Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1021-335X Online ISSN: 1791-2431
Journal Cover
October-2018 Volume 40 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2018 Volume 40 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Integrin β4 reduces DNA damage‑induced p53 activation in colorectal cancer

  • Authors:
    • Jinsong Wu
    • Runyuan Zhao
    • Jing Lin
    • Baohua Liu
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, Research Institute of Surgery, Daping Hospital, The Third Military Medical University (Army Medical University), Chongqing 400042, P.R. China, Institute of Chinese Medicine, Hebei University of Chinese Medicine, Shijiazhuang, Hebei 050091, P.R. China, Department of Nephrology, Bethune International Peace Hospital, Shijiazhuang, Hebei 050082, P.R. China
  • Pages: 2183-2192
    |
    Published online on: August 6, 2018
       https://doi.org/10.3892/or.2018.6628
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Integrin contributes to the maintenance of cell adhesion. In turn, cell adhesion triggers certain integrin signaling cascades, and influences cell biological behavior. In the present study, we explored the role and mechanism of integrin β4 in the DNA damage response in colorectal cancer (CRC) using a three‑dimensional (3D) cell culture model. Under 3D culture condition, dispersed CRC cells automatically formed multicellular spheroids, which consisted of layers of cells with cell junctions commonly distributed. The expression level of integrin β4 in HCT116 3D cultures was slightly higher compared with two‑dimensional (2D) cultures, while the expression level in LoVo 3D cultures was similar to or slightly lower than that in 2D cultures. Knockdown of integrin β4 by lentiviral delivery of shRNA did not markedly change the architectural formation of 3D cultures under an inverted microscope or transmission electron microscope. Platinum increased p53 and p‑p53 (ser15) in a time‑dependent manner in 3D cultures. Knockdown of integrin β4 increased sensitivity to cisplatin (CDDP) in 3D cultures. Under 3D culture condition, knockdown of integrin β4 did not detectably change the basal p53 protein level but increased p53 and p‑p53 (ser15) protein accumulation induced by platinum. Integrin β4 knockdown did not detectably change p53 protein level in HCT116 2D cultures with or without CDDP treatment. Knockdown of wild‑type p53 decreased sensitivity to platinum in 3D cultures. Since it has been proven that platinum damages DNA to kill cells and p53 plays a key role in the DNA damage response, our results indicated that integrin β4 reduced DNA damage‑induced p53 activation to decrease chemosensitivity in CRC. This may be due to integrin β4 activation in 3D cultures.

Introduction

Colorectal cancer (CRC) is the third most commonly diagnosed cancer in males, and the second most common in females worldwide (1). The highest incidence rates are mainly in developed countries and the incidence is increasing in developing countries, which is partly attributable to lipid metabolism (1–3). Despite an enormous amount of effort spent in the development of therapies to treat CRC, the 5-year survival rate has increased slowly in the USA, from 60% during the 1980s to 66% during 2005 to 2011 (4). To a large extent, this discouraging observation is largely due to the fact that patients with CRC demonstrate resistance to both new and older anticancer drugs (3,5).

Three-dimensional (3D) cell culture models provide an optimal experimental system to study the mechanisms of anticancer drug resistance, as they represent a suitable in vivo approximation of solid tumor tissue microenvironment, including cell adhesion (3,6,7). The formation and stability of cell adhesion, including cell-cell adhesion and cell-extracellular matrix (ECM) adhesion, rely on cell adhesion molecules, particularly the integrin family (6,8,9). Conversely, cell adhesion triggers certain integrin signaling cascades, and influences tumor cell biological behavior, including progression, proliferation, survival and chemosensitivity (6,9–11). Accumulating evidence has demonstrated that the expression of integrin is negatively correlated with prognosis in multiple cancer types (9,10,12). However, the underlying mechanism remains unclear (9,10,12).

In the present study, 3D cultures were used to explore the role of integrin β4 in the response of human CRC cells to platinum. Our data demonstrated that integrin β4 reduced DNA damage-induced p53 activation in CRC.

Materials and methods

Cell lines and cell culture

HCT116 and LoVo, two human CRC cell lines that contain stabilized wild-type p53 protein (3), and the cell line 293T were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China).

Two-dimensional (2D) cultures were grown and passaged routinely as previously described (3). In brief, HCT116 cells were grown in McCoy's 5A (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA, F12K (Gibco Thermo Fisher Scientific, Inc.) for LoVo cells or DMEM (Gibco) for 293T cells, respectively supplemented with 100 ml/l newborn calf serum (Gibco Thermo Fisher Scientific, Inc.), 100,000 IU/l penicillin and 100 µg/ml streptomycin (Gibco Thermo Fisher Scientific, Inc.) under a humidified atmosphere of 5% CO2 at 37°C.

Subsequently, 3D cultures were prepared without the use of any extracellular components as previously described (3,6,13). In brief, plates were coated with poly-2-hydroxyethylmethacrylate (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) as previously described (13). Exponentially growing CRC cells were inoculated into the plates. The plates were then gently horizontally swirled for 2 min every 4 h for the first 24 h, then 6 min every 8 h (3,6). The cells were incubated under a humidified atmosphere of 5% CO2 at 37°C. Half of the medium was replaced every day.

Preparation of slides for scanning electron microscopy

Sample slides were routinely prepared. In brief, 3D cultures were fixed in 2.5% glutaraldehyde. Samples were then sent to The Medical Research Center of The Third Military Medical University for preparation. The sections were imaged using a scanning electron microscope (S3400N II; Hitachi, Tokugawa, Japan).

Hematoxylin and eosin (H&E) staining

HCT116 3D cultures were fixed in 4% paraformaldehyde, and OCT-embedded samples were sectioned at a thickness of 10 µm. Sample slides were routinely stained with H&E (3).

Preparation of slides for transmission electron microscopy

Sample slides were routinely prepared as previously described (3). In brief, 3D cultures were fixed in 2.5% glutaraldehyde and then in 1% osmium tetroxide. Samples were dehydrated and ultrathin sections were generated. The sections were stained with uranium acetate and lead citrate and were observed using a transmission electron microscope (Tecnai 10; Philips, Amsterdam, The Netherlands).

Western blot analysis

Western blotting was performed as previously described (3,6). Cells were washed with PBS and lysed in 2X SDS loading buffer [0.1 M Tris-HCl (pH 6.8), 0.2 M DTT, 4% SDS, 20% glycerol and 0.2% bromophenol blue] with Protease Inhibitor Cocktail, Phosphatase Inhibitor Cocktail 2 and Phosphatase Inhibitor Cocktail 3 (all from Sigma-Aldrich; Merck KGaA) for 5 min on ice, inverting the tube. Following sonication, protein was quantitated using the RC DC protein assay (Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer's instructions.

The protein was resolved by SDS/PAGE and blotted on nitrocellulose membranes (Bio-Rad Laboratories). The nitrocellulose membranes were incubated with specific primary antibodies overnight at 4°C. Following incubation with secondary antibodies for 90 min at 37°C, immunoreactive proteins were visualized using the Enhanced Chemiluminescent Substrate (Thermo Fisher Scientific, Inc.).

Primary antibodies against integrin β4 (1:500; cat. no. 14803), p53 (1:1,000; cat. no. 2524), phospho-p53 (Ser15) (p-p53; 1:500; cat. no. 9286), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (1:1,000; cat. no. 5174) and HRP-linked secondary antibodies (anti-mouse IgG; 1:5,000; cat. no. 7076; anti-rabbit IgG; 1:5,000; cat. no. 7074) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA).

Lentiviral delivery of small hairpin (sh)RNA

Integrin β4 and p53 were knocked down by lentiviral vector-mediated shRNA interference using The RNAi Consortium system (Open Biosystems, Inc., Huntsville, AL, USA) according to the manufacturer's instructions (3). In brief, an integrin β4 or p53-targeting shRNA-pLKO.1 vector or a control shRNA-pLKO.1 vector, with the packaging plasmid pCMV-Dr8.91 and the enveloping plasmid pCMV-VSV-G, was co-transfected into 293T cells using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions (3). Virus-containing medium was collected at 48 and 72 h post-transfection and was filtered using a 0.22-µm filter (EMD Millipore, Billerica, MA, USA). Cells were infected with the lentivirus, and then were selected using puromycin (Sigma-Aldrich; Merck KGaA). Control shRNA (shcontrol) was targeted against green fluorescent protein, and the sense sequence of this shRNA is TACAACAGCCACAACGTCTAT (3). Sense sequences of shRNAs targeting specific genes were GAGGGTGTCATCACCATTGAA (shβ4-1) (14) or ACGATGACAACCGACCTATTG (shβ4-2) for integrin β4, and GACTCCAGTGGTAATCTACT for p53 (3). Knockdown efficiency was confirmed by western blotting.

Immunohistochemical staining

HCT116 3D cultures were fixed in 4% paraformaldehyde, and OCT-embedded samples were sectioned at a thickness of 10 µm. Immunohistochemistry was performed according to the protocol of the SPlink Detection kits (ZSGB-Bio, Beijing, China), as previously described (3).

Immunofluorescence staining

Immunofluorescence staining was performed as previously described (7). HCT116 cells were grown as 2D cultures on cover slides, and then treated with 2.5 µg/ml cisplatin (CDDP; Sigma-Aldrich; Merck KGaA) for 24 h. Following fixation in 4% paraformaldehyde for 30 min, cells were incubated in 0.2% Triton X-100 in 2% BSA/PBS for 30 min. Subsequently, cells were incubated in p53 (Cell Signaling Technology, Inc.; 1:500) antibody solution and Alexa Fluor® 555 goat anti-mouse (Invitrogen; Thermo Fisher Scientific, Inc.; 1:1,000) solution for 2 h and 30 min, respectively. The nuclei were stained by incubating with 4′,6-diamidino-2-phenylindole (DAPI, 1 µg/ml) (Sigma-Aldrich; Merck KGaA) for 30 min.

Water-soluble tetrazolium salt (WST) assay

3D cultures were treated with 10 µg/ml CDDP or 5 µg/ml oxaliplatin (L-OHP) (Sigma-Aldrich; Merck KGaA) for 48 h. Control cultures received 10 µl PBS only. Cell viability was assayed using WST [2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt], as previously described (3,7). The WST assay was performed using Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer's instructions (3,7). In brief, 3D cultures detached using accutase (Non-enzyme Cell Detach Solution; Applygen Technologies, Beijing, China) were incubated with WST/media for 3–4 h, after which the absorbance at 450 nm was determined using a microplate reader with a reference wavelength of 650 nm. Cell viability was normalized to the control.

Clonogenic assay

Clonogenic assay was performed as previously described (3,7). In brief, 3D cultures with the same numbers of cells were treated with 10 µg/ml CDDP for 48 h. Then, the 3D cultures were detached as single-cell suspensions using accutase, and the same ratio was inoculated into 24-well plates. The cells were grown for 7 days and were subsequently stained with crystal violet and counted using a stereomicroscope and an automatic ‘counting colony counter pen’.

Statistical analysis

The data shown represent the mean ± standard error. Statistical differences between groups were analyzed by Student's t-test or one-way ANOVA. P<0.05 was considered to indicate a statistically significant difference.

Results

Histopathology of 3D cultures

HCT116 cells grew as a layer of cells under 2D condition (Fig. 1A). Under 3D condition, dispersed cells aggregated automatically and formed 3D cultures (multicellular spheroids). The surface of 3D cultures was observed using an inverted microscope (Fig. 1B) or a scanning electron microscope (Fig. 1C). The cells in the outermost layer of 3D cultures were uniformly spherical.

Figure 1.

Histopathology of 3D cultures. (A) HCT116 cells were cultured routinely under 2D conditions for 4 days, or (B) under 3D conditions for 5 days. Cells were imaged using an inverted microscope. Scale bars represent 100 µm. (C) HCT116 3D cultures were imaged using a scanning electron microscope. The scale bar represents 10 µm. (D) HCT116 3D cultures were stained with H&E. The scale bar represents 100 µm. (E) HCT116 3D cultures were imaged using a transmission electron microscope. The scale bar represents 2 µm.

HCT116 3D cultures were stained with H&E to further analyze the inner structure. 3D cultures consisted of layers of cells packed tightly. The cells in the inner layers were heteromorphic, not uniformly spherical as in the outermost layer (Fig. 1D). These structures mimicked colorectal tumors at an avascular stage or avascular regions of colorectal tumors in vivo (2,7). The ultrastructure of 3D cultures was observed using a transmission electron microscope. Cells adhered with each other in 3D cultures, and cell junctions were commonly found (Fig. 1E).

Association between integrin β4 and 3D cultures

Western blot analysis revealed that the integrin β4 expression level in HCT116 3D cultures was slightly higher than in 2D cultures. The integrin β4 expression level in LoVo 3D cultures was similar to or mildly lower than in 2D cultures (Fig. 2A). These results indicated that the function of cell adhesion in integrin β4 expression may be cell-type specific.

Figure 2.

The function of 3D architecture in integrin β4 expression. (A) The integrin β4 protein level was assayed by western blotting. Protein was extracted from 2D cultures grown for 4 days or from 3D cultures grown for 5 days. (B) Integrin β4 was knocked down by lentiviral delivery of shRNA (shβ4-1 and shβ4-2), and the efficiency was assayed by western blotting.

To explore the role of integrin β4 in the architectural formation of 3D cultures, integrin β4 was knocked down by lentiviral delivery of shRNA. The efficiency was confirmed by western blot analysis (Fig. 2B). Cells with integrin β4-knockdown (shβ4) or cells transfected with control lentivirus (shcontrol) were cultured under 3D condition for 15 days and were observed under an inverted microscope (Fig. 3A). LoVo 3D cultures were smaller and more uniform than HCT116 3D cultures. Cells with integrin β4 knockdown grew as multicellular spheroids, similar to the respective shcontrol. No differences between shβ4 and the respective shcontrol were observed. The ultrastructures of parental HCT116 3D cultures and of shβ4 HCT116 3D cultures were observed using a transmission electron microscope (Fig. 3B). Integrin β4 knockdown did not detectably change cell adhesion, and no significant difference was observed. These results demonstrated that integrin β4 knockdown did not detectably change the architecture of 3D cultures.

Figure 3.

The function of integrin β4 in 3D architecture. (A) Cells were cultured under 3D condition and imaged at multiple time-points using an inverted microscope. Scale bars represent 500 µm. (B) Parental HCT116 cells and HCT116 cells with integrin β4 knockdown (shβ4-1) were cultured under 3D condition for 5 days and then imaged using a transmission electron microscope.

Integrin β4 reduces DNA damage-induced p53 activation in 3D cultures

Platinum and irradiation kills cells by damaging DNA, and p53 plays a key role in the DNA damage response (3,15,16). CDDP caused p53 protein accumulation in HCT116 3D cultures in a time-dependent manner (Fig. 4A). DNA damage induces the phosphorylation of p53 at ser15 (16,17). Western blot analysis revealed that CDDP induced p-p53 (ser15) protein accumulation in a time-dependent manner (Fig. 4A). These results are consistent with those of previous studies (3,15,17,18) and, collectively, these results demonstrated that platinum caused DNA damage to induce p53 activation in a time-dependent manner.

Figure 4.

Integrin β4 reduces DNA damage-induced p53 activation in 3D cultures. (A) CDDP induced p53 and p-p53 (ser15) accumulation in a time-dependent manner. (western blotting). (B) Integrin β4 knockdown increased the p53 accumulation induced by CDDP, and did not detectably change the basal p53 protein level (western blotting). (C) Integrin β4 knockdown reduced the p53 accumulation induced by CDDP (10 µg/ml, 48 h) or L-OHP (5 µg/ml, 48 h) in HCT116 or LoVo cells, respectively (western blotting). (D) Immunohistochemical staining of p-p53 in HCT116 3D cultures treated with CDDP (10 µg/ml, 48 h). Scale bars represent 50 µm; (h, hours).

HCT116 3D cultures were treated with 10 µg/ml CDDP in a time-gradient manner and the p53 protein level was assayed using western blot analysis. Knockdown of integrin β4 did not detectably change the basal p53 protein level but increased the CDDP-induced p53 protein accumulation (Fig. 4B). HCT116 and LoVo 3D cultures were treated with 10 µg/ml CDDP or 5 µg/ml L-OHP for 48 h, respectively. Western blot analysis revealed that integrin β4 knockdown increased platinum-induced p53 protein accumulation (Fig. 4C), but did not detectably change the basal p53 level (data not shown). The effect of integrin β4 knockdown on p-p53 was explored. HCT116 3D cultures were treated with 10 µg/ml CDDP for 48 h, and p-p53 was evaluated using immunohistochemical staining. Integrin β4 knockdown increased the CDDP-induced p-p53 accumulation that arose from DNA damage (16,17) (Fig. 4D). These results unanimously supported the conclusion that integrin β4 reduced p53 activation from platinum-induced DNA damage in 3D cultures.

The effect of integrin β4 on p53 in HCT116 2D cultures was studied. Since 2D cultures are more sensitive to chemotherapy and radiotherapy than 3D cultures (3,8,19), 2D cultures were treated with a lower concentration of CDDP. Results of western blot analysis revealed that integrin β4 knockdown (shβ4-1) did not markedly change the basal p53 protein level, or the CDDP-induced (2.5 µg/ml, 48 h) p53 protein level (Fig. 5A). Results of immunofluorescence staining were consistent with those of western blot analysis. Integrin β4 knockdown did not markedly change the p53 protein level in HCT116 2D cultures treated with CDDP (2.5 µg/ml, 24 h) (Fig. 5B). In summary, these results indicated that integrin β4 reduced DNA damage-induced p53 activation in 3D cultures, but not in HCT116 2D cultures.

Figure 5.

Integrin β4 does not detectably alter DNA damage-induced p53 accumulation in HCT116 2D cultures. (A) Integrin β4 knockdown did not detectably change the basal p53 protein level, or CDDP-induced (2.5 µg/ml, 48 h) p53 accumulation (western blotting). (B) Results of immunofluorescence revealed that integrin β4 knockdown did not markedly change CDDP-induced (2.5 µg/ml, 24 h) p53 accumulation. Scale bars represent 100 µm. (h, hours).

Knockdown of wild-type p53 decreases sensitivity to platinum in CRC

The role of p53 in the sensitivity of HCT116 (containing stabilized wild-type p53 protein (3)) to platinum was explored. p53 was knocked down by lentiviral delivery of shRNA. The efficiency was confirmed by western blot analysis (Fig. 6A). The specificity was previously verified (3,20). Immunohistochemistry revealed that knockdown of p53 significantly decreased p-p53 level in HCT116 3D cultures treated with 10 µg/ml CDDP for 48 h (Fig. 6B). Results of the WST assay revealed that knockdown of p53 significantly decreased chemosensitivity of HCT116 3D cultures to platinum (Fig. 6C). The viability of shcontrol HCT116 cells treated with CDDP (10 µg/ml, 48 h) was 44.1±2.6%, whereas that of HCT116 cells with p53 knockdown was 64.6±3.2% (P<0.01). The viability of shcontrol HCT116 cells treated with L-OHP (5 µg/ml, 48 h) was 51.4±2.4%, whereas that of HCT116 cells with p53 knockdown was 67.7±4.2% (P<0.05). There was no significant difference in viability between the parental HCT116 3D cell cultures and the shcontrol (P≥0.05) (data not shown). The results of the clonogenic assay were consistent with these of the WST assay. The clonogenicity of the shp53 HCT116 cells was higher than that of the shcontrol (Fig. 6D).

Figure 6.

Knockdown of p53 decreases sensitivity to platinum in HCT116 3D cultures. (A) p53 was knocked down by lentiviral delivery of shRNA (shp53), and the efficiency was assayed by western blot. (B) Immunohistochemical staining of p-p53 in HCT116 3D cultures treated with CDDP (10 µg/ml, 48 h). Scale bars represent 50 µm. (C) Cell viability was assayed by WST. *P<0.01; **P<0.05. (D) Clonogenic assay. The clonogenicity of the shcontrol HCT116 cells was lower than that of the shp53 cells. (h, hours).

The aforementioned experiments were also performed in LoVo cells [containing stabilized wild-type p53 protein (3)]. The results were consistent with those observed in HCT116 cells. Western blot analysis confirmed the efficiency of p53-knockdown in LoVo 3D cultures (Fig. 7A). Immunohistochemistry revealed that knockdown of p53 significantly decreased p-p53 in LoVo 3D cultures treated with 10 µg/ml CDDP for 48 h (Fig. 7B). WST assay revealed that knockdown of p53 significantly decreased chemosensitivity of LoVo 3D cultures to CDDP (P<0.05) (Fig. 7C). The cell viability of shcontrol LoVo treated with CDDP (10 µg/ml, 48 h) was 57.0±3.7%, whereas that of LoVo with p53 knockdown was 69.9±3.1% (P<0.05). The clonogenicity of the shp53 LoVo 3D cultures was higher than that of the shcontrol (Fig. 7D). There was no significant difference in viability between parental LoVo 3D cultures and shcontrol (P≥0.05) (data not shown).

Figure 7.

Knockdown of p53 decreases sensitivity to CDDP in LoVo 3D cultures. (A) Western blot assay. (B) Immunohistochemical staining of p-p53 in LoVo 3D cultures treated with CDDP (10 µg/ml, 48 h). Scale bars represent 50 µm. (C) Cell viabilities. **P<0.05. (D) Clonogenic assay.

Knockdown of integrin β4 increases sensitivity to CDDP in CRC

As aforementioned, integrin β4 reduced DNA damage-induced p53 activation (Fig. 4) and knockdown of wild-type p53 decreased sensitivity to platinum (Figs. 6 and 7). These results led to the hypothesis that knockdown of integrin β4 may increase sensitivity to platinum of CRC. Results of WST assay revealed that knockdown of integrin β4 significantly increased the chemosensitivity of HCT116 3D cultures to CDDP (Fig. 8A). The viability of shcontrol HCT116 cells treated with CDDP (10 µg/ml, 48 h) was 45.3±2.4%, whereas that of HCT116 cells with integrin β4 knockdown (shβ4-1) was 36.5±2.1% (P<0.01). The results of the clonogenic assay revealed that the clonogenicity of the shβ4-1 LoVo 3D cultures was lower than that of the shcontrol (Fig. 8B). In summary, these results indicated that integrin β4 reduces DNA damage-induced p53 activation to decrease CRC chemosensitivity to platinum.

Figure 8.

Knockdown of integrin β4 increases CRC sensitivity to CDDP. (A) Viabilities of HCT116 3D cultures. *P<0.01. (B) Clonogenic assay with LoVo cells. The clonogenicity of the shcontrol LoVo cells was lower than that of the shp53 cells.

Knockdown of p53 does not markedly change integrin β4 protein levels in HCT116 cells

It was reported that p53 regulated integrin β4 expression in several cells types, including tumor cells (21–23). The effect of p53 on integrin β4 expression in HCT116 3D cultures was investigated. HCT116 3D cultures were treated with or without 10 µg/ml CDDP for 24 or 48 h, respectively. Integrin β4 expression levels were assayed using western blot analysis. No detectable difference in integrin β4 expression levels was observed between shcontrol HCT116 cells and the respective shp53 HCT116 cells (Fig. 9A). Immunohistochemical staining was employed to evaluate the integrin β4 protein level of HCT116 3D cultures without any treatment. Knockdown of p53 (shp53) did not detectably change the integrin β4 protein level (Fig. 9B). The effect of p53 on integrin β4 in HCT116 2D cultures was studied. HCT116 2D cultures were treated with or without 2.5 µg/ml CDDP for 24 or 48 h, respectively. Integrin β4 expression levels were assayed using western blot analysis. No detectable difference in integrin β4 expression levels was observed (Fig. 9C). These results indicated that knockdown of p53 may not detectably change the expression of integrin β4 under these specific conditions.

Figure 9.

Knockdown of p53 does not detectably alter integrin β4 in HCT116 cells. (A) Knockdown of p53 did not detectably change the expression of integrin β4 in 3D cultures (western blotting). (B) Immunohistochemical staining of integrin β4 in 3D cultures. Scale bars represent 50 µm. (C) Knockdown of p53 did not detectably change integrin β4 expression in 2D cultures.

Discussion

Solid tumor cells, including CRC cells, proliferate, survive and response to stimuli in a specific tissue microenvironment in vivo (3,7,8). In addition, 3D cell culture models provide an optimal experimental system for mimicking solid tumor tissue microenvironments, particularly cell adhesion in vivo (Fig. 1) (3,7,8). In 3D cultures, cells adhered to each other within layers of cells, and cell junctions were commonly found (Fig. 1B-E) (7). Their structures were more similar to these of tumors at avascular stage and avascular tumor regions (3,7,8).

The formation and stability of cell adhesion rely on cell adhesion molecules, particularly E-cadherin and the integrin family (6–11). Integrins, consisting of α and β subunits, are a group of transmembrane heterodimeric cell surface receptors that enhance cell anchorage to the ECM and cell-cell interaction (6,9–11). It has been reported that 24 definite integrin heterodimers are established by the amalgamation of 18 α subunits and 8 β subunits (9,10). In the present study, integrin β4 knockdown did not prevent suspended CRC cells from forming 3D cultures (Fig. 3A). This indicated that integrin β4 may not be essential for architectural formation of 3D cultures or very low expression of integrin β4 may be sufficient. Integrin β4 is different from other integrin β subunits for its exceptionally large cytoplasmic domain and its upregulation correlates with changes in cell biology (10,12,23,24). High expression of integrin β4 has been reported in human CRC, and it was also reported that cell adhesion affects cell adhesion molecules expression levels (8,14). In the present study, the integrin β4 expression level in HCT116 3D cultures was higher than in 2D cultures, while in LoVo 3D cultures, the integrin β4 expression level was similar to or slightly lower than in 2D cultures (Fig. 2A). These results indicated that the function of cell adhesion in integrin β4 expression may be cell-type specific in CRC. Another possible explanation is that the difference may be caused by the difference in the microenvironment between HCT116 3D cultures and LoVo 3D cultures since the two cell lines form different shapes of multicellular spheroids (Fig. 3B).

Integrin contributes to the maintenance of cell adhesion (6,9,10,23,25). On the other hand, mounting evidence has indicated that integrin couples intra- and extra-cellular signals, since it rapidly undergoes conformational switches transduced via cytoplasmic changes (‘inside-out’ signaling) and simultaneous ligand-induced rearrangements (‘outside-in’ signaling) (6,9,25). Inactive integrins are compact and bent, with their genu folded and the headpiece ~5 nm from the membrane. Separation of the α and β subunit legs destabilizes their interface with the headpiece, converting the bent structure to an overall extended conformation and relieving constraints on headpiece activation (6,9,10,21,25). Several factors, such as ECM-cell adhesion, cell-cell adhesion and force, were reported to activate integrins (6,9–11,25). Furthermore, 3D cultures represent the solid tumor tissue microenvironment, particularly cell adhesion in vivo (Fig. 1B-E) (3,6–8). Under 3D condition, integrin β4 exhibited the ability to reduce DNA damage-induced p53 acivation (Fig. 4B-D). This effect was not observed in HCT116 2D cultures (Fig. 5A and B). These results indicated that integrin β4 reduced DNA damage-induced p53 activation in 3D cultures and this may be due to integrin β4 activation. Due to a myriad of difference in the microenvironment between 3D cultures and 2D cultures (3,6,8), it is unclear what causes integrin β4 activation under the specific condition.

Platinum and irradiation damages DNA by binding to and causing crosslink of DNA to kill cells (3,15,16,26). Mounting evidence has demonstrated that the activation of p53 plays a key role in the DNA damage response, and loss of wild-type p53 leads to resistance to DNA damage-induced cell death (3,15,18,20,27,28). In the present study, integrin β4 reduced DNA damage-induced p53 activation, and knockdown of integrin β4 increased sensitivity to CDDP (Figs. 4, 5 and 8). Knockdown of wild-type p53 [both HCT116 and LoVo contain a stabilized wild-type p53 protein (3)] decreased sensitivity to platinum (Figs. 6 and 7). In summary, these findings indicated that integrin β4 reduced DNA damage-induced p53 activation. This may contribute to explain the phenomenon that the integrin expression level negatively correlated with prognosis in multiple cancer types (10,12,14,23). Furthermore, mutated p53 or loss of p53 is frequently observed in cancer (17,21,27) and p53 mutations can also inactivate the protein normal function (18,22,28). These results may also contribute to explain that loss of p53 or mutated p53 often acquired drug resistance and that loss of p53 or mutated p53 negatively correlated with survival of cancer patients, including CRC patients (3,15,20,23,26–28).

In the present study, knockdown of integrin β4 appeared to increase chemosensitivity to a lesser degree than that caused by knockdown of p53 (Figs. 6–8). Integrin β4 triggers numerous signaling cascades, and p53 can be regulated by a variety of factors (3,10,12,14,17,20–25,27). It is reasonable to hypothesize that other signaling cascades, besides integrin β4-p53 pathway, may be involved in the mechanism underlying the development of CRC resistance to DNA damage.

In summary, 3D cultures consist of layers of cells that preserve cell adhesive systems. These present a good model to deciphering the function of cell adhesive systems in cancer. Cell adhesion triggers certain integrin signaling cascades and influences tumor cell biological behavior, including chemosensitivity (6,9–11). Data in the present study indicated that integrin β4 reduced DNA damage-induced p53 activation to decrease DNA damage-induced cell death; this may be due to integrin β4 activation in 3D cultures. However, the mechanism of adhesion-associated CRC cell resistance to DNA damage in vivo is complex and deserves further investigation.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

JW, RZ and JL performed the experiments; JW and BL analyzed the data, designed the research and wrote the paper. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

CRC

colorectal cancer

3D

three-dimensional

ECM

extracellular matrix

2D

two-dimensional

AOM

azoxymethane

DSS

dextran sodium sulfate

H&E

hematoxylin and eosin

PBS

phosphate-buffered saline

p-p53

phospho-p53 (Ser15)

GAPDH

glyceraldehyde 3-phosphate dehydrogenase

sh

small hairpin

shcontrol

control shRNA

CDDP

cisplatin

DAPI

4′,6-diamidino-2-phenylindole

WST

water-soluble tetrazolium salt

L-OHP

oxaliplatin

References

1 

Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J and Jemal A: Global cancer statistics, 2012. CA Cancer J Clin. 65:87–108. 2015. View Article : Google Scholar : PubMed/NCBI

2 

He J, Shin H, Wei X, Kadegowda AK, Chen R and Xie SK: NPC1L1 knockout protects against colitis-associated tumorigenesis in mice. BMC Cancer. 15:1892015. View Article : Google Scholar : PubMed/NCBI

3 

He J, Liang X, Luo F, Chen X, Xu X, Wang F and Zhang Z: P53 is involved in a three-dimensional architecture-mediated decrease in chemosensitivity in colon cancer. J Cancer. 7:900–909. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2016. CA Cancer J Clin. 66:7–30. 2016. View Article : Google Scholar : PubMed/NCBI

5 

He J, Pei L, Jiang H, Yang W, Chen J and Liang H: Chemoresistance of colorectal cancer to 5-fluorouracil is associated with silencing of the BNIP3 gene through aberrant methylation. J Cancer. 8:1187–1196. 2017. View Article : Google Scholar : PubMed/NCBI

6 

He JM, Wang FC, Qi HB, Li Y and Liang HJ: Down-regulation of alphav integrin by retroviral delivery of small interfering RNA reduces multicellular resistance of HT29. Cancer Lett. 284:182–188. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Liang X, Xu X, Wang F, Chen X, Li N, Wang C and He J: E-cadherin knockdown increases β-catenin reducing colorectal cancer chemosensitivity only in three-dimensional cultures. Int J Oncol. 47:1517–1527. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Liang X, Xu X, Wang F, Li N and He J: E-cadherin increasing multidrug resistance protein 1 via hypoxia-inducible factor-1alpha contributes to multicellular resistance in colorectal cancer. Tumour Biol. 37:425–435. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Longmate W and DiPersio CM: Beyond adhesion: Emerging roles for integrins in control of the tumor microenvironment. F1000Res. 6:16122017. View Article : Google Scholar : PubMed/NCBI

10 

Das V, Kalyan G, Hazra S and Pal M: Understanding the role of structural integrity and differential expression of integrin profiling to identify potential therapeutic targets in breast cancer. J Cell Physiol. 233:168–185. 2018. View Article : Google Scholar : PubMed/NCBI

11 

Zeltz C and Gullberg D: The integrin-collagen connection-a glue for tissue repair? J Cell Sci. 129:653–664. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Bierie B, Pierce SE, Kroeger C, Stover DG, Pattabiraman DR, Thiru P, Donaher Liu J, Reinhardt F, Chaffer CL, Keckesova Z, et al: Integrin-β4 identifies cancer stem cell-enriched populations of partially mesenchymal carcinoma cells. Proc Natl Acad Sci USA. 114:E2337–E2346. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Phung YT, Barbone D, Broaddus VC and Ho M: Rapid generation of in vitro multicellular spheroids for the study of monoclonal antibody therapy. J Cancer. 2:507–514. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Tai YL, Lai IR, Peng YJ, Ding ST and Shen TL: Activation of focal adhesion kinase through an interaction with beta4 integrin contributes to tumorigenicity of colon cancer. FEBS Lett. 590:1826–1837. 2016. View Article : Google Scholar : PubMed/NCBI

15 

Ye X, Zhang C, Chen Y and Zhou T: Upregulation of acetylcholinesterase mediated by p53 contributes to cisplatin-induced apoptosis in human breast cancer cell. J Cancer. 6:48–53. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Valentine JM, Kumar S and Moumen A: A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation. BMC Cancer. 11:792011. View Article : Google Scholar : PubMed/NCBI

17 

He J, Wang F, Luo F, Chen X, Liang X, Jiang W, Huang Z, Lei J, Shan F and Xu X: Effects of long term low- and high-dose sodium arsenite exposure in human transitional cells. Am J Transl Res. 9:416–428. 2017.PubMed/NCBI

18 

Yogev O, Barker K, Sikka A, Almeida GS, Hallsworth A, Smith LM, Jamin Y, Ruddle R, Koers A, Webber HT, et al: p53 loss in MYC-driven neuroblastoma leads to metabolic adaptations supporting radioresistance. Cancer Res. 76:3025–3035. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Verjans ET, Doijen J, Luyten W, Landuyt B and Schoofs L: Three-dimensional cell culture models for anticancer drug screening: Worth the effort? J Cell Physiol. 233:2993–3003. 2018. View Article : Google Scholar : PubMed/NCBI

20 

Godar S, Ince TA, Bell GW, Feldser D, Donaher JL, Bergh J, Liu A, Miu K, Watnick RS, Reinhardt F, et al: Growth-inhibitory and tumor-suppressive functions of p53 depend on its repression of CD44 expression. Cell. 134:62–73. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Yoshioka T, Otero J, Chen Y, Kim YM, Koutcher JA, Satagopan J, Reuter V, Carver B, de Stanchina E, Enomoto K, et al: β4 Integrin signaling induces expansion of prostate tumor progenitors. J Clin Invest. 123:682–699. 2013.PubMed/NCBI

22 

Bon G, Di Carlo SE, Folgiero V, Avetrani P, Lazzari C, D'Orazi G, Brizzi MF, Sacchi A, Soddu S, Blandino G, et al: Negative regulation of beta4 integrin transcription by homeodomain-interacting protein kinase 2 and p53 impairs tumor progression. Cancer Res. 69:5978–5986. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Lakshmanan I, Rachagani S, Hauke R, Krishn SR, Paknikar S, Seshacharyulu P, Karmakar S, Nimmakayala RK, Kaushik G, Johansson SL, et al: MUC5AC interactions with integrin β4 enhances the migration of lung cancer cells through FAK signaling. Oncogene. 35:4112–4121. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Chao C, Lotz MM, Clarke AC and Mercurio AM: A function for the integrin alpha6beta4 in the invasive properties of colorectal carcinoma cells. Cancer Res. 56:4811–4819. 1996.PubMed/NCBI

25 

Alon R and Dustin ML: Force as a facilitator of integrin conformational changes during leukocyte arrest on blood vessels and antigen-presenting cells. Immunity. 26:17–27. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Sarasqueta AF, Forte G, Corver WE, de Miranda NF, Ruano D, van Eijk R, Oosting J, Tollenaar RA, van Wezel T and Morreau H: Integral analysis of p53 and its value as prognostic factor in sporadic colon cancer. BMC Cancer. 13:2772013. View Article : Google Scholar : PubMed/NCBI

27 

Li H, Rokavec M, Jiang L, Horst D and Hermeking H: Antagonistic effects of p53 and HIF1A on microRNA-34a regulation of PPP1R11 and STAT3 and hypoxia-induced epithelial to mesenchymal transition in colorectal cancer cells. Gastroenterology. 153:505–520. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Tran TQ, Lowman XH, Reid MA, Mendez-Dorantes C, Pan M, Yang Y and Kong M: Tumor-associated mutant p53 promotes cancer cell survival upon glutamine deprivation through p21 induction. Oncogene. 36:1991–2001. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wu J, Zhao R, Lin J and Liu B: Integrin β4 reduces DNA damage‑induced p53 activation in colorectal cancer. Oncol Rep 40: 2183-2192, 2018.
APA
Wu, J., Zhao, R., Lin, J., & Liu, B. (2018). Integrin β4 reduces DNA damage‑induced p53 activation in colorectal cancer. Oncology Reports, 40, 2183-2192. https://doi.org/10.3892/or.2018.6628
MLA
Wu, J., Zhao, R., Lin, J., Liu, B."Integrin β4 reduces DNA damage‑induced p53 activation in colorectal cancer". Oncology Reports 40.4 (2018): 2183-2192.
Chicago
Wu, J., Zhao, R., Lin, J., Liu, B."Integrin β4 reduces DNA damage‑induced p53 activation in colorectal cancer". Oncology Reports 40, no. 4 (2018): 2183-2192. https://doi.org/10.3892/or.2018.6628
Copy and paste a formatted citation
x
Spandidos Publications style
Wu J, Zhao R, Lin J and Liu B: Integrin β4 reduces DNA damage‑induced p53 activation in colorectal cancer. Oncol Rep 40: 2183-2192, 2018.
APA
Wu, J., Zhao, R., Lin, J., & Liu, B. (2018). Integrin β4 reduces DNA damage‑induced p53 activation in colorectal cancer. Oncology Reports, 40, 2183-2192. https://doi.org/10.3892/or.2018.6628
MLA
Wu, J., Zhao, R., Lin, J., Liu, B."Integrin β4 reduces DNA damage‑induced p53 activation in colorectal cancer". Oncology Reports 40.4 (2018): 2183-2192.
Chicago
Wu, J., Zhao, R., Lin, J., Liu, B."Integrin β4 reduces DNA damage‑induced p53 activation in colorectal cancer". Oncology Reports 40, no. 4 (2018): 2183-2192. https://doi.org/10.3892/or.2018.6628
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team