Inhibition of SOX4 induces melanoma cell apoptosis via downregulation of NF-κB p65 signaling

  • Authors:
    • Qiong Cheng
    • Juan Du
    • Lin Xie
    • Xiao Liu
    • Zheng Li
    • Fuguo Zuo
    • Jinfeng Wu
    • Jinhua Xu
  • View Affiliations

  • Published online on: May 16, 2018     https://doi.org/10.3892/or.2018.6443
  • Pages: 369-376
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

SOX4 (SRY Box 4) has attracted attention due to its important effects on cell growth, proliferation and apoptosis, among other cellular processes. However, the role of SOX4 in melanoma cell apoptosis remains unclear. In the present study, we investigated whether inhibition of SOX4 induces melanoma cell apoptosis, and explored the possible mechanism involving the NF-κB signaling pathway. SOX4 was knocked down using a lentivirus in melanoma A2058 and SK-MEL-5 cell lines. Cell proliferation was measured by MTT assay. Apoptosis was determined by flow cytometry. Western blotting was performed to detect the protein levels of SOX4, p65 and apoptosis-related proteins, such as PARP, Bcl-2, Bax and survivin. Quantitative real-time PCR (qRT-PCR) was used to examine the mRNA levels of SOX4 and p65. To determine whether SOX4 is able to bind to the promoter of p65, a CHIP-PCR assay was performed. Our data demonstrated that SOX4 knockdown significantly induced apoptosis in melanoma cells, which was accompanied by increases in cleaved PARP and Bax, and decreases in Bcl-2 and survivin. The expression of p65 was also decreased in SOX4-knockdown melanoma cells. The CHIP-PCR assay indicated that SOX4 was able to bind to the promoter region of p65. We also observed that apoptosis in SOX4-knockdown and p65-overexpressing A2058 cells was much lower than that in SOX4-knockdown alone cells. This revealed that the overexpression of p65 partially reversed SOX4 downregulation-induced apoptosis. In conclusion, our results demonstrated that inhibition of SOX4 markedly induced melanoma cell apoptosis via downregulation of the NF-κB signaling pathway, which thus may be a novel approach for the treatment of melanoma.

Introduction

SOX4 (SRY Box 4) is a 47-kDa protein and contains a conserved signature sequence in the high-mobility group (HMG). SOX4 is highly expressed in almost all types of cancer in humans, and plays an important role in the development of tumors (1). Recent studies have uncovered the key functions of the SOX4 gene as a regulator of cancer cell proliferation, apoptosis, invasion and metastasis.

SOX4 is considered to be a tumor-suppressor gene or an oncogene in different types of tumors. For example, SOX4 inhibits the cell proliferation of polymorphous glioblastoma (GBM) (2). However, high expression of SOX4 in nasopharyngeal carcinoma promotes tumor growth and metastasis (3). Whether SOX4 promotes apoptosis or represses apoptosis in different tumors remains a controversial question. Liu et al revealed that silencing of SOX4 by small interfering RNA transfection induced apoptosis in prostate cancer cells (4). Yoon et al found that SOX4 knockdown (KO) induced apoptosis by activating caspase-3 and caspase-7 in head and neck squamous cell carcinoma (HNSCC) cells (5). Hur et al reported that SOX4 overexpression led to a significant suppression of p53-induced Bax expression, and subsequent repression of p53-mediated apoptosis induced by γ-irradiation (6). Pramoonjago et al discovered that SOX4 knockdown resulted in the apoptosis of adenoid cystic carcinoma (ACC) cells (7) and Bilir et al also reported that SOX4 knockdown enhanced the effects of a wnt pathway inhibitor (iCRT-3) on apoptosis in breast cancer cells (8). Other researchers have reported the opposite findings regarding the role of SOX4 in apoptosis. Pan et al revealed that SOX4 promoted cell cycle arrest and apoptosis in human lung non-small cell carcinoma H460 cells (9). Aaboe et al confirmed that SOX4 strongly impaired bladder carcinoma cell viability and promoted apoptosis (10). Li et al revealed that SOX4 was more highly expressed in primary-stage (AJCC I and II) than in advanced-stage (AJCC III and IV) melanoma cases (11). Jafarnejad et al reported that SOX4 was underexpressed in metastatic melanoma compared with dysplastic nevi and primary melanoma; furthermore, knockdown of SOX4 enhanced melanoma cell invasion (12). However, the role of SOX4 in the apoptosis of melanoma cells remains unknown.

NF-κB is a classical signaling pathway that is involved in the survival, proliferation and apoptosis of tumor cells. Watanabe et al revealed that inhibition of the expression and/or activity of NF-κB induced apoptosis in melanoma cells (13). In this study, the role of SOX4 in the apoptosis of melanoma A2058 and SK-MEL-5 cells was investigated, and the underlying mechanisms were determined. We demonstrated that inhibition of SOX4 markedly induced melanoma cell apoptosis via downregulation of the NF-κB signaling pathway, thus, indicating a novel target for melanoma treatment.

Materials and methods

Cell culture and lentiviral transfection

The human melanoma A2058 and SK-MEL-5 cell lines were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA) and were cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen; Thermo Fisher Scientific, Carlsbad, CA, USA), supplemented with 1% penicillin/streptomycin (Sigma-Aldrtich; Merck KGaA, Darmstand, Germany) and 10% fetal bovine serum (FBS; Thermo Fisher Scientific) at 37°C. The melanoma cells (8×104/well) were plated into 6-well plates and incubated overnight. When the melanoma cells had reached ~70% confluence, they were infected with SOX4 shRNA (Shanghai GeneChem Co., Ltd., Shanghai, China) and/or p65-overexpressing lentivirus (Shanghai GeneChem Co., Ltd.) in FBS-free medium containing 6 µg/ml Polybrene (Sigma-Aldrtich; Merck KGaA). We used blank vector lentivirus as the control. Twenty-four hours later, the FBS-free medium was replaced with 10% FBS culture medium. SOX4 and p65 expression in cells was confirmed by western blot analysis and a real-time PCR assay 72 h after lentiviral infection.

MTT assay

Cells (5×103) were seeded in 96-well plates. At 24, 48 or 72 h post-transfection, 20 µl MTT solution (5 mg/ml) was added to each well and incubated for 4 h. The medium was subsequently removed and 150 µl dimethyl sulfoxide (DMSO) was added. The optical density (OD) was detected at 600 nm with a microplate spectrophotometer (BD Biosciences, San Jose, CA, USA).

Western blot assay

A2058 and SK-MEL-5 cells were lysed in RIPA buffer (Beyotime Institute of Biotechnology, Haimen, China) for total protein extraction. The cells were lysed on ice for 15 min, after 12,000 rpm centrifugation for 10 min. The proteins in the supernatant were extracted. We carried out nuclear protein extraction, according to the manufacturer's protocol (Beyotime Institute of Biotechnology). The samples were separated by 12% SDS-PAGE, then transferred onto polyvinylidene fluoride (PVDF) membranes. After blocking of the membranes in 5% skimmed milk, the membranes were incubated with specific antibodies against SOX4 (1:100 dilution; cat. no. ab85204; Abcam, Cambridge, UK), Bcl-2 (1:1,000 dilution; cat. no. ab32124; Abcam), Bax (1:1,000 dilution; cat. no. ab32503), survivin (1:5,000 dilution; cat. no. ab76424; Abcam), p65 (1:1,000 dilution, cat. no. 3039; Cell Signaling Technology, Beverly, MA, USA) and PARP (1:1,000 dilution; cat. no. 9542; Cell Signaling Technology). An ECL detection system was used to detect the protein bands (Amersham Pharmacia Biotechnology, Tokyo, Japan).

Apoptosis assay

Apoptosis was determined based on Annexin V/7AAD staining using an Apoptosis Detection kit (BD Biosciences, San Diego, CA, USA), according to the manufacturer's instructions. Cells were harvested at 72 h post-transfection, and 2×104 cells were collected and suspended in 100 µl 1X binding buffer, mixed with 5 µl Annexin V-PE and 5 µl 7AAD, in darkness for 20 min, and then 400 µl of 1X binding buffer was added to stop the staining reaction. Data were acquired using a FACSCalibur™ (BD Biosciences). Apoptosis was analyzed using FlowJo software v6.0 (Tree Star, Inc., Ashland, OR, USA).

RNA extraction and real-time PCR assay

Total RNA was extracted from melanoma cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific). Real-time PCR was performed using a SYBR® Premix Dimer Eraser™ kit (Takara Biotechnology, Co., Ltd., Dalian, China) in a 25-µl reaction system. Denaturation was performed at 95°C for 30 sec, annealing at 60°C for 30 sec, and elongation at 72°C for 30 sec over 39 cycles. An ABI Prism 7900HT fast RT-PCR system (Applied Biosystems; Thermo Fisher Scientific) was used to perform the real-time PCR assay. The primers were designed as shown in Table I.

Table I.

PCR primer data.

Table I.

PCR primer data.

Gene nameForward primerReverse primer
SOX4 ACAGCGACAAGATCCCTTTC CGGACTTCACCTTCTTCCTG
P65 AGCACAGATACCACCAAGACC CGGCAGTCCTTTCCTACAAG
Chromatin immunoprecipitation (CHIP)

The CHIP assay was performed according to the manufacturer's protocol (Millipore, Billerica, MA, USA). At 72 h after lentiviral infection, the A2058 cells were cross-linked using 1% formaldehyde (Sigma-Aldrich; Merck KGaA) for 10 min at room temperature and stopped with glycine buffer, followed by sonication. DNA was sheared to fragments of 200–1,000 bp in length. Anti-SOX4 antibody was added at 4°C overnight with rotation and IgG was used as a control. The immunoprecipitated DNA fragments were detected on 2% agarose gels and images were analyzed with an LAS 4000 luminescent image analyzer (Fujifilm, Tokyo, Japan). The CHIP primers were generated by Shanghai Sangon Co., Ltd. (Shanghai, China) (Table II).

Table II.

p65 PCR primer data.

Table II.

p65 PCR primer data.

p65Forward primerReverse primer
+15 to −104 cgcgcacttggccccgaccgcgcctgcgcgct
−113 to −202acaaagtgagtaatcg gtcggggccaagtgcgc
−1703 to −1810 cttgagcccaggagtttg ggcgtgagccaccacgc
−1490 to −1603ccacttctttacaaa atctctgctcactgcag
−221 to −318 cctgcgcggggcgggc taggggatttcagggc
−1300 to −1405 atacaatacaatacaata taacttttaaattaatac
−990 to −1100 gtgctaactctattttcac gacttttttattttctctga
−831 to −931 catcctcctttggggat tctgtcatgtgacccc
−680 to −780 acacaggcgggggca aatcccggagcctcg
−350 to −441 ggtaggacattttaacg ggccttctgctccgcaga
Statistical analysis

All data were obtained from three separate experiments and are presented as the mean ± standard deviation. Statistical analysis was performed using one-way analysis of variance (ANOVA). When comparing differences between two groups, we used a Student's t-test. Differences were considered to be statistically significant when P-values were <0.05.

Results

SOX4 downregulation inhibits p65 expression and cell proliferation in melanoma cells

As shown in Fig. 1A and B, the expression of SOX4 at both the mRNA and protein levels was significantly decreased in SOX4 shRNA-transfected A2058 and SK-MEL-5 cells, compared to the scrambled shRNA control group (P<0.01). As demonstrated in Fig. 1C, downregulation of SOX4 markedly inhibited the proliferation of A2058 and SK-MEL-5 cells at 48 or 72 h post-SOX4 shRNA transfection (P<0.01). We also observed that SOX4 downregulation inhibited the expression of NF-κB p65 at both the mRNA and protein levels (P<0.05) (Fig. 1A and B).

SOX4 downregulation promotes melanoma cell apoptosis

As shown in Fig. 2A, SOX4 downregulation significantly increased the level of apoptosis in the A2058 and SK-MEL-5 cells at 72 h post-SOX4 shRNA transfection (P<0.01). The expression of cleaved PARP was increased, while that of pro-PARP was decreased (Fig. 2B; P<0.01, P<0.05).

SOX4 downregulation decreases the expression of Bcl-2 and survivin, and increases the expression of Bax; meanwhile, SOX4 was able to bind to the promoter region of p65

Bcl-2 and survivin belong to an anti-apoptotic protein family, while Bax belongs to a pro-apoptotic protein family. As shown in Fig. 3A and B, SOX4 downregulation markedly inhibited the expression of Bcl-2 and survivin in the A2058 (P<0.05, P<0.01, respectively) and SK-MEL-5 (P<0.01, P<0.05, respectively) cells, while the expression of Bax was increased (P<0.01). To determine whether SOX4 could bind to the promoter region of p65, a CHIP-PCR assay was performed. As shown in Fig. 3C, SOX4 bound to the p65 promoter region at the following positions: +15 to −104, −1490 to −1603, −221 to −318 and −831 to −931 bp.

p65 overexpression partially reverses SOX4 downregulation-induced apoptosis

As shown in Fig. 4A and B, the expression of p65 mRNA and protein was significantly increased in the p65-overexpressing and SOX4-knockdown melanoma cells, compared to SOX4-knockdown alone cells (P<0.01). As demonstrated in Fig. 4C and E, p65 overexpression partially reversed SOX4 downregulation-induced decreases in cell proliferation and increases in apoptosis (P<0.01, P<0.05). The decreases in pro-PARP and survivin were also partially reversed in p65-overexpressing and SOX4-knockdown melanoma cells, compared to the SOX4-knockdown alone cells (Fig. 4D).

Discussion

Several studies have demonstrated that SOX4 is highly expressed in nearly all of the major cancers in humans, including breast, lung, brain, prostate, colorectal, bladder and ovarian cancers, which indicates a central role in the development of multiple tumors (14). Previous studies have demonstrated that SOX4 effectively drives cells towards apoptosis (15,16). In bladder carcinoma cells, the pathway through which SOX4 promotes apoptosis is still not understood. This indicated that SOX4 may induce apoptosis independently of caspase-3. Downstream target genes of SOX4 are involved in signal transduction (MAP2K5), angiogenesis (NRP2), and cell cycle arrest (PIK3R3) (10). However, other studies have reached the opposite conclusion. Zhou et al revealed that downregulation of SOX4 expression induced apoptosis in lung cancer patients through upregulation of caspase-3 expression (17). The role of SOX4 in the apoptosis of melanoma cells remains unknown. In the present study, we demonstrated that downregulation of SOX4 markedly inhibited melanoma cell proliferation and promoted cellular apoptosis.

It has been reported that SOX4 may interact with many signaling pathways, such as Wnt (8) or p53 (18), to influence cellular apoptosis. Low SOX4 expression can also facilitate peritoneal macrophage apoptosis by activating caspase-3 (19). Hur et al demonstrated that there is an important structural domain in SOX4 related to apoptosis; when the glycine in the domain is replaced by serine, apoptosis is inhibited (20). Nonetheless, the mechanisms of SOX4 inhibition-induced apoptosis in melanoma cells require further investigation.

NF-κB is one of the most important transcription factors that play a crucial role in the suppression of apoptosis, as well as the induction of cell proliferation and inflammation, which is closely associated with cancer development (2124). NF-κB activation is involved in the inhibition of apoptosis by upregulating the expression of anti-apoptotic proteins, including Bcl-2, Mcl-1 and survivin (25). Tao et al revealed that triptolide induced melanoma A375 apoptosis by inhibiting NF-κB signaling pathways (26). However, NF-κB has not only been proven to suppress apoptosis, but has also been proven to induce apoptosis. Schneider et al reported that NF-κB activation promoted neuronal cell death in focal cerebral ischemia (27). In this experiment, we observed that inhibition of SOX4 downregulated the expression of NF-κB p65, and NF-κB p65-targeted genes, such as Bcl-2 and survivin, were also decreased.

Apoptosis is the process of programmed cell death and plays an important role in cancer development. Apoptosis involves the balance between pro-apoptotic and anti-apoptotic proteins. Tumor cells can resist apoptosis by expressing the anti-apoptotic protein Bcl-2, while decreasing the expression of the pro-apoptotic protein Bax (28). Survivin is a member of the IAP family that inhibits cellular apoptosis, and is expressed in human melanoma, including primary melanoma and metastatic melanoma, but not expressed in normal melanocytes (29). Survivin has been found to inhibit the activity of caspase-9 by binding to HBXIP (30). Our study demonstrated that the anti-apoptotic proteins Bcl-2 and survivin were downregulated, while the pro-apoptotic proteins Bax and cleaved-PARP were upregulated, in SOX4-knockdown melanoma cells.

In order to determine whether SOX4 binds to the promoter of p65, a CHIP-PCR assay was performed. Our data revealed that SOX4 was able to bind to the p65 promoter at positions +15 to −104, −1490 to −1603, −221 to −318 and −831 to −931 bp. However, the CHIP-PCR assay only indicated that there was a connection between SOX4 and NF-κB p65, and it could not confirm whether the connection was direct or indirect. Further research needs be performed to confirm a direct binding event. We also revealed that p65 overexpression partially reversed SOX4 knockdown-induced increases in apoptosis, which further suggested that inhibition of SOX4 induces melanoma cell apoptosis partially through the downregulation of NF-κB p65 signaling.

In conclusion, we demonstrated that inhibition of SOX4 markedly induced melanoma cell apoptosis via downregulation of the NF-κB signaling pathway, which thus may serve as a novel approach for the treatment of melanoma.

Acknowledgements

Not applicable.

Funding

The present study was funded by the Fundamental Research Funds for the Central Universities (no. 1507219067), the National Natural Science Foundation of China (no. 81673917) and Shanghai Municipal Commission of Health and Family Planning (no. 201440336).

Availability of data and materials

The datasets used during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

QC, HX and JFW conceived and designed the study. QC, JD, LX performed the experiments. QC and JD wrote the paper. XL and ZL analyzed the data. FGZ, JFW, JHX and QC reviewed and edited the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

All experimental protocols were approved by the Institutional Review Board of the Department of Laboratory Animal Science of Fudan University (Shanghai, China).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T, Pandey A and Chinnaiyan AM: Large-scale meta-analysis of cancer microarray data identifies common transcriptional profiles of neoplastic transformation and progression. Proc Natl Acad Sci USA. 101:9309–9314. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Zhang J, Jiang H, Shao J, Mao R, Liu J, Ma Y, Fang X, Zhao N, Zheng S and Lin B: SOX4 inhibits GBM cell growth and induces G0/G1 cell cycle arrest through Akt-p53 axis. BMC Neurol. 14:2072014. View Article : Google Scholar : PubMed/NCBI

3 

Shi S, Cao X, Gu M, You B, Shan Y and You Y: Upregulated expression of SOX4 is associated with tumor growth and metastasis in nasopharyngeal carcinoma. Dis Markers. 2015:6581412015. View Article : Google Scholar : PubMed/NCBI

4 

Liu P, Ramachandran S, Seyed Ali M, Scharer CD, Laycock N, Dalton WB, Williams H, Karanam S, Datta MW, Jaye DL, et al: Sex-determining region Y Box 4 is a transforming oncogene in human prostate cancer cells. Cancer Res. 66:4011–4019. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Yoon TM, Kim SA, Cho WS, Lee DH, Lee JK, Park YL, Lee KH, Lee JH, Kweon SS, Chung IJ, et al: SOX4 expression is associated with treatment failure and chemoradioresistance in oral squamous cell carcinoma. BMC Cancer. 15:8882015. View Article : Google Scholar : PubMed/NCBI

6 

Hur W, Rhim H, Jung CK, Kim JD, Bae SH, Jang JW, Yang JM, Oh ST, Kim DG, Wang HJ, et al: SOX4 overexpression regulates the p53-mediated apoptosis in hepatocellular carcinoma: Clinical implication and functional analysis in vitro. Carcinogenesis. 31:1298–1307. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Pramoonjago P, Baras AS and Moskaluk CA: Knockdown of Sox4 expression by RNAi induces apoptosis in ACC3 cells. Oncogene. 25:5626–5639. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Bilir B, Kucuk O and Moreno CS: Wnt signaling blockage inhibits cell proliferation and migration, and induces apoptosis in triple-negative breast cancer cells. J Transl Med. 11:2802013. View Article : Google Scholar : PubMed/NCBI

9 

Pan X, Zhao J, Zhang WN, Li HY, Mu R, Zhou T, Zhang HY, Gong WL, Yu M, Man JH, et al: Induction of SOX4 by DNA damage is critical for p53 stabilization and function. Proc Natl Acad Sci USA. 106:3788–3793. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Aaboe M, Birkenkamp-Demtroder K, Wiuf C, Sørensen FB, Thykjaer T, Sauter G, Jensen KM, Dyrskjøt L and Ørntoft T: SOX4 expression in bladder carcinoma: Clinical aspects and in vitro functional characterization. Cancer Res. 66:3434–3442. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Li J, Zhang Z and Li G: Patient outcome prediction using multiple biomarkers in human melanoma: A clinicopathological study of 118 cases. Exp Ther Med. 2:131–135. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Jafarnejad SM, Wani AA, Martinka M and Li G: Prognostic significance of Sox4 expression in human cutaneous melanoma and its role in cell migration and invasion. Am J Pathol. 177:2741–2752. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Watanabe M, Umezawa K, Higashihara M and Horie R: Combined inhibition of NF-κB and Bcl-2 triggers synergistic reduction of viability and induces apoptosis in melanoma cells. Oncol Res. 21:173–180. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Vervoort SJ, van Boxtel R and Coffer PJ: The role of SRY-related HMG box transcription factor 4 (SOX4) in tumorigenesis and metastasis: Friend or foe? Oncogene. 32:3397–3409. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Ahn SG, Kim HS, Jeong SW, Kim BE, Rhim H, Shim JY, Kim JW, Lee JH and Kim IK: Sox-4 is a positive regulator of Hep3B and HepG2 cells' apoptosis induced by prostaglandin (PG)A2 and Δ12-PGJ2. Exp Mol Med. 34:243–249. 2002. View Article : Google Scholar : PubMed/NCBI

16 

Ahn SG, Cho GH, Jeong SY, Rhim H, Choi JY and Kim IK: Identification of cDNAs for Sox-4, an HMG-Box protein, and a novel human homolog of yeast splicing factor SSF-1 differentially regulated during apoptosis induced by prostaglandin A212-PGJ2 in Hep3B cells. Biochem Biophys Res Commun. 260:216–221. 1999. View Article : Google Scholar : PubMed/NCBI

17 

Zhou Y, Wang X, Huang Y, Chen Y, Zhao G, Yao Q, Jin C, Huang Y, Liu X and Li G: Down-regulated SOX4 expression suppresses cell proliferation, metastasis and induces apoptosis in Xuanwei female lung cancer patients. J Cell Biochem. 116:1007–1018. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Jang SM, Kang EJ, Kim JW, Kim CH, An JH and Choi KH: Transcription factor Sox4 is required for PUMA-mediated apoptosis induced by histone deacetylase inhibitor, TSA. Biochem Biophys Res Commun. 438:445–451. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Weng HL and Wang MJ: Effects of microRNA-338-3p on morphine-induced apoptosis and its underlying mechanisms. Mol Med Rep. 14:2085–2092. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Hur EH, Hur W, Choi JY, Kim IK, Kim HY, Yoon SK and Rhim H: Functional identification of the pro-apoptotic effector domain in human Sox4. Biochem Biophys Res Commun. 325:59–67. 2004. View Article : Google Scholar : PubMed/NCBI

21 

Murtas D, Piras F, Minerba L, Ugalde J, Piga M, Maxia C, Perra MT and Sirigu P: Nuclear factor-κB expression is predictive of overall survival in patients with cutaneous melanoma. Oncol Lett. 1:633–639. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Karin M, Cao Y, Greten FR and Li ZW: NF-kappaB in cancer: From innocent bystander to major culprit. Nat Rev Cancer. 2:301–310. 2002. View Article : Google Scholar : PubMed/NCBI

23 

Park MH and Hong JT: Roles of NF-κB in cancer and inflammatory diseases and their therapeutic approaches. Cells. 5:152016. View Article : Google Scholar :

24 

Savva CG, Totokotsopoulos S, Nicolaou KC, Neophytou CM and Constantinou AI: Selective activation of TNFR1 and NF-κB inhibition by a novel biyouyanagin analogue promotes apoptosis in acute leukemia cells. BMC Cancer. 16:2792016. View Article : Google Scholar : PubMed/NCBI

25 

Pahl HL: Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene. 18:6853–6866. 1999. View Article : Google Scholar : PubMed/NCBI

26 

Tao Y, Zhang ML, Ma PC, Sun JF, Zhou WQ, Cao YP and Li LJ: Triptolide inhibits proliferation and induces apoptosis of human melanoma A375 cells. Asian Pac J Cancer Prev. 13:1611–1615. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Schneider A, Martin-Villalba A, Weih F, Vogel J, Wirth T and Schwaninger M: NF-kappaB is activated and promotes cell death in focal cerebral ischemia. Nat Med. 5:554–559. 1999. View Article : Google Scholar : PubMed/NCBI

28 

Li F and Ling X: Survivin study: An update of ‘what is the next wave’? J Cell Physiol. 208:476–486. 2006. View Article : Google Scholar : PubMed/NCBI

29 

Grossman D, McNiff JM, Li F and Altieri DC: Expression and targeting of the apoptosis inhibitor, survivin, in human melanoma. J Invest Dermatol. 113:1076–1081. 1999. View Article : Google Scholar : PubMed/NCBI

30 

Marusawa H, Matsuzawa S, Welsh K, Zou H, Armstrong R, Tamm I and Reed JC: HBXIP functions as a cofactor of survivin in apoptosis suppression. EMBO J. 22:2729–2740. 2003. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

July-2018
Volume 40 Issue 1

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Cheng Q, Du J, Xie L, Liu X, Li Z, Zuo F, Wu J and Xu J: Inhibition of SOX4 induces melanoma cell apoptosis via downregulation of NF-κB p65 signaling. Oncol Rep 40: 369-376, 2018
APA
Cheng, Q., Du, J., Xie, L., Liu, X., Li, Z., Zuo, F. ... Xu, J. (2018). Inhibition of SOX4 induces melanoma cell apoptosis via downregulation of NF-κB p65 signaling. Oncology Reports, 40, 369-376. https://doi.org/10.3892/or.2018.6443
MLA
Cheng, Q., Du, J., Xie, L., Liu, X., Li, Z., Zuo, F., Wu, J., Xu, J."Inhibition of SOX4 induces melanoma cell apoptosis via downregulation of NF-κB p65 signaling". Oncology Reports 40.1 (2018): 369-376.
Chicago
Cheng, Q., Du, J., Xie, L., Liu, X., Li, Z., Zuo, F., Wu, J., Xu, J."Inhibition of SOX4 induces melanoma cell apoptosis via downregulation of NF-κB p65 signaling". Oncology Reports 40, no. 1 (2018): 369-376. https://doi.org/10.3892/or.2018.6443