7‑Difluoromethoxyl‑5,4'‑di‑n‑octylygenistein targets the STAT3 pathway by upregulating microRNA‑152‑3p expression to inhibit self‑renewal and tumor growth in non‑small cell lung carcinoma

Introduction

Non-small cell lung carcinoma (NSCLC), responsible for >80% of all lung cancer cases, is the deadliest form of malignancy worldwide (1). Despite advancements in therapeutic strategies such as surgical resection, chemotherapy, radiotherapy, immunotherapy and combination therapies, each focusing primarily on symptom alleviation, the 5-year overall survival rate of NSCLC remains <20% (2). This is further complicated by the widespread occurrence of chemoresistance and the increased metastatic potential of the disease, which undermine the efficacy of conventional treatments (3). This challenge is, at least in part, attributable to the self-renewal properties of cancer stem cells (4), which are resistant to chemotherapy, rendering traditional treatments less effective. As such, there is an urgent need for innovative therapeutic approaches targeting NSCLC cancer stem cells. Research has intensified efforts to understand self-renewal and tumor growth mechanisms, aiming to identify novel therapeutic targets or develop innovative curative interventions for various cancer types, including NSCLC (4–6). Studies have identified a small subset of tumor cells that, derived from bulk tumors, possess self-renewal and tumor-initiating abilities (7–9). These cells are typically enriched using cell surface markers (CD133, CD44, Sox2 and Oct4) or sphere formation assays in suspension culture (4,5,8,10,11). Notably, the sphere culture assay has proven effective in enriching sphere-forming cells (SFCs) from NSCLC cell lines, and SFCs exhibit stronger self-renewal potential (12,13). There is a critical need to develop effective therapeutic strategies, particularly novel targeted drugs aimed at directly addressing cancer cell self-renewal and tumor growth in NSCLC.

Genistein, an isoflavone found abundantly in soybeans and related products, has exhibited anticancer properties across various malignancies such as retinoblastoma, laryngeal cancer and colorectal cancer (14–16). 7-difluoromethoxyl-5,4′-di-n-octylgenistein (DFOG), a new genistein analog synthesized independently by the Department of Pharmacy, Hunan Normal University (Changsha, China), has been shown to induce apoptosis in ovarian cancer cells, and to inhibit their self-renewal and carcinogenesis (17,18). Despite these promising findings, the exact mechanism through which DFOG suppresses self-renewal and tumor growth in NSCLC cells remains to be fully elucidated.

MicroRNAs (miRNAs/miRs) are evolutionarily conserved, endogenous small noncoding RNAs, typically 19–23 nucleotides in length (19). Despite lacking protein-coding potential, they regulate a wide array of genes post-transcriptionally through complementary binding to mRNAs (20). These molecules are critical in processes such as apoptosis, differentiation, proliferation and metabolism, making them central to cancer development and stemness in cancer cells (21). One such miRNA, miR-152, has been identified as a tumor suppressor and is linked to malignant phenotypes of various types of cancer such as colon cancer, breast cancer, prostate cancer and ovarian cancer (22–25). A recent study has demonstrated that miR-152-3p is involved in the self-renewal and tumor growth of non-small cell lung cancer (26). Additionally, miR-152-3p is associated with tumor invasion, metastasis, drug resistance and proliferation (27,28). However, whether DFOG can inhibit the self-renewal and tumor growth of NSCLC by regulating miR-152-3p remains to be determined.

Persistent activation of STAT3 impacts gene regulation, thereby influencing self-renewal, migration and invasion in cancer cells (29,30). The miR-152/STAT3 axis is associated with poor prognosis in epithelial ovarian cancer (31). A previous study using JSI-124, a specific STAT3 inhibitor, suggested that suppressing STAT3 activation can diminish stem cell-like properties in hepatocellular carcinoma cells (32). However, it remains unclear whether miR-152-3p-mediated STAT3 inactivation can effectively reduce the self-renewal and tumor growth of SFCs derived from NSCLC. Therefore, the present study aimed to examine the hypothesis that reinstating miR-152-3p expression to suppress STAT3 can synergistically enhance the inhibitory effects of DFOG on self-renewal and tumor growth in SFCs derived from NSCLC.

Materials and methods

Cells and sphere cultures

The NCI-H460 and NCI-A549 human NSCLC cell lines were obtained from Shanghai Zhong Qiao Xin Zhou Biotechnology Co., Ltd., and Procell Life Science & Technology Co., Ltd., respectively, while the BEP2D human bronchial epithelial cell line was sourced from Otwo Biotech. All cell lines were authenticated through short tandem repeat profiling and mycoplasma testing. The cells were cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), penicillin (100 U/ml) and streptomycin (100 µg/ml). All cells were maintained in a 5% CO2 incubator at 37°C. The STAT3 inhibitor S3I 201 (97%; cat. no. ab146606; Abcam) was stored at room temperature, and the cells were treated with S3I 201 (10 µM) at 37°C for 24 h before subsequent experiments.

To study sphere formation, H460 and A549 cells were cultured in stem-cell culture medium at a density of 5,000 cells per well in ultra-low attachment 6-well plates until spheres containing >20 cells formed (12,13). Stem-cell culture medium (DMEM/F12; Gibco; Thermo Fisher Scientific, Inc.), supplemented with 2% B27, 1% penicillin/streptomycin, basic fibroblast growth factor (20 ng/ml), epidermal growth factor (20 ng/ml) and insulin (4 µg/ml), was used. The inhibitory effects of DFOG on sphere formation were assessed by incubating SFCs derived from H460 and A549 cells with varying concentrations of DFOG (1, 5 and 10 µM) at 37°C for 72 h. Subsequently, the cells were reseeded at a density of 1,000 cells per well in ultra-low attachment 24-well plates and cultured until spheres reformed in the absence of DFOG. Subsequently, the number and status of spheres were evaluated manually under a light microscope (Leica Microsystems GmbH). The sphere formation rate was calculated using the following formula: Number of spheres/number of cells seeded ×100%. Experiments were performed in triplicate.

Cell viability assessment

Cell viability was assessed using the Cell Counting Kit-8 (CCK-8) assay (Dojindo Laboratories, Inc.). Single-cell suspensions were seeded at 1,000 cells per well in 96-well plates for 24 h and treated with varying concentrations of DFOG (1, 5 and 10 µM) at 37°C. After 72 h, the cells were incubated with 10 µl CCK-8 solution per well for 2 h, and the optical density (OD450) was measured using a microplate reader (BioTek; Agilent Technologies, Inc.).

Reverse transcription-quantitative PCR (RT-qPCR)

The Superscript IV RT kit and SYBR Green fluorophore were purchased from Thermo Fisher Scientific, Inc. The RT reaction conditions were incubation at 37°C for 5 min, 50°C for 15 min and 75°C for 5 min. Total RNA was extracted from H460 cells, A549 cells or SFCs (1×105 cells) using TRIzol® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. For RNA extraction from tissue samples, grinding using a tissue homogenizer (Beyotime Institute of Biotechnology) was first performed. cDNA synthesis was conducted according to the supplier's instructions (Thermo Fisher Scientific, Inc.). The 2−ΔΔCq method (33) was used for qPCR, with U6 as the internal control for miR-152 and GAPDH as the internal control for STAT3. To identify candidate miRNAs affected by DFOG treatment, H460 cells, A549 cells or SFCs were treated with DFOG (5 µM) at 37°C for 24 h, followed by total RNA extraction and cDNA synthesis. PCR amplification was performed using specific primers (Table I), with the following thermocycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 55°C for 30 sec and 70°C for 30 sec. For miRNA quantification, 2 µg total miRNA was transcribed and amplified using the All-in-One™ miRNA qRT-PCR Detection Kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) and the TaqMan MicroRNA Assay (GeneCopoeia, Inc.), with U6 (Sangon Biotech Co., Ltd.) as the reference gene. Data analysis was conducted using the 2−ΔΔCq method. All experiments were conducted in triplicate independently.

Table I. Primer sequences for reverse transcription-quantitative PCR.

Table I.

Primer sequences for reverse transcription-quantitative PCR.

Gene name	Primer sequence (5′-3′)
U6	F: CTCGCTTCGGCAGCACA
	R: AACGCTTCACGAATTTGCGT
STAT3	F: GGGAGAGAGTTACAGGTTGGACAT
	R: AGACGCCATTACAAGTGCCA
GAPDH	F: CGGAGTCAACGGATTTGGTCGTAT
	R: ATCCTTCTCCATGGTGGTGAAGAC
miR-671-5p	F: AGGAAGCCCTGGAGGGGC
	R: CAGTGCAGGGTCCGAGGTAT
miR-148a-3p	F: TCAGTGCACTACAGAACTTTGT
	R: AGTGCAGGGTCCGAGGTAT
miR-340-5p	F: TTATAAAGCAATGAGACTGATT
	R: AGTGCAGGGTCCGAGGTATT
miR-342-3p	F: TCTCACACAGAAATCGCACCC
	R: AGTGCAGGGTCCGAGGTAT
miR-34a-5p	F: TGGCAGTGTCTTAGCTGGTTGT
	R: AGTGCAGGGTCCGAGGTATT
miR-152-3p	F: TCAGTGCATGACAGAACTTGG
	R: TGCAGGGTCCGAGGTAT

[i] AGTGCAGGGTCCGAGGTAT is a universal reverse primer. F, forward; miR, microRNA; R, reverse.

Clonogenic assay

For the colony formation assay, a bottom agar layer was prepared by mixing 1.2% agarose (Invitrogen; Thermo Fisher Scientific, Inc.) with DMEM in equal proportions, and 500 µl of this mixture was added to each well of a 24-well plate. The top agar layer was prepared by mixing H460 cells, A549 cells or SFCs (1,000 cells) with 0.7% agarose and 500 µl of 20% FBS-supplemented DMEM. After 12 h of cell seeding, different concentrations of DFOG (1, 5 and 10 µM) were added according to the needs of each group. The drug was continuously administered at 37°C until the end of the experiment. Images of colony formation were captured under a light microscope (Leica Microsystems GmbH) and colonies were counted manually. More than 20 cells were defined as a colony. The cells were incubated for 14 days at 37°C, and colonies were counted to calculate the colony formation rate per 1,000 cells based on triplicate experiments.

Immunoblot assay

The RIPA protein extraction kit was purchased from Thermo Fisher Scientific, Inc. BCA was used to quantitatively determine the protein concentration. Each lane was loaded with 20 µg of protein. The gel concentration used was 10%. After electrophoresis, protein was transferred to a PVDF membrane. Blocking was performed using 5% skimmed milk at 37°C for 1 h. Membranes were incubated with the primary antibody at 4°C for 6 h, and membranes were incubated with the horseradish peroxidase-conjugated IgG secondary antibody (1:1,000 dilution; cat. no. RGAR011; Proteintech Group, Inc.) at room temperature for 1 h. Antibodies against α-tubulin (1:1,000 dilution; cat. no. 2125; Cell Signaling Technology, Inc.), STAT3 (1:1,000 dilution; cat. no. 12640; Cell Signaling Technology, Inc.), phosphorylated-STAT3 (p-STAT3; 1:2,000 dilution; cat. no. 9145; Cell Signaling Technology, Inc.), CD133 (1:1,000 dilution; cat. no. 64326; Cell Signaling Technology, Inc.), CD44 (1:1,000 dilution; cat. no. 37259; Cell Signaling Technology, Inc.), Oct4 (1:1,000 dilution; cat. no. 2890; Cell Signaling Technology, Inc.) and Sox2 (1:1,000 dilution; cat. no. 3579; Cell Signaling Technology, Inc.) were used as previously described (12). Finally, the chemiluminescent substrate (ECL) was purchased from Beyotime Institute of Biotechnology, and ImageJ 1.37 (National Institutes of Health) was used for gray-scale analysis.

miRNA transfection

MicrON™ miR-152-3p mimic (5′-UCAGUGCAUGACAGAACUUGG-3′) and micrOFF™ miR-152-3p inhibitor (5′-CCAAGUUCUGUCAUGCACUGA-3′), miR-152-3p mimic negative control (5′-UUGUACUACACAAAAGUACUG-3′) and miR-152-3p inhibitor negative control (5′-GGAACUUAGCCACUGUGAAUU-3′), were purchased from Guangzhou RiboBio Co., Ltd., and transfected into SFCs using transfection reagent iboFECT™ CP (Guangzhou RiboBio Co., Ltd.) at a concentration of 50 nM, according to the manufacturer's instructions. The small RNA complexes were incubated with cells for 2 h before the medium was replaced, then the culture was continued at 37°C for 48 h, and cells were used for subsequent experiments.

Luciferase reporter assay

The binding sites of miR-152-3p and STAT3 were predicted using RNAhybrid (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid). For the luciferase reporter assays, SFCs were co-transfected with miR-152-3p or miR-control and the pGL3 luciferase vector (Guangzhou RiboBio Co., Ltd.) containing the firefly luciferase reporter, along with the wild-type (WT) or mutant (MUT) 3′-untranslated region (UTR) sequence of STAT3. After 48 h, luciferase activity was measured using a luciferase assay kit (Promega Corporation), and normalized to Renilla luciferase activity in triplicate experiments.

Plasmid transfection

Transfection was performed using 10 µg nucleic acid with a concentration of 1 µg/µl at 37°C for 48 h, and subsequent experiments were performed 48 h after transfection. For STAT3 overexpression, cells were transfected with pcDNA3.1-Control or pcDNA3.1-STAT3 plasmids obtained from Invitrogen; Thermo Fisher Scientific, Inc., using Lipofectamine™ 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) in Opti-MEM (Gibco; Thermo Fisher Scientific, Inc.), according to the manufacturer's guidelines.

In vivo therapeutic effects in nude mice

A total of 18 female pathogen-free nude BALB/c mice (aged 4–5 weeks; weight, 18–22 g) were sourced from GemPharmatech Co., Ltd., and housed in a specific pathogen-free facility [SYXK (Xiang) 2020-0012] under a standard 12-h light/12-h dark cycle, at 20–26°C, with an atmospheric pressure of 20–50 Pa and a relative humidity of 40–70%, and ad libitum access to regular mouse chow and water. The site of cell injection was the armpit of the upper limb. When the tumor grew to ~100 cm3, the mouse was treated with drug treatment for 21 days. The time interval between the injection of cells and the end of the experiment was 6 weeks, and tumor volume was detected every 2 days until the end of the experiment. The ethical approval (approval no. D2023045) was granted by the Ethics Committee of Hunan Normal University (Changsha, China).

To evaluate the effects of DFOG in the xenograft mouse model, 1×106 SFCs were suspended in PBS and mixed with 100% Matrigel at a 1:1 ratio (BD Biosciences). A 100 µl mixture was subcutaneously injected into each mouse. When the xenograft volume reached ~100 mm3, mice in the control group received 200 µl of 2% DMSO every 2 days, while those in the experimental groups were orally administered DFOG (10 and 50 mg/kg) for 3 weeks every 2 days. Each group consisted of 6 mice. Tumor volume was calculated using the following formula: V (mm3)=(L × W2)/2, where L is the longest diameter and W is the shortest diameter of the xenograft, measured using a Vernier caliper. At the end of the experiment, xenograft-bearing mice were euthanized using CO2 asphyxiation (CO2 replacement rate of 30%), and the xenografts were collected, weighed, and snap-frozen in liquid nitrogen, and tumor tissues were fixed in 4% paraformaldehyde for subsequent H&E staining and immunohistochemistry. Tumor tissues for qPCR analysis were preserved in RNAlater.

For H&E staining, tumor tissues were fixed in 4% paraformaldehyde at 4°C for 24 h, and the slice thickness was 4 µm. Hematoxylin staining was performed for 5 min, followed by eosin staining for 1 min, and these were performed at 25°C. Staining was observed under a light microscope (Leica Microsystems GmbH).

Immunohistochemical staining

Tumor tissues were fixed in 4% paraformaldehyde at 4°C for 24 h. Tissue sections (thickness, 4 µm) from paraffin-embedded and fixed samples were subjected to deparaffinization in citrate buffer. Sections were heated in an oven at 90°C for 20 min, followed by a series of ethanol washes (anhydrous ethanol, 95, 85 and 75% ethanol). Subsequently, the slices underwent three consecutive washes with PBS. After blocking endogenous peroxidase activity with 3% H2O2 and nonspecific binding with 5% goat serum (Beyotime Institute of Biotechnology) for 15 min at 25°C, the sections were incubated overnight at 4°C with the primary antibody against p-STAT3 (1:200 dilution; cat. no. 9145; Cell Signaling Technology, Inc.). As a negative control, PBS was used in place of the primary antibody. The sections were then incubated with horseradish peroxidase-conjugated anti-rabbit IgG antibodies (1:500 dilution; cat. no. RGAR011; Proteintech Group, Inc.) for 20 min at 25°C. Staining was developed using the 3,3′diaminobenzidine substrate (Fuzhou Maixin Biotechnology Development Co., Ltd.). The results were observed and images were captured under a light microscope (Leica Microsystems GmbH). The signal intensity was evaluated as previously described (34), and semi-quantitatively analyzed using ImageJ 1.37.

Statistical analysis

All statistical analyses were performed using GraphPad Prism Software 9 (Dotmatics). Data are presented as the mean ± SD. Comparisons between groups were performed using one-way analysis of variance with Tukey's post hoc test or an unpaired Student's t-test. For in vitro analyses, experiments were performed in triplicate. P<0.05 was considered to indicate a statistically significant difference.

Results

DFOG small-scale miRNAs efficacy screen, and analysis of self-renewal-related stemness of H460-derived SFCs

The effect of DFOG on cell viability was assessed in BEP2D, H460 and A549 cell lines using the CCK-8 assay, following treatment at various concentrations. A reduction in cell viability was observed in H460 and A549 cells compared with the control group (0 µM), yielding an IC50 of ~10 µM (Fig. 1A). Noncytotoxic concentrations of DFOG (1, 5 and 10 µM) were selected for subsequent experiments.

Figure 1. mRNA expression analysis by RT-qPCR, and assessment of self-renewal and tumor growth in H460-derived SFCs. (A) BEP2D, H460 and A549 cells were treated with DFOG (0–20 µM) for 48 h, and cell viability was assessed using a Cell Counting Kit-8 assay. H460 and A549 cells were treated with DFOG (5 µM) for 24 h. RT-qPCR was used to evaluate the effects of DFOG (5 µM) on tumor-suppressive miRNAs, including miR-671-5p, miR-148a-3p, miR-340-5p, miR-342-3p, miR-34a-5p and miR-152-3p in (B) H460 and (C) A549 cells. (D) Comparison of miR-152-3p expression between H460 cells and H460-derived SFCs. (E) STAT3 mRNA levels and (F) p-STAT3 protein levels. Rates of (G) sphere formation and (H) colony formation (scale bar, 100 µm). Western blot analysis of (I) CD44 and CD133 expression, as well as (J) Oct4 and Sox2 expression. *P<0.05, **P<0.01 (n=3). DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein; miR/miRNA, microRNA; p-, phosphorylated; RT-qPCR, reverse transcription-quantitative PCR; SFC, sphere-forming cell.

Natural phytochemicals have been reported to modulate miRNA-mediated suppression of stemness characteristics in hepatocellular carcinoma cells (34). Therefore, it was detected whether tumor suppressor miRNAs in NSCLC cells, including miR-671-5p (31), miR-148a-3p (35), miR-340-5p (36), miR-342-3p (37), miR-34a-5p (38) and miR-152-3p (39), are regulated by DFOG (5 µM). DFOG treatment (5 µM) led to significant upregulation of miR-152-3p in both H460 and A549 cell lines, with the most notable increase among the tested miRNAs (Fig. 1B and C).

To examine the role of miR-152-3p and STAT3 expression in self-renewal and tumor growth in NSCLC, miR-152-3p expression was compared between H460 cells and H460-derived SFCs. The results revealed lower miR-152-3p levels in SFCs compared with H460 cells (Fig. 1D). Additionally, SFCs exhibited elevated STAT3 mRNA expression and p-STAT3 levels (Fig. 1E and F).

The sphere formation and colony formation were significantly increased in H460-derived SFCs compared with H460 cells (Fig. 1G and H). Furthermore, the expression levels of stem cell-associated markers, including CD133, CD44, Oct4 and Sox2, were elevated in H460-derived SFCs compared with H460 cells (Fig. 1I and J).

DFOG inhibits self-renewal-related stemness possibly by upregulating miR-152-3p and inhibiting p-STAT3 in H460-derived SFCs

DFOG treatment at noncytotoxic concentrations (1, 5 and 10 µM) induced a dose-dependent increase in miR-152-3p expression in H460-derived SFCs (Fig. 2A). miR-152-3p has been recognized for its role in suppressing carcinogenesis by inhibiting carcinogenic transcription factors and signaling pathways in colon cancer, breast cancer, prostate cancer and ovarian cancer (22–25). Subsequently, the effects of DFOG on STAT3 mRNA expression and p-STAT3 protein levels were assessed using RT-qPCR and western blotting. DFOG treatment resulted in a decrease in STAT3 mRNA expression (Fig. 2B) and a significant reduction in p-STAT3 protein levels (Fig. 2C).

Figure 2. DFOG induces miR-152-3p expression, and inhibits self-renewal and tumor growth in H460-derived SFCs. At the indicated concentrations, DFOG (A) upregulated miR-152-3p expression, and (B) decreased STAT3 mRNA expression and (C) p-STAT3 protein levels in H460-derived SFCs. (D) Sphere formation and (E) colony formation were reduced (scale bar, 100 µm). Western blot analysis showed downregulation of (F) CD44 and CD133 expression, as well as (G) Oct4 and Sox2 expression. *P<0.05, **P<0.01,***P<0.001, ****P<0.0001 (n=3). (H) (1) Images of tumor tissue; (2) volume quantification; (3) weight quantification; (4) H&E staining and immunohistochemical staining using an anti-p-STAT3 antibody (scale bar, 50 µm). (5) Quantification of p-STAT3 protein levels and (6) miR-152-3p levels in xenograft tumors of nude mice bearing H460-derived SFCs treated with DFOG at the indicated doses. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein; miR, microRNA; p-, phosphorylated; SFC, sphere-forming cell.

To evaluate the effect of DFOG on self-renewal and tumor growth in NSCLC, sphere formation and colony formation assays were performed. DFOG treatment led to reduced sphere (Fig. 2D) and colony (Fig. 2E) formation rates in H460-derived SFCs. Additionally, the protein levels of the stem cell markers CD133 and CD44 were significantly decreased (Fig. 2F). Consistent with these results, DFOG treatment substantially decreased the protein levels of Oct4 and Sox2 (Fig. 2G) in H460-derived SFCs.

For in vivo assessment, DFOG was orally administered to mice with H460-derived SFC xenograft tumors, with DMSO administered in the control group. The volumes of xenografts are shown in Table II and the maximum diameter is shown in Table III. As shown in Fig. 2H-1, −2 and −3, DFOG significantly suppressed the growth of xenograft tumors. Mechanistically, DFOG exerted a dual effect by reducing the p-STAT3 levels (Fig. 2H-4 and −5) and enhancing miR-152-3p expression (Fig. 2H-6). These results suggested that DFOG inhibited the self-renewal and tumor growth of H460-derived SFCs both in vitro and in vivo, likely through modulation of miR-152-3p and its target, STAT3.

Table II. Maximum volume of the xenograft (mm3) in each mouse across all experimental groups.

Table II.

Maximum volume of the xenograft (mm3) in each mouse across all experimental groups.

DFOG (0 mg/kg)	DFOG (10 mg/kg)	DFOG (50 mg/kg)
953.06	408.32	166.08
884.01	367.26	105.36
877.36	316.19	115.17
896.21	402.42	62.97
806.09	309.19	88.68
931.01	207.37	60.69

[i] DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein.

Table III. Maximum diameter measured of the xenograft (mm) in each mouse across all experimental groups.

Table III.

Maximum diameter measured of the xenograft (mm) in each mouse across all experimental groups.

DFOG (0 mg/kg)	DFOG (10 mg/kg)	DFOG (50 mg/kg)
14.56	11.23	6.32
13.09	10.21	5.21
13.32	9.68	5.69
12.25	8.99	4.62
14.32	8.32	5.17
14.87	7.96	4.16

[i] DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein.

miR-152-3p mimic increases DFOG-induced suppression of p-STAT3 and self-renewal

To further elucidate the role of miR-152-3p regulation in DFOG-mediated suppression of self-renewal, H460-derived SFCs were transfected with a miR-152-3p mimic. As shown in Fig. 3A, the miR-152-3p mimic, in combination with DFOG (5 µM), elevated miR-152-3p expression. Furthermore, both DFOG (5 µM) and the miR-152-3p mimic synergistically reduced STAT3 mRNA levels and p-STAT3 protein levels (Fig. 3B and C). Notably, miR-152-3p overexpression enhanced the inhibitory effects of DFOG on self-renewal, leading to a reduction in sphere (Fig. 3D) and colony (Fig. 3E) formation rates compared with the control group (0 µM). The combined action of miR-152-3p and DFOG resulted in decreased expression of the stemness markers CD133 and CD44 (Fig. 3F), as well as the pluripotent factors Oct4 and Sox2 (Fig. 3G). These results suggested that DFOG elevated miR-152-3p expression, which in turn suppressed STAT3 transcription and activity, thereby inhibiting self-renewal in H460-derived SFCs.

Figure 3. miR-152-3p mimic enhances DFOG-induced downregulation of p-STAT3 levels and inhibits self-renewal in H460-derived SFCs. Expression levels of (A) miR-152-3p and (B) STAT3 mRNA, and (C) p-STAT3 protein levels. (D) Spheres and (E) colonies formed were quantified (scale bar, 100 µm). Western blot analysis of (F) CD44 and CD133, as well as (G) Oct4 and Sox2 expression in H460-derived SFCs transfected with miR-152-3p mimic and/or treated with DFOG (5 µM). *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 (n=3). DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein; miR, microRNA; NC, negative control; p-, phosphorylated; SFC, sphere-forming cell.

miR-152-3p inhibitor antagonizes DFOG-induced suppression of p-STAT3 expression and self-renewal

To further validate the role of miR-152-3p regulation in DFOG-induced suppression of self-renewal, H460-derived SFCs were transfected with miR-152-3p inhibitor or miR-inhibitor-NC, followed by treatment with or without DFOG (5 µM). As shown in Fig. 4A, miR-152-3p inhibitor transfection effectively reversed the DFOG-induced increase in miR-152-3p expression. Additionally, miR-152-3p inhibitor counteracted the reduction in STAT3 mRNA expression and p-STAT3 protein levels induced by DFOG (Fig. 4B and C). Notably, miR-152-3p inhibitor mitigated the inhibitory effects of DFOG on self-renewal, as evidenced by an increase in sphere (Fig. 4D) and colony formation rates (Fig. 4E). miR-152-3p inhibitor transfection also increased the expression of the stemness-associated markers CD133 and CD44 (Fig. 4F), and the pluripotent factors Oct4 and Sox2 (Fig. 4G), reversing the suppressive effect of DFOG. These results suggested that inhibiting the expression of miR-152-3p could counteract the inhibition of p-STAT3 activity and self-renewal induced by DFOG treatment in H460-derived SFCs.

Figure 4. miR-152-3p inhibitor antagonizes DFOG-induced suppression of p-STAT3 levels and self-renewal in H460-derived SFCs. Expression levels of (A) miR-152-3p and (B) STAT3 mRNA, and (C) p-STAT3 protein levels. (D) Spheres and (E) colonies formed were quantified (scale bar, 100 µm). Western blot analysis of (F) CD44 and CD133, as well as (G) Oct4 and Sox2 expression in H460-derived SFCs transfected with miR-152-3p inhibitor and/or treated with DFOG (5 µM). *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 (n=3). DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein; miR, microRNA; NC, negative control; p-, phosphorylated; SFC, sphere-forming cell.

STAT3 inhibitor increases DFOG-induced self-renewal

To investigate whether the DFOG-induced suppression of self-renewal was linked to the regulation of STAT3 mRNA expression and activity, H460-derived SFCs were treated with S3I 201, a specific STAT3 inhibitor. As shown in Fig. 5A, S3I 201 (10 µM) treatment did not affect the DFOG-induced elevation of miR-152-3p expression. However, as illustrated in Fig. 5B and C, S3I 201 (10 µM), in combination with DFOG (5 µM), effectively decreased STAT3 mRNA expression and p-STAT3 protein levels. Inhibition of STAT3 activity enhanced the suppressive effects of DFOG on self-renewal compared with S3I 201 (10 µM) or DFOG (5 µM) treatment alone, leading to a significant reduction in sphere (Fig. 5D) and colony (Fig. 5E) formation rates. Furthermore, the combination of S3I 201 and DFOG resulted in decreased protein levels of the stemness markers CD133 and CD44 (Fig. 5F), as well as the pluripotent factors Oct4 and Sox2 (Fig. 5G). These results highlighted that modulation of STAT3 mRNA expression and activity by DFOG contributed to the suppression of self-renewal in H460-derived SFCs.

Figure 5. STAT3 inhibitor enhances DFOG-induced suppression of self-renewal in H460-derived SFCs. Expression levels of (A) miR-152-3p and (B) STAT3 mRNA, and (C) p-STAT3 protein levels are shown. (D) Spheres and (E) colonies formed were quantified (scale bar, 100 µm). Western blot analysis of (F) CD44 and CD133, as well as (G) Oct4 and Sox2 expression in H460-derived SFCs treated with S3I 201 (10 µM) and/or DFOG (5 µM). *P<0.05, **P<0.01 and ***P<0.001 (n=3). DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein; miR, microRNA; p-, phosphorylated; SFC, sphere-forming cell.

STAT3 overexpression does not significantly affect miR-152-3p expression

To verify the upstream and downstream relationship between miR-152-3p and STAT3, H460-derived SFCs were transfected with STAT3 cDNA and pcDNA3.1, followed by treatment with or without DFOG (5 µM). As shown in Fig. 6A, transfection with STAT3 cDNA did not affect the miR-152-3p expression induced by DFOG. However, STAT3 cDNA transfection significantly counteracted the reduction in STAT3 mRNA and protein levels caused by DFOG (Fig. 6B and C).

Figure 6. Effect of STAT3 overexpression and DFOG co-treatment on miR-152-3p expression. Expression levels of (A) miR-152-3p and (B) STAT3 mRNA, and (C) STAT3 protein levels in H460-derived sphere-forming cells transfected with pcDNA-STAT3 and/or treated with DFOG (5 µM). *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 (n=3). DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein; miR, microRNA.

miR-152-3p mimic suppresses the transcriptional activity of STAT3

To determine whether miR-152-3p directly targets STAT3, a luciferase reporter assay was conducted in H460-derived SFCs to identify the specific binding site of the miR-152-3p seed sequence on the 3′-UTR of STAT3 mRNA. RNAhybrid predicted binding sites for miR-152-3p and STAT3 (Fig. 7A). As shown in Fig. 7B, luciferase activity was reduced in cells co-transfected with the miR-152-3p mimic and STAT3-3′-UTR-WT, while no change in luciferase activity was observed following co-transfection with STAT3-3′-UTR-MUT. Additionally, the luciferase activity was further decreased in NSCLC cells co-transfected with miR-152-3p mimic and STAT3-3′-UTR-WT after DFOG (5 µM) treatment, compared with cells treated with miR-152-3p mimic or DFOG alone (Fig. 7C). These results demonstrated that DFOG inhibited self-renewal by upregulating miR-152-3p, which directly suppressed STAT3 expression by disrupting its transcriptional activity (Fig. 7D).

Figure 7. STAT3 is a direct target of miR-152-3p (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid). (A) Representation of the predicted miR-152-3p binding site in the 3′-UTR of STAT3 mRNA. (B) Luciferase activity of 3′-UTR-WT and 3′-UTR-MUT STAT3 3′-UTR reporters in H460 cells after transfection with the miR-152-3p mimic or miR-mimic-Cont. (C) Luciferase activity of 3′-UTR-WT STAT3 3′-UTR in H460 cells transfected with the miR-152-3p mimic and/or treated with DFOG (5 µM). *P<0.05, **P<0.01 (n=3). (D) Mechanism of action of DFOG regulating the miR-152-3p/STAT3 axis and suppressing self-renewal in non-small cell lung carcinoma. 3′-UTR, 3′-untranslated region; Cont, control; DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein; miR, microRNA; MUT, mutant; p-, phosphorylated; WT, wild-type.

DFOG halts self-renewal in A549-derived SFCs

The inhibitory effect of DFOG on self-renewal was also assessed in A549-derived SFCs. Consistently, DFOG dose-dependently increased miR-152-3p expression, and downregulated STAT3 mRNA expression and p-STAT3 protein levels in A549 cells (Fig. 8A-C). Additionally, sphere formation (Fig. 8D) and colony formation (Fig. 8E) rates, as well as the expression of the stem cell markers CD44 and CD133 (Fig. 8F), and the pluripotent factors Oct4 and Sox2 (Fig. 8G), were all suppressed. These results indicated that DFOG-induced inhibition of self-renewal in A549-derived SFCs was mediated through the upregulation of miR-152-3p, and the suppression of STAT3 mRNA and activity.

Figure 8. DFOG induces miR-152-3p expression, and inhibits STAT3 activation and self-renewal in A549-derived SFCs. At the indicated concentrations, DFOG (A) upregulated miR-152-3p expression, and decreased (B) STAT3 mRNA expression and (C) p-STAT3 protein levels in A549-derived SFCs. (D) Spheres and (E) colonies formed were quantified (scale bar, 100 µm). Western blot analysis of (F) CD44 and CD133, as well as (G) Oct4 and Sox2 expression in A549-derived SFCs. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 (n=3). DFOG, 7-difluoromethoxyl-5,4′-di-n-octylygenistein; miR, microRNA; p-, phosphorylated; SFC, sphere-forming cell.

Discussion

The present study provided evidence that DFOG inhibited self-renewal and tumor growth in NSCLC cells by upregulating miR-152-3p, thereby suppressing the expression and activity of STAT3. These findings have substantial implications for the potential use of DFOG as a therapeutic strategy for human NSCLC, particularly targeting cancer cells with self-renewal-related stemness properties.

Dysregulated miRNA expression contributes to the progression of breast cancer, liver cancer and lung cancer (31,35–37,40,41). Reduced miR-152-3p expression has been linked to multiple aspects of malignancy, including progression, proliferation, invasion and metastasis, in colon cancer, breast cancer, prostate cancer and ovarian cancer (22–25). However, further investigation is required, particularly in lung cancer. Our results demonstrated that DFOG upregulated miR-152-3p, miR-34a-5p and miR-148a-3p, with miR-152-3p exhibiting the most pronounced increase. To the best of our knowledge, the present study was the first to report that DFOG enhanced self-renewal and tumor growth traits in NSCLC cells by elevating miR-152-3p expression, thus revealing a novel mechanism through which DFOG exerts its inhibitory effects on self-renewal and tumor growth. Furthermore, the molecular mechanisms underlying DFOG-induced suppression of tumor cells involve multiple signaling pathways, including the inactivation of FoxM1 and NF-κB (17,18). One study indicated that the expression of miR-152 and STAT3 was associated with poor prognosis in epithelial ovarian cancer (31). STAT3, an oncogenic transcription factor mediating signaling from the cell surface to the nucleus, is frequently upregulated in various malignancies, including NSCLC (29,30). Notably, targeting STAT3 has been shown to reduce tumor stem cell properties (30,41,42). In the present study, a luciferase reporter assay identified STAT3 as a direct target of miR-152-3p. This finding was further corroborated by the reduced transcription of STAT3 following combined treatment with DFOG and a miR-152-3p mimic in H460-derived SFCs. The present results demonstrated that DFOG-induced upregulation of miR-152-3p inhibited self-renewal and tumor growth by downregulating STAT3 expression at the mRNA level and impairing its activity, as evidenced by decreased p-STAT3 protein levels in H460-derived SFCs. Overexpression of STAT3 reversed this effect, highlighting the interconnection among DFOG, miR-152-3p and STAT3. Collectively, these findings suggested that the inhibitory effects of DFOG on self-renewal and tumor growth were mediated through miR-152-3p upregulation and STAT3 downregulation, underscoring its potential as a preventive and therapeutic agent for NSCLC, particularly in targeting self-renewing tumor cells.

In conclusion, the present study elucidated the mechanism by which DFOG targeted STAT3 through miR-152-3p upregulation, effectively suppressing self-renewal and tumor growth in NSCLC. Therefore, DFOG may be a promising candidate for novel preventive and therapeutic interventions for NSCLC in humans.

Acknowledgements

Not applicable.

Funding

The present study was funded by the Science and Technology Innovation Leading Academics of National High-level Personnel of Special Support Program from Ministry of Science and Technology, P.R. China (grant no. GKFZ-2018-29), Department of Science and Technology of Guizhou Province [grant no. QKHJC-ZK(2022)-YB-666], and the Natural Science Foundation of Hunan Province (grant no. 2021JJ30462).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

QY, XL and XC conducted the experiments, contributed to data collection and drafted the manuscript. JX and JZ performed the data analysis and contributed to the study design. XL, XC and JX provided resources. JZ and QY confirm the authenticity of all the raw data. All authors have read and approved the final version of the manuscript.

Ethics approval and consent to participate

All animal studies were approved (approval no. D2023045) by the Ethics Committee of Hunan Normal University (Changsha, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

References