant chemotherapy: A prospective study. Oncol Lett. 11:299–305. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Chen L, Luo L, Chen W, Xu HX, Chen F, Chen LZ, Zeng WT, Chen JS and Huang XH: MicroRNA-24 increases hepatocellular carcinoma cell metastasis and invasion by targeting p53: miR-24 targeted p53. Biomed Pharmacother. 84:1113–1118. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Dong X, Ding W, Ye J, Yan D, Xue F, Xu L, Yin J and Guo W: MiR-24-3p enhances cell growth in hepatocellular carcinoma by targeting metallothionein 1M. Cell Biochem Funct. 34:491–496. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Ye SB, Zhang H, Cai TT, Liu YN, Ni JJ, He J, Peng JY, Chen QY, Mo HY, Jun-Cui, et al: Exosomal miR-24-3p impedes T-cell function by targeting FGF11 and serves as a potential prognostic biomarker for nasopharyngeal carcinoma. J Pathol. 240:329–340. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Li Q, Wang N, Wei H, Li C, Wu J and Yang G: miR-24-3p regulates progression of gastric mucosal lesions and suppresses proliferation and invasiveness of N87 via peroxiredoxin 6. Dig Dis Sci. 61:486–3497. 2016. View Article : Google Scholar

28 

Zhao J, Hu C, Chi J, Li J, Peng C, Yun X, Li D, Yu Y, Li Y, Gao M and Zheng X: miR-24 promotes the proliferation, migration and invasion in human tongue squamous cell carcinoma by targeting FBXW7. Oncol Rep. 36:1143–1149. 2016. View Article : Google Scholar : PubMed/NCBI

29 

Li YQ, Lu JH, Bao XM, Wang XF, Wu JH and Hong WQ: MiR-24 functions as a tumor suppressor in nasopharyngeal carcinoma through targeting FSCN1. J Exp Clin Cancer Res. 34:1302015. View Article : Google Scholar : PubMed/NCBI

30 

Du WW, Fang L, Li M, Yang X, Liang Y, Peng C, Qian W, O'Malley YQ, Askeland RW, Sugg SL, et al: MicroRNA miR-24 enhances tumor invasion and metastasis by targeting PTPN9 and PTPRF to promote EGF signaling. J Cell Sci. 126:1440–1453. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Veschi S, Lattanzio R, Aceto GM, Curia MC, Magnasco S, Angelucci D, Cama A, Piantelli M and Battista P: Alterations of MEN1 and E-cadherin/β-catenin complex in sporadic pulmonary carcinoids. Int J Oncol. 41:1221–1228. 2012.PubMed/NCBI

32 

Wu Y, Feng ZJ, Gao SB, Matkar S, Xu B, Duan HB, Lin X, Li SH, Hua X and Jin GH: Interplay between menin and K-Ras in regulating lung adenocarcinoma. J Biol Chem. 287:40003–40011. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

34 

Pfaffl MW: A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:e452001. View Article : Google Scholar : PubMed/NCBI

35 

Yang TS, Yang XH, Wang XD, Wang YL, Zhou B and Song ZS: MiR-214 regulate gastric cancer cell proliferation, migration and invasion by targeting PTEN. Cancer Cell Int. 13:682013. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May-2018
Volume 39 Issue 5

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Pan Y, Wang H, Ma D, Ji Z, Luo L, Cao F, Huang F, Liu Y, Dong Y, Chen Y, Chen Y, et al: miR‑24 may be a negative regulator of menin in lung cancer. Oncol Rep 39: 2342-2350, 2018
APA
Pan, Y., Wang, H., Ma, D., Ji, Z., Luo, L., Cao, F. ... Chen, Y. (2018). miR‑24 may be a negative regulator of menin in lung cancer. Oncology Reports, 39, 2342-2350. https://doi.org/10.3892/or.2018.6327
MLA
Pan, Y., Wang, H., Ma, D., Ji, Z., Luo, L., Cao, F., Huang, F., Liu, Y., Dong, Y., Chen, Y."miR‑24 may be a negative regulator of menin in lung cancer". Oncology Reports 39.5 (2018): 2342-2350.
Chicago
Pan, Y., Wang, H., Ma, D., Ji, Z., Luo, L., Cao, F., Huang, F., Liu, Y., Dong, Y., Chen, Y."miR‑24 may be a negative regulator of menin in lung cancer". Oncology Reports 39, no. 5 (2018): 2342-2350. https://doi.org/10.3892/or.2018.6327