Open Access

Downregulation of miR‑505‑3p predicts poor bone metastasis‑free survival in prostate cancer

  • Authors:
    • Yubo Tang
    • Bowen Wu
    • Shuai Huang
    • Xinsheng Peng
    • Xing Li
    • Xiufang Huang
    • Wei Zhou
    • Peigen Xie
    • Peiheng He
  • View Affiliations

  • Published online on: October 25, 2018     https://doi.org/10.3892/or.2018.6826
  • Pages: 57-66
  • Copyright: © Tang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

The principal issue deriving from prostate cancer (PCa) is its propensity to metastasize to bone. To date, bone metastasis remains incurable, and therapeutic strategies are limited. Therefore, it is of paramount importance to explore predictive markers for bone metastasis of PCa. In the present study, we reported that miR‑505‑3p was significantly downregulated in bone metastatic PCa tissues compared with that in non‑bone metastatic PCa tissues, but there was no significant difference in miR‑505‑3p expression between PCa and adjacent normal tissues. miR‑505‑3p expression was inversely associated with serum PSA levels, Gleason grade, N and M classification, and short bone metastasis‑free survival in PCa patients, but had no effect on overall survival in PCa patients. Furthermore, upregulation of miR‑505‑3p suppressed the activity of TGF‑β signaling by directly targeting downstream effectors of TGF‑β signaling, SMAD2 and SMAD3, further inhibiting the invasion and migration abilities of PCa cells. Therefore, our findings unraveled a novel mechanism by which miR‑505‑3p inhibits bone metastasis of PCa, supporting the notion that miR‑505‑3p may serve as a predictive marker for bone metastasis of PCa.

Introduction

Prostate cancer (PCa) is one of the most common cancers and the second leading cause of cancer-related deaths in men worldwide (1). Although there has been substantial progress in the treatment of primary PCa, distant bone metastasis remains incurable, due to the lack of effective therapeutic avenues, contributing to the mortality of PCa (2). Therefore, exploring a novel marker to predict bone metastasis of PCa will facilitate the development of antimetastatic therapeutic strategies against PCa.

miRNAs are a class of small non-coding regulatory RNAs that mechanistically function by binding to the 3′ untranslated region (3′UTR) of downstream mRNAs, giving rise to mRNA degradation or repression of translation (3,4), and play crucial roles in many biological processes, including cell apoptosis, proliferation and differentiation (3). Numerous studies have demonstrated that aberrant expression of miRNAs is implicated in the progression and metastasis of several human cancers (59). Furthermore, several miRNAs have been identified as critical mediators of bone metastasis in human cancer (10,11), holding promise as a potential predictive factor for bone metastasis. Our previous studies demonstrated that downregulation of miR-145 by loss of wild-type p53 in PC-3 cells promoted bone metastasis of PCa by regulating several positive regulators of EMT, including ZEB2 and HEF1 (1214). Therefore, it is imperative to discern a novel miRNA to predict bone metastasis of PCa.

In the present study, we found no evident difference in miR-505-3p expression in PCa tissues compared with that in adjacent normal tissues. Notably, miR-505-3p was significantly reduced in bone metastatic PCa tissues, and miR-505-3p expression was inversely associated with poor clinicopathological characteristics in PCa patients. More importantly, low expression of miR-505-3p was positively associated with shorter bone metastasis-free survival in PCa patients, but was not associated with overall survival of PCa patients. Our results further revealed that upregulation of miR-505-3p inhibited TGF-β signaling activity by targeting SMAD2 and SMAD3, which further inhibited the invasion and migration abilities of PCa cells. Therefore, our results demonstrated that downregulation of miR-505-3p was associated with poor bone metastasis-free survival in PCa, suggesting that miR-505-3p may be used as a novel marker to predict bone metastasis of PCa.

Materials and methods

Cell lines and cell culture

Human RWPE-1, DU145, LNCaP, 22RV1, PC-3 and VCaP cells were obtained from the American Type Culture Collection (ATCC; American Type Culture Collection, Manassas, VA, USA) and cultured according to the manufacturer's instructions. The C4-2B cell line was purchased from MD Anderson Cancer Center (Houston, TX, USA). RWPE-1 cells were grown in defined keratinocyte-SFM (1X) (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). LNCaP, 22RV1, C4-2B and PC-3 cells were grown in RPMI-1640 medium supplemented with 10% FBS, while DU145 and VCaP cells were grown in Dulbecco's modified Eagle's medium (all from Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS. All cells were incubated at 37°C in a humidified atmosphere with 5% CO2.

Patients and tumor tissues

The 127 archived PCa tissues, including 81 non-bone metastatic PCa tissues and 46 bone metastatic PCa tissues were obtained during surgery or needle biopsy at Jiangmen Central Hospital (Guangzhou, China). Patients were diagnosed based on clinical and pathological evidence, and the specimens were immediately snap-frozen and stored in liquid nitrogen tanks. For the use of these clinical materials for research purposes, prior informed consents from patients and approval from the Institutional Research Ethics Committee were obtained from Jiangmen Central Hospital (Jiangmen, China). The clinicopathological features of the patients are presented in Table I.

Table I.

The relationship between the expression level of miR-505-3p and the clinicopathological characteristics in 127 PCa patients.

Table I.

The relationship between the expression level of miR-505-3p and the clinicopathological characteristics in 127 PCa patients.

miR-505-3p expression

ParametersNumber of casesLowHighP-values
Age (years)
  ≤725829290.935
  >72693534
T classification
  T1-T25028220.309
  T3-T4773641
N classification
  N0933855<0.001
  N134268
M classification
  M0781860<0.001
  M149463
Gleason score
  ≤7481533<0.01
  >7794930
Serum PSA at diagnosis, µg/ml
  <77.6522032<0.05
  >77.6754431
BM status
  nBM812457<0.001
  BM46406

[i] PCa, prostate cancer; PSA, prostate-specific antigen; BM, bone metastasis; nBM, non-bone metastasis.

RNA extraction, reverse transcription, and real-time PCR

Total RNA from tissues or cells was extracted using TRIzol (Life Technologies; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Messenger RNA (mRNA) and miRNA were reverse-transcribed from total mRNA using the Revert Aid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Real-time PCR was performed according to a standard method, as previously described (15). The list of primers used is presented in Table II. Primers for U6 and miR-505-3p were synthesized and purified by Guangzhou RiboBio Co., Ltd. U6 or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control for miRNA or mRNA, respectively. Relative fold expression was calculated using the comparative threshold cycle (2−∆∆Cq) method (16).

Table II.

List of primers used for real-time RT-PCR.

Table II.

List of primers used for real-time RT-PCR.

Primers
CTGFF: GCTACCACATTTCCTACCTAGAAATCA
R: GACAGTCCGTCAAAACAGATTGTT
PTHRPF: ACTCGCTCTGCCTGGTTAGA
R: GGAGGTGTCAGACAGGTGGT
IL11F: TGAAGACTCGGCTGTGACC
R: CCTCACGGAAGGACTGTCTC
SMAD2F: CACGCTAGGAAAACAGCCTC
R: TCGGAAGAGGAAGGAACAAA
SMAD3F: CGGCAGTAGATGACATGAGG
R: TCAACACCAAGTGCATCACC
GAPDHF: ATTCCACCCATGGCAAATTC
R: TGGGATTTCCATTGATGACAAG

[i] F, forward; R, reverse.

Plasmid, small interfering RNA and transfection

The (CAGAC) 12/pGL3 TGF-β/Smad-responsive luciferase reporter plasmid and control plasmids (cat. no. 32177; Clontech; Takara Bio, Inc., Tokyo, Japan) were used to quantitatively assess the transcriptional activity of TGF-β signaling components. The 3′UTR regions of SMAD2 and SMAD3 were PCR-amplified from genomic DNA and cloned into the pmirGLO luciferase reporter vector (Promega Corporation, Madison, WI, USA). The miR-505-3p mimics were obtained from Guangzhou RiboBio Co., Ltd. Transfection of siRNAs and plasmids was performed using Lipofectamine 3000 (Life Technologies; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions.

Invasion and migration assays

Migration and invasion were performed using Transwell chambers consisting of 8-mm membrane filter inserts (Corning Incorporated, Corning, NY, USA) coated with or without Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) as previously described (17).

Luciferase assay

Cells (4×104) were seeded in triplicate in 24-well plates and cultured for 24 h as previously described (18). Cells were transfected with 250 ng pTGF-β/Smad reporter luciferase plasmid, or pmirGLO-SMAD2-3′UTR and -SMAD3-3′UTR luciferase plasmid, plus 5 ng pRL-TK Renilla plasmid (Promega Corporation) using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Luciferase and Renilla signals were assessed 36 h after transfection using a Dual-Luciferase Reporter Assay kit (Promega Corporation) according to the manufacturer's protocol.

RNA immunoprecipitation

Cells were co-transfected with HA-Ago2 (cat. no. 10822; Addgene, Inc., Cambridge, MA, USA), followed by HA-Ago2 immunoprecipitation using an HA-antibody (1:1,000; cat. no. H3663; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), as previously described (19). Real-time PCR analysis of the IP material was used to assess the association of SMAD2 and SMAD3 mRNA with the RISC complex.

Western blotting

Western blotting was performed according to a standard method, as previously described (20). Proteins were visualized using ECL reagents (Pierce; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Antibodies against SMAD2 (cat. no. 5339), SMAD3 (cat. no. 9523), pSMAD2/3 (cat. no. 9510) and SMAD2/3 (cat. no. 8685) were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA), and p84 (cat. no. PA5-27816) was obtained from Invitrogen; Thermo Fisher Scientific, Inc. All antibodies aforementioned were diluted 1:1,000. The membranes were stripped and reprobed with an anti-α-tubulin antibody (1:5,000; cat. no. ab7291, Abcam, Cambridge, UK) as the loading control.

Generation and analysis of TCGA datasets and Gene Set Enrichment Analysis (GSEA)

The miRNA expression levels and clinical profile datasets from PCa patients were downloaded from The Cancer Genome Atlas (TCGA; http://tcga-data.nci.nih.gov/tcga/). The log2 values of miRNAs in each sample were analyzed using Excel 2010 and GraphPad 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA). The miRNA expression levels of all PCa tissues were statistically analyzed using paired t-tests or unpaired t-tests. The miRNA expression levels in each sample were analyzed as previously described (21). Briefly the high and low expression levels of miR-505-3p were stratified by the medium expression level of miR-505-3p in PCa tissues. Gene set enrichment analysis was performed using Molecular Signatures Database (MSigDB) v5.2.

TargetScan and miRanda analysis

TargetScan (http://www.targetscan.org/vert_71/) and miRanda (http://34.236.212.39/microrna/home.do) datasets were analyzed as previously described respectively (22,23).

Statistical analysis

All values are presented as the means ± standard deviation (SD). Significant differences were determined using GraphPad 5.0 software. Student's t-test was used to determine significant differences between two groups. The chi-square test was used to analyze the relationship between miR-505-3p expression and clinicopathological characteristics. Survival curves were plotted using the Kaplan Meier method and compared by log-rank test. P<0.05 was considered to indicate a statistically significant difference. All experiments were repeated three times.

Results

miR-505-3p is downregulated in bone metastatic PCa tissues

To investigate the aberrant miRNA expression between bone metastatic PCa tissues and non-bone metastatic PCa tissues, we analyzed the miRNA sequencing datasets of PCa tissues from TCGA. We found that that there was no significant difference in miR-505-3p expression between 498 PCa tissues and 52 adjacent normal tissues (ANT) (Fig. 1A), or between 52 paired PCa tissues compared with the expression in the matched ANT (Fig. 1B). Notably, miR-505-3p expression was significantly downregulated in bone metastatic PCa tissues compared with the expression in non-bone metastatic PCa tissues (Fig. 1C). The miR-505-3p expression in our 81 non-bone metastatic PCa tissues and 46 bone metastatic PCa tissues was further validated via real-time PCR and the results revealed that miR-505-3p expression was significantly downregulated in bone metastatic PCa tissues compared with the expression in non-bone metastatic PCa tissues (Fig. 1D). The percentage of low miR-505-3p expression was much higher in bone metastatic PCa tissues compared to that in non-bone metastatic PCa tissues (Fig. 1E), which was consistent with the results of TCGA (Fig. 1F). Therefore, these results indicated that downregulation of miR-505-3p was involved in bone metastasis of PCa.

Low expression of miR-505-3p is ssociated with advanced clinicopathological features and poor bone metastasis-free survival in PCa patients

We further investigated the clinical association of miR-505-3p expression with clinicopathological characteristics in PCa patients and found that miR-505-3p expression was downregulated in N1, M1 or Gleason grade (>7) PCa tissues, but not in T3-T4 PCa tissues (Fig. 2A-D). Statistical analysis of PCa tissue samples revealed that miR-505-3p expression was inversely associated with serum PSA levels, Gleason grade, N classification, M classification and bone metastasis status in PCa patients (Table I). Kaplan Meier analysis revealed that miR-505-3p expression levels had no effect on the overall 5-year survival in PCa patients (Fig. 2E); whereas low expression of miR-505-3p was strongly and positively associated with shorter bone metastasis-free survival in PCa patients (Fig. 2F). Thus, our results demonstrated that downregulation of miR-505-3p predicted poor bone metastasis-free survival in PCa patients.

Upregulation of miR-505-3p inhibits invasion and migration in PCa cells

To determine the biological role of miR-505-3p in bone metastasis of PCa, we performed gene set enrichment (GSEA) analysis of miR-505-3p expression against the oncogenic signatures collection of MSigDB, and the results revealed that downregulation of miR-505-3p was significantly and positively associated with metastatic propensity (Fig. 3A-D). Therefore, we further examined whether miR-505-3p has an effect on the invasion and migration of PCa cells. We first examined miR-505-3p expression in normal prostate cells (RWPE-1) and 6 PCa cell lines and found that miR-505-3p expression was differentially downregulated in metastatic cell lines, including lymph node metastatic cell line LNCaP, brain metastatic PCa cells DU145 and bone metastatic PCa cell lines (PC-3, C4-2B and VCaP), particularly in PC-3 and C4-2B, but slightly elevated in primary PCa 22RV1 cells (Fig. 3E). This finding further elucidated the pro-metastatic roles of miR-505-3p downregulation in PCa. According to the expression levels of miR-505-3p shown in Fig. 3E, we upregulated miR-505-3p in bone metastatic PC-3, C4-2B and VCaP cells via transfection with miR-505-3p mimics to further evaluate the effects of miR-505-3p on the invasion and migration of PCa cells (Fig. 3F). As shown in Fig. 3G, miR-505-3p overexpression significantly decreased the invasive and migratory abilities of PCa cells. Therefore, these results indicated that low expression of miR-505-3p was implicated in bone metastasis of PCa cells via promotion of the invasion and migration abilities of PCa cells.

miR-505-3p inhibits TGF-β signaling activity by targeting SMAD2 and SMAD3

GSEA analysis of miR-505-3p expression revealed that downregulation of miR-505-3p was positively associated with TGF-β signaling activity (Fig. 4A-C). These results indicated that miR-505-3p may negatively regulate the TGF-β signaling pathway, which has been demonstrated to play an important role in bone metastasis of PCa (24). As shown in Fig. 4D, miR-505-3p overexpression reduced the transcriptional activity of the TGF-β/Smad-responsive luciferase reporter in PCa cells. Cellular fractionation and western blot analysis revealed that overexpression of miR-505-3p decreased nuclear accumulation of pSMAD2/3 (Fig. 4E). Real-time PCR analysis revealed that upregulation of miR-505-3p differentially reduced downstream target genes of TGF-β signaling in PCa cells, including IL11, PTHRP and CTGF (Fig. 4F-H). Thus, these results indicated that miR-505-3p inhibited the activity of TGF-β signaling in PCa cells.

miR-505-3p directly targets SMAD2 and SMAD3 in PCa cells

Using the publicly available algorithms TargetScan and miRanda, we found that the critical downstream effectors of TGF-β signaling SMAD2 and SMAD3 were potential targets of miR-505-3p (Fig. 5A). Real-time-PCR and western blot analysis revealed that miR-505-3p overexpression reduced the mRNA and protein expression levels of SMAD2 and SMAD3 (Fig. 5B and C). Luciferase assays revealed that miR-505-3p overexpression suppressed the luciferase reporter activity of SMAD2 and SMAD3, but not the expression of SMAD2 and SMAD3 with the 3′UTR mutation within the miR-505-3p-binding seed regions in PCa cells (Fig. 5D-F). Microribonucleoprotein (miRNP) immunoprecipitation (IP) assays revealed a direct association of miR-505-3p with SMAD2 and SMAD3 transcripts (Fig. 5G-I), further elucidating the direct suppressive effects of miR-505-3p on SMAD2 and SMAD3. Collectively, these results demonstrated that miR-505-3p inhibited the activity of TGF-β signaling by targeting SMAD2 and SMAD3in PCa cells.

SMAD2 and SMAD3 reverse the effects of miR-505-3p on the invasion and migration in PCa cells

We further investigated whether SMAD2 and SMAD3 had an effect on the invasion and migration abilities in miR-505-3p-overexpressing PCa cells and found that individual upregulation of SMDA2 and SMAD3 markedly reversed the inhibitory effects of miR-505-3p on the invasion and migration abilities in PCa cells (Fig. 6). These results indicated that miR-505-3p suppresses the invasion and migration abilities by inhibiting SMAD2 and SMAD3 activity in PCa cells.

Discussion

The primary findings of the present study provide novel insights into the important predictive role of miR-505-3p in bone metastasis of PCa. In the present study, we reported that miR-505-3p was significantly downregulated in bone metastatic PCa tissues, and that miR-505-3p expression was inversely associated with poor clinicopathological characteristics and bone metastasis-free survival in PCa patients. Our results further revealed that upregulation of miR-505-3p inhibited TGF-β signaling activity by targeting SMAD2 and SMAD3, which further inhibited the invasion and migration abilities of PCa cells. Therefore, our results provide evidence that miR-505-3p may serve as a novel marker to predict bone metastasis of PCa.

As one of the originally identified miRNAs, miR-505-3p has been reported to be downregulated in several types of cancers, which predicted poor prognosis in cancer patients (25,26). However, miR-505-3p was found to be upregulated in hepatocellular carcinoma, which facilitated the identification of small-size, early-stage, α-fetoprotein-negative hepatocellular carcinoma in patients at risk (27). These findings indicated that the anticancer or pro-cancer role of miR-505-3p in cancer is tumor type-dependent. However, the expression level and biological role of miR-505-3p in bone metastasis of PCa remains largely unknown. In the present study, we found that miR-505-3p expression was downregulated in bone metastatic PCa tissues, which was positively associated with advanced clinicopathological characteristics and poor bone metastasis-free survival in PCa patients. Upregulation of miR-505-3p inhibited the invasion and migration abilities of PCa cells by targeting SMAD2 and SMAD3, leading to the inactivation of TGF-β signaling activity. Therefore, our findings demonstrated that miR-505-3p plays a tumor-suppressive role in bone metastasis of PCa by suppressing the activity of the TGF-β signaling pathway.

Constitutive activation of TGF-β signaling has been reported in bone metastasis of PCa. Fournier et al have reported that TGF-β upregulated the negative regulator of the TGF-β pathway PMEPA1, which inhibited bone metastasis of PCa. Notably, disruption of this negative feedback loop using PMEPA1 siRNA promoted bone metastases in vivo (28). Furthermore, downregulation of the negative regulator of the TGF-β signaling PICK1 caused by oncogenic miR-210-3p contributed to bone metastasis in PCa (24). In the present study, we found that the critical downstream effectors of TGF-β signaling SMAD2 and SMAD3 were potential targets of miR-505-3p. Through a series of mechanistic experiments, including real-time-PCR, western blotting, luciferase assay and microribonucleoprotein immunoprecipitation, our results demonstrated that miR-505-3p directly targeted SMAD2 and SMAD3 in PCa cells, resulting in the suppression of TGF-β signaling activity. Since the crucial roles of TGF-β signaling in bone metastasis in a variety of cancers (2933), including PCa (24,28), have been well established, our results uncovered a novel mechanism responsible for the constitutive activation of TGF-β signaling in PCa, providing theoretical evidence that miR-505-3p plays a tumor suppressive role in bone metastasis of PCa.

miRNAs alone or in clusters have been widely documented to serve as potential markers for the diagnosis and prognosis of cancer. Several studies have shown that high levels of miR-96 were significantly correlated with poor overall and recurrence-free survival in PCa patients (34,35). Moreover, a miRNA classifier, including miR-505-3p, served as a potential biomarker for hepatocellular carcinoma, which was valuable in the detection of preclinical hepatocellular carcinoma (27). However, the clinical significance of miR-505-3p in PCa remains largely unknown. In this study, our results demonstratd that low expression of miR-505-3p was positively associated with poor clinicopathological characteristics and shorter bone metastasis-free survival in PCa patients, but had no significant effect on the overall survival in PCa patients. These findings indicated that miR-505-3p holds promise as a novel prognostic marker for bone metastasis of PCa.

miRNAs can not only serve as potential markers for the diagnosis and prognosis of cancer, but also provide data for the optimization and personalization of therapy in the treatment of cancer. miR-505-3p has been reported as a tumor inhibitor in several human cancer types, suggesting the therapeutic application of miR-505-3p in cancer treatment. For example, lentivirus-mediated miR-505-3p upregulation suppressed cervical cancer cell proliferation and invasion in vitro. Notably, upregulation of miR-505-3p markedly reduced tumorigenicity of cervical cancer cells in vivo (26). In endometrial carcinoma, overexpression of miR-505 reduced tumorigenicity and inhibited the growth of xenograft tumors in a mouse model of endometrial carcinoma (36). Furthermore, several lines of evidence have reported that miR-505-3p expression levels can predict complete chemotherapeutic response in cancer (3739). Therefore, it is tempting to investigate, although it remains to be studied, the therapeutic application of miR-505-3p in bone metastasis of PCa via an intra-prostatic injection mouse model or clinical trial.

In summary, our results demonstrated that miR-505-3p negatively regulated TGF-β signaling and was inversely associated with bone metastasis-free survival in PCa. An improved understanding of the underlying molecular mechanisms by which miR-505-3p inhibits bone metastasis of PCa and the prognostic values of miR-505-3p expression for bone metastasis of PCa will increase our knowledge of the biological basis of the development of PCa bone metastasis and facilitate the development of antimetastatic therapeutic strategies against PCa.

Acknowledgements

Not applicable.

Funding

The present study was supported in part by grants from the National Natural Science Foundation of China (nos. 81402227 and 81503281), and the Guangdong Natural Science Foundation (no. 2017A020215162).

Availability of data and materials

The datasets used during the present study are available from the corresponding author upon reasonable request.

Authors' contributions

PX and PH conceived, designed, and wrote the study. YT, BW and XL performed the experiments. XH and WZ analyzed the miR-505-3p expression and clinical correlation with clinicopathological characteristics. SH and XP performed the clinical analysis and drafted the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

For the use of the clinical samples for research purposes, prior informed consents from patients and approval from the Institutional Research Ethics Committee were obtained from Jiangmen Central Hospital (Jiangmen, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Nelson WG, De Marzo AM and Isaacs WB: Prostate cancer. N Engl J Med. 349:366–381. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Sabbatini P, Larson SM, Kremer A, Zhang ZF, Sun M, Yeung H, Imbriaco M, Horak I, Conolly M, Ding C, et al: Prognostic significance of extent of disease in bone in patients with androgen-independent prostate cancer. J Clin Oncol. 17:948–957. 1999. View Article : Google Scholar : PubMed/NCBI

3 

Ventura A and Jacks T: MicroRNAs and cancer: Short RNAs go a long way. Cell. 136:586–591. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Khew-Goodall Y and Goodall GJ: Myc-modulated miR-9 makes more metastases. Nat cell Biol. 12:209–211. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Hao GJ, Ding YH, Wen H, Li XF, Zhang W, Su HY, Liu DM and Xie NL: Attenuation of deregulated miR-369-3p expression sensitizes non-small cell lung cancer cells to cisplatin via modulation of the nucleotide sugar transporter SLC35F5. Biochem Biophys Res Commun. 488:501–508. 2017. View Article : Google Scholar : PubMed/NCBI

6 

Ren D, Lin B, Zhang X, Peng Y, Ye Z, Ma Y, Liang Y, Cao L, Li X, Li R, et al: Maintenance of cancer stemness by miR-196b-5p contributes to chemoresistance of colorectal cancer cells via activating STAT3 signaling pathway. Oncotarget. 8:49807–49823. 2017. View Article : Google Scholar : PubMed/NCBI

7 

Zhao G, Li Y and Wang T: Potentiation of docetaxel sensitivity by miR-638 via regulation of STARD10 pathway in human breast cancer cells. Biochem Biophys Res Commun. 487:255–261. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Zhang X, Liu J, Zang D, Wu S, Liu A, Zhu J, Wu G, Li J and Jiang L: Upregulation of miR-572 transcriptionally suppresses SOCS1 and p21 and contributes to human ovarian cancer progression. Oncotarget. 6:15180–15193. 2015.PubMed/NCBI

9 

Ren D, Yang Q, Dai Y, Guo W, Du H, Song L and Peng X: Oncogenic miR-210-3p promotes prostate cancer cell EMT and bone metastasis via NF-kappaB signaling pathway. Mol Cancer. 16:1172017. View Article : Google Scholar : PubMed/NCBI

10 

Liu Z, Liu Z, Zhang Y, Li Y, Liu B and Zhang K: miR-24 represses metastasis of human osteosarcoma cells by targeting Ack1 via AKT/MMPs pathway. Biochem Biophys Res Commun. 486:211–217. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Siu MK, Tsai YC, Chang YS, Yin JJ, Suau F, Chen WY and Liu YN: Transforming growth factor-beta promotes prostate bone metastasis through induction of microRNA-96 and activation of the mTOR pathway. Oncogene. 34:4767–4776. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Ren D, Wang M, Guo W, Zhao X, Tu X, Huang S, Zou X and Peng X: Wild-type p53 suppresses the epithelial-mesenchymal transition and stemness in PC-3 prostate cancer cells by modulating miR145. Int J Oncol. 42:1473–1481. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Ren D, Wang M, Guo W, Huang S, Wang Z, Zhao X, Du H, Song L and Peng X: Double-negative feedback loop between ZEB2 and miR-145 regulates epithelial-mesenchymal transition and stem cell properties in prostate cancer cells. Cell Tissue Res. 358:763–778. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Guo W, Ren D, Chen X, Tu X, Huang S, Wang M, Song L, Zou X and Peng X: HEF1 promotes epithelial mesenchymal transition and bone invasion in prostate cancer under the regulation of microRNA-145. J Cell Biochem. 114:1606–1615. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Wang M, Ren D, Guo W, Huang S, Wang Z, Li Q, Du H, Song L and Peng X: N-cadherin promotes epithelial-mesenchymal transition and cancer stem cell-like traits via ErbB signaling in prostate cancer cells. Int J Oncol. 48:595–606. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Zhang X, Ren D, Guo L, Wang L, Wu S, Lin C, Ye L, Zhu J, Li J, Song L, et al: Thymosin beta 10 is a key regulator of tumorigenesis and metastasis and a novel serum marker in breast cancer. Breast cancer Res. 19:152017. View Article : Google Scholar : PubMed/NCBI

18 

Zhang X, Zhang L, Lin B, Chai X, Li R, Liao Y, Deng X, Liu Q, Yang W, Cai Y, et al: Phospholipid phosphatase 4 promotes proliferation and tumorigenesis, and activates Ca2+-permeable cationic channel in lung carcinoma cells. Mol Cancer. 16:1472017. View Article : Google Scholar : PubMed/NCBI

19 

Li X, Liu F, Lin B, Luo H, Liu M, Wu J, Li C, Li R, Zhang X, Zhou K, et al: miR150 inhibits proliferation and tumorigenicity via retarding G1/S phase transition in nasopharyngeal carcinoma. Int J Oncol. 2017.

20 

Wang M, Ren D, Guo W, Wang Z, Huang S, Du H, Song L and Peng X: Loss of miR-100 enhances migration, invasion, epithelial-mesenchymal transition and stemness properties in prostate cancer cells through targeting Argonaute 2. Int J Oncol. 45:362–372. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Cheadle C, Vawter MP, Freed WJ and Becker KG: Analysis of microarray data using Z score transformation. J Mol Diagn. 5:73–81. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Agarwal V, Bell GW, Nam JW and Bartel DP: Predicting effective microRNA target sites in mammalian mRNAs. Elife. 4:2015. View Article : Google Scholar

23 

Betel D, Wilson M, Gabow A, Marks DS and Sander C: The microRNA.org resource: Targets and expression. Nucleic Acids Res. 36:D149–D153. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Dai Y, Ren D, Yang Q, Cui Y, Guo W, Lai Y, Du H, Lin C, Li J, Song L, et al: The TGF-β signalling negative regulator PICK1 represses prostate cancer metastasis to bone. Br J Cancer. 117:685–694. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Xu M, Kuang Y, Wang M, Han X and Yang Q: A microRNA expression signature as a predictor of survival for colon adenocarcinoma. Neoplasma. 64:56–64. 2017. View Article : Google Scholar : PubMed/NCBI

26 

Ma C, Xu B, Husaiyin S, Wang L, Wusainahong K, Ma J, Zhu K and Niyazi M: MicroRNA-505 predicts prognosis and acts as tumor inhibitor in cervical carcinoma with inverse association with FZD4. Biosmed Pharmacother. 92:586–594. 2017. View Article : Google Scholar

27 

Lin XJ, Chong Y, Guo ZW, Xie C, Yang XJ, Zhang Q, Li SP, Xiong Y, Yuan Y, Min J, et al: A serum microRNA classifier for early detection of hepatocellular carcinoma: A multicentre, retrospective, longitudinal biomarker identification study with a nested case-control study. Lancet Oncol. 16:804–815. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Fournier PG, Juarez P, Jiang G, Clines GA, Niewolna M, Kim HS, Walton HW, Peng XH, Liu Y, Mohammad KS, et al: The TGF-beta signaling regulator PMEPA1 suppresses prostate cancer metastases to bone. Cancer Cell. 27:809–821. 2015. View Article : Google Scholar : PubMed/NCBI

29 

No authors listed. TGF β induces a pro-bone metastasis program in prostate cancer. Cancer Discov. 5(OF23)2015.

30 

Yin JJ, Selander K, Chirgwin JM, Dallas M, Grubbs BG, Wieser R, Massague J, Mundy GR and Guise TA: TGF-beta signaling blockade inhibits PTHrP secretion by breast cancer cells and bone metastases development. J Clin Invest. 103:197–206. 1999. View Article : Google Scholar : PubMed/NCBI

31 

Kang Y, Siegel PM, Shu W, Drobnjak M, Kakonen SM, Cordon-Cardo C, Guise TA and Massague J: A multigenic program mediating breast cancer metastasis to bone. Cancer Cell. 3:537–549. 2003. View Article : Google Scholar : PubMed/NCBI

32 

Sethi N, Dai X, Winter CG and Kang Y: Tumor-derived JAGGED1 promotes osteolytic bone metastasis of breast cancer by engaging Notch signaling in bone cells. Cancer Cell. 19:192–205. 2011. View Article : Google Scholar : PubMed/NCBI

33 

Javelaud D, Mohammad KS, McKenna CR, Fournier P, Luciani F, Niewolna M, Andre J, Delmas V, Larue L, Guise TA, et al: Stable overexpression of Smad7 in human melanoma cells impairs bone metastasis. Cancer Res. 67:2317–2324. 2007. View Article : Google Scholar : PubMed/NCBI

34 

Schaefer A, Jung M, Mollenkopf HJ, Wagner I, Stephan C, Jentzmik F, Miller K, Lein M, Kristiansen G and Jung K: Diagnostic and prognostic implications of microRNA profiling in prostate carcinoma. Int J Cancer. 126:1166–1176. 2010.PubMed/NCBI

35 

Haflidadottir BS, Larne O, Martin M, Persson M, Edsjo A, Bjartell A and Ceder Y: Upregulation of miR-96 enhances cellular proliferation of prostate cancer cells through FOXO1. PLoS One. 8:e724002013. View Article : Google Scholar : PubMed/NCBI

36 

Chen S, Sun KX, Liu BL, Zong ZH and Zhao Y: MicroRNA-505 functions as a tumor suppressor in endometrial cancer by targeting TGF-alpha. Mol Cancer. 15:112016. View Article : Google Scholar : PubMed/NCBI

37 

Skinner HD, Lee JH, Bhutani MS, Weston B, Hofstetter W, Komaki R, Shiozaki H, Wadhwa R, Sudo K, Elimova E, et al: A validated miRNA profile predicts response to therapy in esophageal adenocarcinoma. Cancer. 120:3635–3641. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Ramachandran SS, Muiwo P, Ahmad HM, Pandey RM, Singh S, Bakhshi S, Kumar L, Bhattacharya A and Gupta YK: miR-505-5p and miR-193b-3p: Potential biomarkers of imatinib response in patients with chronic myeloid leukemia. Leuk Lymphoma. 58:1981–1984. 2017. View Article : Google Scholar : PubMed/NCBI

39 

Molina-Pinelo S, Carnero A, Rivera F, Estevez-Garcia P, Bozada JM, Limon ML, Benavent M, Gomez J, Pastor MD, Chaves M, et al: MiR-107 and miR-99a-3p predict chemotherapy response in patients with advanced colorectal cancer. BMC Cancer. 14:6562014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

January 2019
Volume 41 Issue 1

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Tang, Y., Wu, B., Huang, S., Peng, X., Li, X., Huang, X. ... He, P. (2019). Downregulation of miR‑505‑3p predicts poor bone metastasis‑free survival in prostate cancer. Oncology Reports, 41, 57-66. https://doi.org/10.3892/or.2018.6826
MLA
Tang, Y., Wu, B., Huang, S., Peng, X., Li, X., Huang, X., Zhou, W., Xie, P., He, P."Downregulation of miR‑505‑3p predicts poor bone metastasis‑free survival in prostate cancer". Oncology Reports 41.1 (2019): 57-66.
Chicago
Tang, Y., Wu, B., Huang, S., Peng, X., Li, X., Huang, X., Zhou, W., Xie, P., He, P."Downregulation of miR‑505‑3p predicts poor bone metastasis‑free survival in prostate cancer". Oncology Reports 41, no. 1 (2019): 57-66. https://doi.org/10.3892/or.2018.6826