Introduction
Rheumatoid arthritis (RA) is a chronic systemic
autoimmune disease characterized by persistent synovial
inflammation and progressive joint destruction. The disease results
from a complex interaction between genetic susceptibility and
environmental triggers that collectively contribute to immune
dysregulation and autoantibody production. Accumulating evidence
indicates that both genetic predisposition and environmental
exposures play critical roles in initiating and perpetuating the
autoimmune response in RA (1).
Among the genetic factors involved in RA, the
strongest association with susceptibility to RA involves specific
alleles of the HLA-DRB1 gene, particularly those carrying the
so-called shared epitope (SE) motif. These alleles encode a
conserved amino acid sequence within the peptide-binding groove of
the major histocompatibility complex class II molecule, enhancing
the presentation of modified self-peptides to autoreactive
T-lymphocytes (2). Structural and
molecular studies have demonstrated that SE-positive HLA molecules
preferentially bind citrullinated peptides, thereby promoting
autoreactive immune responses and facilitating the development of
autoantibodies characteristic of RA. This mechanism represents a
key immunogenetic pathway linking genetic susceptibility with
adaptive immune activation in the pathogenesis of RA (3,4).
Although the condition can appear at any age, the peak age of onset
is in the sixth decade of life, and its prevalence is ~3-fold
higher in women than in men (5).
Exposure to environmental pollutants, particularly
cigarette smoke, markedly amplifies the risk conferred by the SE.
Smoking increases the degree of protein citrullination in pulmonary
tissues by upregulating peptidyl arginine deiminase 2 enzyme
expression. The aryl hydrocarbon receptor (AHR) has been detected
in the peripheral blood mononuclear cells of patients with RA who
are smokers. The activation of AHR by smoking exacerbates the
severity of arthritis and promotes T-cell differentiation, thereby
affecting both humoral and cellular immune responses. Notably,
smoking is strongly associated with the development of RA in
individuals carrying HLA-SE susceptibility alleles (6). Additionally, smoking may influence
immune responses to citrullinated enolase in genetically
predisposed individuals (7).
Autoantibodies represent another hallmark of RA (8). Although not entirely
disease-specific, the most recognized autoantibodies include
rheumatoid factor (RF), which targets the Fc portion of
immunoglobulin G (IgG); RA is commonly diagnosed through the
detection of RF, particularly the IgM isotype (9). By contrast, anti-cyclic citrullinated
peptide (ACCP) antibodies are highly specific serological and can
be detected prior to the clinical onset of the disease (10). These antibodies are also considered
reliable predictors of the progression of RA (11,12).
Recent clinical and molecular evidence suggests that the combined
presence of SE alleles, anti-citrullinated protein antibodies and
exposure to smoke is associated with more severe disease
manifestations, including a higher inflammatory activity and
greater structural joint damage. This interaction indicates that
environmental triggers may potentiate genetic susceptibility by
enhancing autoantigen presentation and promoting autoreactive
immune responses, thereby accelerating disease progression in
susceptible individuals (13).
However, despite the well-established role of
HLA-DRB1*04 and smoking in the pathogenesis of RA, data regarding
this interaction within the Iraqi population remain limited.
Therefore, the present study aimed to investigate the association
between RA and HLA-DRB1*04 (SE) in smokers and non-smokers, as well
as to evaluate the association between disease severity and the
combined effects of these risk factors.
Patients and methods
Study participants
The present study employed a case-control design and
included 100 patients with RA, of whom 50% were smokers, diagnosed
according to the criteria of the American College of Rheumatology
(14). The patient cohort
comprised 25 males and 75 females, with an age range of 20-70
years. Cases were recruited from the Rheumatology Consultation
Clinic at Baghdad Teaching Hospital/Medical City, Baghdad,
Iraq.
The control group consisted of 50 healthy
individuals confirmed by a clinical examination and laboratory
investigations, with smokers representing 50% of the group.
Patients with comorbidities, other connective tissue diseases,
spondylitis, malignancies or pregnancy were excluded from the
study.
A total of 75 patients were receiving therapy with
methotrexate and enbrel. The study protocol was approved by the
Scientific Ethics Committee of the College of Science, University
of Baghdad, as part of a PhD research plan. Informed consent was
obtained from all participants, both verbally and in writing, prior
to enrollment in the study.
Blood sample collection was conducted from early
November, 2023 to the end of March, 2024. Laboratory diagnostic
investigations were performed using enzyme-linked immunosorbent
assay (ELISA) to measure serum RF levels (Rheumatoid Factor Screen,
quant. 96; cat. no. R97422, Dialab GmbH; positive result >25
U/ml) and ACCP antibodies (cat. no. 0323/VER-03, Qualisa; positive
result, >25 U/ml). Disease Activity Score-28 (DAS-28) values
were assessed by a specialist physician (Rheumatology and medical
rehabilitation) and were used to evaluate the clinical severity of
the disease (15).
Molecular analysis
Total RNA was extracted from the peripheral blood
samples obtained from the patients with RA and the healthy controls
using the TRIzol™ reagent extraction kit (cat. no.
ER501-01-01, TransGen Biotech) following the manufacturer's
protocol. Complementary DNA (cDNA) was synthesized from total mRNA
using the EasyScript One-Step gDNA Removal and cDNA Synthesis
SuperMix kit (cat. no. AE311-04, TransGen Biotech). The reverse
transcription reaction was performed in a final volume of 20 µl
under the following thermocycler conditions: One cycle of primer
annealing at 25˚C for 10 min, reverse transcription at 42˚C for 15
min, and reverse transcriptase inactivation at 85˚C for 5 sec.
Reverse transcription-quantitative polymerase chain reaction
(RT-qPCR) was performed using gene-specific primers for HLA-DRB1
gene (forward, ACAACTACGGGGTTGTGGAG; and reverse,
CGTTCAGGAACCACCTGACT). GAPDH was used as the housekeeping gene
(forward, GAAATCCCATCACCATCTTCCAGG; reverse, GAGCCCCAGCCTTCTCCATG).
Each reaction was carried out in a final volume of 20 µl containing
a cDNA template, primer, SYBR-Green Master Mix and nuclease-free
water. Thermal cycling conditions included one cycle of initial
denaturation at 94˚C for 10 min, followed by 45 cycles of
denaturation at 94˚C for 20 sec and annealing at 60˚C for 30 sec. A
final melting-curve stage was conducted at 55˚C for 20 min.
Melting-curve analysis was performed to confirm amplification
specificity. Relative gene expression levels were calculated using
the folding method (2-∆∆Cq) with normalization to the
housekeeping gene (16).
For HLA-DRB1*04 typing, a specific PCR technique was
performed using allele-specific primers for HLA-DRB1*04, following
the protocol described in the study by Parasannanavar et al
(17), including a reverse primer
(TCTCGGTAAGTCTGTGCCTT) and two forward primers (forward 1,
GCTACGTGGACGACACGCT; forward 2, CTCGGTCAGTCTGTGCCTT); HGH was used
as the control primer (forward, TGCCTTCCCAACCATTCCCTTA; reverse,
CCACTCACGGATTTCTGTTGTGTTTC). This method was selected due to its
high sensitivity and specificity (100%) in identifying
theHLA-DRB1*04 allele, as validated against commercial PCR-SSOP
kits in the source (14). To
ensure this high level of accuracy and specificity in the clinical
samples, the present study strictly adhered to the optimized
concentrations and thermal cycling parameters, particularly the
annealing temperature of 65˚C, as described in the original
protocol. The specificity of the results was further confirmed by
electrophoresis, demonstrating distinct target bands without
non-specific amplification, as presented in Fig. 1. Genomic DNA was extracted from
peripheral blood leukocytes (EDTA-anticoagulated samples) using the
AddPrep Genomic DNA Extraction kit (cat. no. 100-002, Biotech
Ltd.). PCR amplification was performed in a total reaction volume
of 25 µl containing extracted DNA, primers and PCR premix.
Amplification was carried out u sing a G-Storm thermal cycler (Gene
Technologies Ltd.) under the following conditions: An initial
denaturation at 94˚C for 5 min; 30 cycles of denaturation at 94˚C
for 1 min, annealing at 65˚C for 2 min, and extension at 72˚C for 1
min; followed by a final extension at 72˚C for 10 min. The
amplified PCR products (5 µl) and a 100 bp DNA ladder (molecular
weight marker) were separated by electrophoresis on a 2% agarose
gel (Promega Corporation) stained with ethidium bromide
(MilliporeSigma) for 20 min at room temperature.
Statistical analysis
Statistical analysis was performed using SPSS
software (version 20; IBM Corp.). Continuous variables with normal
distribution are expressed as the mean ± standard deviation (SD). A
one-way analysis of variance (ANOVA) and Tukey's post hoc test were
performed to compare the mean levels of gene expression,
autoantibodies and disease activity score across multiple patient
groups and controls. A P-value <0.05 was considered to indicate
a statistically significant difference, while a P-value <0.01
was considered to indicate a highly significant difference
(18).
Results
Baseline characteristic of patients
and controls
The general and clinical findings of 100 patients
with RA estimated according to the American College of Rheumatology
(ACR) criteria are presented in Table
I. The mean age of the patients with RA was 53.34±12.23 years,
and the mean age of the healthy controls was 43.06±10.78 years; the
mean disease duration was 4.3±0.42 years and the mean disease
activity (DAS-28) was 4.1±0.8.
 | Table IBaseline characteristics of patients
with RA and the controls. |
Table I
Baseline characteristics of patients
with RA and the controls.
| Parameters, mean ±
SD, or % | Patients (n=100) | Control (n=50) |
|---|
| Age, years | 53.34±2.23 | 43.06±10.78 |
| Sex
(male/female) | 25/75 | 20/30 |
| Duration of RA
(years) | 4.3±0.42 | - |
| Family history
(yes/no) | 19/81 | - |
| DAS-28 | 4.1±0.8 | - |
| DAS-28
(mild/moderate/severe) | (10/66/24) | - |
| Smoking
(yes/no) | 50/50 | 25/25 |
| Laboratory
parameters | | |
|
RF
positivity, % | 79 | 0 |
|
ACCP
positivity, % | 87 | 0 |
HLA-DRB1 gene expression percentages
in the study groups
Gene expression analyses revealed different levels
of the HLA-DRB1 gene, ranging from 0.72-18.26 in patients and
0.21-1.98 in the controls. Accordingly, the results revealed the
positivity percentage of the HLA-DRB1 gene as 64% in the patients
and 16% in the controls (Table
II).
| Table IIPercentage, range and mean of
HLA-DRB1 gene expression between patients and controls. |
Table II
Percentage, range and mean of
HLA-DRB1 gene expression between patients and controls.
| Groups | No. of
participants | Gene expression
(%) | Range of the
HLA-DRB1 gene (fold) | Mean ± SD | P-value |
|---|
| Patients | 100 | 64 | 0.72-18.26 | 1.51±0.59 | 0.02a |
| Controls | 50 | 16 | 0.21-1.98 | 1.13±0.22 | |
HLA-DRB1*04 allele percentages in the
study groups
Positive HLA-DRB1*04allele was recorded in 19
patients who were smokers, and 13 patients who were non-smokers
(total, 32% of 100 patients with RA), while the healthy controls
recorded 3 patients positive for the HLA-DRB1*04 allele in smokers
only (total, 6%) (Tables III and
IV).
| Table IIIAssociation of the HLA-DRB1*04 (SE)
allele with gene expression and autoantibody in patients with RA
who were smokers and the controls. |
Table III
Association of the HLA-DRB1*04 (SE)
allele with gene expression and autoantibody in patients with RA
who were smokers and the controls.
| | | Mean ± SD |
|---|
| Smokers group;
patients (n=50); controls (n=25) | HLA-DRB1*04
allele | Gene expression
(fold) | ACCP (U/ml) | RF (U/ml) |
|---|
| Patients | +ve | 19 | 4.46±4.20 | 77.54±24.6 | 138.48±140.10 |
| Controls | +ve | 3 | 1.20±0.00 | 24.40±0.86 | 24.83±0.15 |
| P-value | | | 0.001a | 0.001a | 0.001a |
| Patients | -ve | 31 | 1.95±1.35 | 63.04±22.90 | 76.12±86.60 |
| Controls | -ve | 22 | 0.75±0.00 | 7.60±1.70 | 17.20±4.30 |
| P-value | | | 0.001a | 0.001a | 0.001a |
| Table IVAssociation of the HLA-DRB1*04 (SE)
allele with gene expression and autoantibody in patients with RA
who were non-smokers and the controls. |
Table IV
Association of the HLA-DRB1*04 (SE)
allele with gene expression and autoantibody in patients with RA
who were non-smokers and the controls.
| | | Mean ± SD |
|---|
| Smokers group;
patients (n=50); controls (n=25) | HLA-DRB1*04
allele | Gene expression
(fold) | ACCP (U/ml) | RF (U/ml) |
|---|
| Patients | +ve | 13 | 1.75±0.82 | 65.71±36.22 | 85.43±124.1 |
| Controls | -ve | 25 | 0.4±0.0 | 8.28±3.98 | 10.18±5.86 |
| P-value | | | 0.001a | 0.001a | 0.001a |
| Patients | -ve | 37 | 1.43±1.11 | 58.32±20.2 | 44.39±24.4 |
| Control | -ve | 25 | 0.4±0.0 | 8.28±3.98 | 10.18±5.86 |
| P-value | | | 0.001a | 0.001a | 0.001a |
Link between the HLA-DRB1*04 allele
and the parameters tested
The results demonstrated a significant association
between the presence of the HLA-DRB1*04 allele, and increased
levels of HLA-DRB1gene expression, and ACCP and RF levels in
patients with RA compared with the controls. Among the smokers, the
HLA-DRB1*04-positive patients exhibited significantly higher gene
expression levels (4.46±4.2 vs. 1.2±0.0 fold), ACCP levels
(77.54±24.6 vs. 24.4±0.86 U/ml) and RF levels (138.48±140.1 vs.
24.83±0.15 U/ml) compared with theHLA-DRB1*04-positive controls
(P=0.001), as shown in Table III
and Fig. 2.
Similarly, the HLA-DRB1*04-negative patients who
were smokers exhibited significantly higher gene expression levels
(1.95±1.35 vs. 0.75±0.5 fold), ACCP levels (63.04±22.9 vs. 7.6±1.7
U/ml) and RF levels (76.12±86.6 vs. 17.2±4.3 U/ml) compared with
the controls (P=0.001), as demonstrated in Table III and Fig. 2.
HLA-DRB1*04-positive patients who were non-smokers
exhibited significantly higher Gene expression levels (1.75±0.82
vs. 0.4±0.0 fold), anti-CCP levels (65.71±36.22 vs. 8.28±3.98
U/ml), and RF levels (85.43±124.1 vs. 10.18±5.86 U/ml) compared
with controls, (P=0.001), as shown in Table IV and Fig. 3.
Likewise, in the HLA-DRB1*04-negative non-smoker
patients exhibited significantly higher gene expression levels
(1.43±1.11 vs. 0.4±0.0 fold), ACCP levels (58.32±20.2 vs. 8.2±3.9
U/ml) and RF levels (44.39±24.4 vs. 10.1±5.8 U/ml) compared with
the controls (P=0.001), as demonstrated in Table IV and Fig. 3.
HLA-DRB1*04 allele-positive allele in
patients who were smokers and non-smokers
As presented in Table
V and Fig. 4, patients with RA
carrying the HLA-DRB1*04 allele who were smokers exhibited
significantly higher HLA-DRB1 gene expression levels (4.46±4.2 vs.
1.75±0.82-fold, P=0.02), ACCP levels (77.54±24.6 vs. 65.71±36.22
U/ml, P=0.04) and RF levels (138.48±140.1 vs. 85.43±124.1 U/ml,
P=0.01) compared with non-smokers.
| Table VPositive HLA-DRB1*04 allele in the
patient group in relation to gene expression and
autoantibodies. |
Table V
Positive HLA-DRB1*04 allele in the
patient group in relation to gene expression and
autoantibodies.
| | | Mean ± SD |
|---|
| Patients with
positive HLA-DRB1*04 allele | n=32 | Gene expression
(fold) | ACCP (U/ml) | RF (U/ml) |
|---|
| Smokers | 19 | 4.46±4.2 | 77.54±24.6 | 138.48±140.1 |
| Non-smokers | 13 | 1.75±0.82 | 65.71±36.22 | 85.43±124.1 |
| P-value | | 0.02a | 0.04a | 0.01a |
HLA-DRB1*04 allele-negative allele in
patients who were smokers and non-smokers
The effects of cigarette smoke on the levels of
HLA-DRB1 gene expression, and ACCP and RF levels in HLA-DRB1*04
allele-negative patients are demonstrated in Table VI and Fig. 5. The levels of the three parameters
were significantly higher in the smokers than in the non-smokers
(HLA-DRB1 gene: 1.95±1.2 vs. 1.43±1.1 fold, P=0.05; ACCP:
63.04±22.9 vs. 58.32±20.2 U/ml, P=0.05; and RF, 76.12±86.6 vs.
44.39±24.4 U/ml, P=0.04, respectively).
| Table VINegative HLA-DRB1*04 allele in the
patient group in relation to gene expression and
autoantibodies. |
Table VI
Negative HLA-DRB1*04 allele in the
patient group in relation to gene expression and
autoantibodies.
| | | Mean ± SD |
|---|
| Patients with
negative HLA-DRB1*04 allele | n=68 | Gene exp.
(fold) | ACCP (U/ml) | RF (U/ml) |
|---|
| Smokers | 31 | 1.95±1.2 | 63.04±22.9 | 76.12±86.6 |
| Non-smokers | 37 | 1.43±1.1 | 58.32±20.2 | 44.39±24.4 |
| P-value | | 0.05a | 0.05a | 0.04a |
Disease severity in relation to
HLA-DRB1*04 and smoking status
Regardless of disease severity, the highest DAS-28
values were observed in the HLA-DRB1*04-positive patients who were
smokers (4.52±0.9); these values were significantly higher compared
to those in the HLA-DRB1*04-negative patients who were non-smokers
(3.8±1.02; P=0.04). Conversely, no statistically significant
difference was found when comparing HLA-DRB1*04-negative patients
who were smokers (4.18±0.8) with the HLA-DRB1*04-positive patients
who were non-smokers (4.02±0.85; P>0.05) (Table VII and Fig. 6).
| Table VIIAssociation between disease activity
with HLA-DRB1*04 (SE) and smoking status. |
Table VII
Association between disease activity
with HLA-DRB1*04 (SE) and smoking status.
| Patient group | | Mean ± SD
DAS-28 | P-value |
|---|
|
Smokers/SE-positive | 19 | 4.52±0.9 | 0.05a |
|
Non-smokers/SE-negative | 37 | 3.8±1.02 | |
|
Smokers/SE-negative | 31 | 4.18±0.8 | NS |
|
Non-smokers/SE-positive | 13 | 4.02±0.85 | |
Discussion
RA is a chronic, autoimmune disease with destructive
polyarthritis. It is multifactorial with prominent
genetic-environmental interactions as the most key risk factors for
the development of the disease. RA association with HLA-DRB1
alleles, including HLA-DRB1*04, which code to SE contain a common
amino acids sequence in position of 70-74; this has been
traditionally recognized as link the greatest heritable influence
in disease susceptibility (19).
The present study demonstrated (Tables III and IV, and Figs. 2 and 3) the effects cigarette smoke on HLA-DRB1
gene expression levels; the quantity of HLA-DRB1 levels was
affected by the cigarette smoke factor; the level was recorded as
4.46±0.42 in smokers and 1.75±0.82 in non-smokers. The risk of
developing RA is associated to SE-positive HLA-DRB1 alleles
(20). In the present study, the
HLA-DRB1*04(SE) allele was found in 19 patients who were smokers,
and in 13 patients who were non-smokers, with total a percentage of
32% (32/100) of the total RA patient group. Exposure to other
environmental contaminants, including cigarette smoke, interacts
with theHLA-DRB1*04 allele and markedly increases the risk of
developing disease (21). The
HLA-DRB1*04 allele percentage was previously recorded in Egyptian
patients with RA as 60 and 25% in normal subjects (22). Another study in Iraq recorded the
HLA-DRB1*04 allele in 70% of patients with RA and 23.3% in the
controls (23). Another study in
the Babylon governorate in Iraq recorded the HLA-DRB1*04 allele in
59% of patients with RA and 24.4% of the controls (24).
Positivity of the HLA-DRB1*04 (SE) allele was
recorded in 32% of 100 patients with RA in the present study; this
may be due to the fact that herein, there were 75 female and 25
male patients with RA, and despite the fact that RA is more
prevalent among women, it was previously shown that SE alleles were
more frequently identified in men (25). In addition, the family history
percentage of the participants in the present study was recorded as
19, and 81% had no family history (Table I). Another possible explanation for
this variation may be geographic and racial factors; a local study
in the Kurdish region in the north of Iraq reported a strong
association between disease susceptibility, and HLA-DRB1*0404 and
HLA-DRB1*0405 in patients with RA (26). It has been reported that some
geographical areas have recorded no significant association between
HLA-DRB1*04 and RA (27).
According a previous study, there is no RA-specific HLA-DR;
instead, the SE is coded by several HLA-DRB1 alleles (25).
In the present study, 29 out of the 32
HLA-DRB1*04-positive patients were ACCP-positive and 25 were
RF-positive; HLA-DRB1 alleles are the sole risk factor for RA among
individuals with positive ACCP antibodies, according to two sizable
cohort studies conducted in the USA and Europe using various
genetic epidemiology techniques (28,29).
SE-positive HLA-DRB1 alleles are linked to RA that is ACCP-positive
rather than ACCP-negative, that presents them to T-cells that aid
in the production of ACCP-producing B-cells; ACCP is linked to the
pathophysiology of RA (30).
The genetic findings in the present study (Tables III and IV, and Figs. 2 and 3) indicate a positive association between
HLA-DRB1 gene expression and the levels of ACCP and RF, with
statistically significant differences observed between patients who
were smokers and non-smokers (P≤0.01). Evidence suggests that
genetically susceptible individuals exposed to various
environmental pollutants have a substantially increased risk of
developing RA (31). In the
present study, HLA-DRB104-positive patients exhibited higher ACCP
levels (77.54±24.6 U/ml) compared with HLA-DRB104-negative patients
(58.32±20.2 U/ml). ACCP antibodies are strongly associated with the
presence of the HLA-DRB1*04 allele (32).
Certain serological indicators for RA, namely in
individuals who test positive for HLA-DRB1*04, have been
demonstrated to be ACCP positive; these findings suggest that ACCP
may be directly linked to RA (20). It has been noted that patients with
RA with SE alleles have three times the frequency of positive
titers for antibodies against citrullinated peptides compared to
those without them (33).
Effects of smoking on SE-positive and
-negative patients
In the present study, SE-positive patients who were
smokers had higher ACCP levels than SE-positive patients who were
non-smokers; SE-negative patients who were smokers had higher
levels ACCP than those who were non-smokers (P≤0.05) (Tables V and VI, and Figs. 4 and 5). A large US study indicated that the
degree of smoking exposure is crucial in supporting the function of
SE-smoking interaction (34). It
has been mentioned that tobacco exposure increases the risk factor
for ACCP antibodies only in SE-positive patients with RA and is not
observed in undifferentiated arthritis (35).
In present study, the larger percentage of patients
developed RA with no genetic or familial susceptibility. Although
RA susceptibility is genetically defined, it has been proposed that
non-genetic (i.e., environmental), epigenetic, or
post-translational processes may be responsible for the onset of
the illness (36). Cigarette
smoking and HLA-DRB1SE alleles have been shown to interact
strongly, which aids in the development of ACCP positive RA
(4). High levels of both ACCP and
RF may be linked to smoking. Notably, herein, RF levels were
increased in all patients, although the effect of smoking on ACCP
levels was only observed in those with SE alleles. Quitting smoking
prior to the onset of RA reduces the chance of future ACCP-positive
disease (37).
In the present study, HLA-DRB1*04 positive patients
who were smokers had higher RF levels than HLA-DRB1*04-positive
non-smokers; HLA-DRB1*04-negative patients who were smokers had
higher RF levels than non-smokers (P≤0.05). It has been shown that
smokers have increased levels of RF and are more prone to
developing RA (13). Both current
and former smokers have an increased prevalence of developing
elevated RF levels compared to non-smokers, and the proportion of
smokers increases with increasing RF titers (35).
Disease severity in relation to
HLA-DRB1*04 and smoking status
The risk of developing RA increases with cigarette
smoking, which may also have a dose-dependent negative effect on
the severity of RA. Tobacco smoke exposure is associated with RF
positivity among subjects without RA, by increasing RF levels and
altering immune function both in the lungs and systemically;
smoking may have a biological link on the course of RA illness;
thus, cigarette smoke has a marked effect on the development and
severity of RA (38).
The present study demonstrated (Table VII and Fig. 6) the DAS-28 values in relation to
both risk factors cigarette smoke and genetic susceptibility. The
analysis of the results revealed that the DAS-28 value of
HLA-DRB1*04-positive smokers differed significantly with that of
HLA-DRB1*04-negative non-smokers (P≤0.05); no significant
difference was observed between the DAS-28 values of
HLA-DRB1*04-negative smokers and HLA-DRB1*04-positive non-smokers.
The results of the present study demonstrated that the effect of
cigarette smoke as a single risk factor is equipotent to the
presence of the SE allele alone, which reflects the importance of
the smoking-HLA-DRB1*04 interaction in the adverse progression of
RA (35). The highest DAS-28 value
(4.52±0.9) was associated with the highest ACCP level (77.54±24.6
U/ml), a strong association of HLA-DRB1*04 with anti-CCP
positivity, and disease activity was recorded in patients with RA
(30).
The present study had certain limitations which
should be mentioned. The sample size was relatively modest,
particularly in the HLA-DRB104-positive control group, which may
have limited the statistical power and generalizability. In
addition, the cross-sectional study design precluded the assessment
of causal associations between smoking, HLA-DRB1*04 allele status
and RA severity.
Furthermore, the majority of patients were receiving
antirheumatic treatment at the time of sampling, which may have
influenced autoantibody levels, gene expression and DAS-28 scores.
Environmental and lifestyle factors other than smoking were not
fully controlled. Finally, the genetic analysis was limited to the
HLA-DRB1*04 allele and did not include other SE alleles or
gene-gene interactions. Further longitudinal studies with larger
cohorts and expanded genetic analyses are warranted.
In conclusion, cigarette smoking, as an independent
risk factor, exerts an effect comparable to that of the SE-positive
allele. However, the interaction between cigarette smoking and SE
positivity produces the greatest severity of RA. The highest levels
of ACCP antibodies were observed in patients who were smokers
carrying SE-positive alleles. These findings highlight the critical
importance of integrating genetic screening strategies with robust
smoking cessation programs for individuals at elevated risk.
Further studies are required to explore the molecular pathways via
which smoking interacts with particular common epitope alleles in
the Iraqi population.
Acknowledgements
The authors would like to thank the treating
physician (Dr Mohammed Hadi, Rheumatology and Medical
Rehabilitation/Rheumatology Consultation Clinic at Baghdad Teaching
Hospital/Medical City, Baghdad, Iraq) for his assessment of disease
activity in the patients participating in the current study.
Funding
Funding: No funding was received.
Availability of data and materials
The data generated in the present study may be
requested from the corresponding author.
Authors' contributions
Both authors (KE and DSS) were involved in the
conceptualization of the study and in the study methodology. KE was
involved in data investigation and data collection, and in the
writing of the original draft of the manuscript. DSS was involved
in the formal analysis and data interpretation, and in the writing,
reviewing and editing of the manuscript. DSS also supervised the
study. Both KE and DSS confirm the authenticity of all the raw
data, authors have read and approved the final manuscript.
Ethics approval and consent to
participate
Participants were provided with detailed information
about the study objectives and signed an institutional informed
consent form in their native language, including the purpose of the
study, detailed procedures, and any potential benefits of
participation. Healthy participants voluntarily participated in the
present study. Formal approval was obtained from the Ethics
Committee/College of Science/University of Baghdad, reference no.
CSEC/1123/0101, November 2, 2023. Official letter/Ministry of
Health No. 48321-December 25, 2023.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing
interests.
References
|
1
|
Salman SA and Al-Jumaily RMK: Evaluation
of some immunological and DNA damage parameters among patients with
rheumatoid arthritis. Iraqi J Sci. 65:5439–5446. 2024.
|
|
2
|
Bhayani HR and Hedrick SM: The role of
polymorphic amino acids of the MHC molecule in the selection of the
T cell repertoire. J Immunol. 146:1093–1098. 1991.PubMed/NCBI
|
|
3
|
Alves CC, Lewis J, Antunes DA and Donadi
EA: The role of vimentin peptide citrullination in the structure
and dynamics of HLA-DRB1 rheumatoid arthritis risk-associated
alleles. Int J Mol Sci. 26(34)2024.PubMed/NCBI View Article : Google Scholar
|
|
4
|
Lim JJ, Jones CM, Loh TJ, Ting YT, Zareie
P, Loh KL, Felix NJ, Suri A, McKinnon M, Stevenaert F, et al: The
shared susceptibility epitope of HLA-DR4 binds citrullinated
self-antigens and the TCR. Sci Immunol. 6(eabe0896)2021.PubMed/NCBI View Article : Google Scholar
|
|
5
|
Yousif NH and Ibraheem SR: Comparison of
some physiological parameters in female rheumatoid arthritis
patients in pre- and postmenopausal stages. Iraqi J Sci.
61:1926–1931. 2020.
|
|
6
|
Meng W, Zhu Z, Jiang X, Too CL, Uebe S,
Jagodic M, Kockum I, Murad S, Ferrucci L, Alfredsson L, et al: DNA
methylation mediates genotype and smoking interaction in the
development of anti-citrullinated peptide antibody-positive
rheumatoid arthritis. Arthritis Res Ther. 19(71)2017.PubMed/NCBI View Article : Google Scholar
|
|
7
|
Mahdi H, Fisher BA, Källberg H, Plant D,
Malmström V, Rönnelid J, Charles P, Ding B, Alfredsson L, Padyukov
L, et al: Specific interaction between genotype, smoking and
autoimmunity to citrullinated alpha-enolase in the etiology of
rheumatoid arthritis. Nat Genet. 41:1319–1324. 2009.PubMed/NCBI View
Article : Google Scholar
|
|
8
|
Mourad J, Naji S, El Karaaoui A and Wahbeh
D: Association of HLA-DRB1 alleles with rheumatoid arthritis in
Mediterranean populations: A meta-analysis with regional
differences, advanced heterogeneity and evidence quality
assessment. medRxiv: 04.29.25326652, 2025.
|
|
9
|
Al-Saffar EA, Al-Saadi BQH and Awadh NI:
Study the association of miRNA-146a gene polymorphism and some
immunological markers with the risk of rheumatoid arthritis
incidence in a sample of Iraqi patients. Rev Bionatura. 8:1–14.
2023.
|
|
10
|
Li C, Zhang Y, Song H, Gao J, Zhao DB, Zhu
Q, He DY, Wang L, Li XP, Liu XD, et al: Anti-cyclic citrullinated
peptide antibody predicts the development of rheumatoid arthritis
in patients with undifferentiated arthritis. Chin Med J (Engl).
123:2899–2904. 2019.PubMed/NCBI View Article : Google Scholar
|
|
11
|
Oglah AA, AbidMohammed KI and Alosami MH:
Prognostic value of COMP a comparison with ACCP in rheumatoid
arthritis patients in Iraq. Int J Health Sci. 6:937–948. 2022.
|
|
12
|
Larid G, Pancarte M, Offer G, Clavel C,
Martin M, Pradel V, Auger I, Lafforgue P, Roudier J, Serre G and
Balandraud N: In rheumatoid arthritis patients, HLA-DRB1*04:01 and
rheumatoid nodules are associated with ACPA to a particular fibrin
epitope. Front Immunol. 12(692041)2021.PubMed/NCBI View Article : Google Scholar
|
|
13
|
Mole EN, Tarassi K, Tsirogianni A,
Athanassiades T, Kitsiou V, Kouniaki D, Gazi S and
Vlachoyiannopoulos P: Impact of HLA-DRB1 SE, anti-citrullinated
protein antibodies and smoking on radiographic outcome in Greek
patients with Rheumatoid Arthritis. BMC Rheumatol.
9(128)2025.PubMed/NCBI View Article : Google Scholar
|
|
14
|
Arnett FC, Edworthy SM, Bloch DA, McShane
DJ, Fries JF, Cooper NS, Healey LA, Kaplan SR, Liang MH, Luthra HS,
et al: The American Rheumatism Association 1987 revised criteria
for the classification of rheumatoid arthritis. Arthritis Rheum.
31:315–324. 1988.PubMed/NCBI View Article : Google Scholar
|
|
15
|
Pisaniello HL, Whittle SL, Lester S, Menz
F, Metcalf R, McWilliams L, Hill CL and Proudman S: Using the
derived 28-joint disease activity score patient-reported components
(DAS28-P) index as a discriminatory measure of response to
disease-modifying anti-rheumatic drug therapy in early rheumatoid
arthritis. BMC Rheumatol. 6(67)2022.PubMed/NCBI View Article : Google Scholar
|
|
16
|
Livak KJ and Schmittgen TD: Analysis of
relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) method. Methods. 25:402–408.
2001.PubMed/NCBI View Article : Google Scholar
|
|
17
|
Parasannanavar DJ, Yeola A, Pradhan V,
Rajyadhaksha A and Ghosh K: HLA-DRβ1*04 typing by simple in-house
PCR-SSP technique for rheumatoid arthritis patients. Rheumatol Int.
33:867–870. 2013.PubMed/NCBI View Article : Google Scholar
|
|
18
|
Forthofer RN and Lee ES: Introduction to
biostatistics: A guide to design, analysis, and discovery.
Elsevier, 2014.
|
|
19
|
Zhao M, Mauer L, Sayles H, Cannon GW,
Reimold A, Kerr GS, Baker JF, Thiele GM, England BR and Mikuls TR:
HLA-DRB1 haplotypes, shared epitope, and disease outcomes in US
veterans with rheumatoid arthritis. J Rheumatol. 46:685–693.
2019.PubMed/NCBI View Article : Google Scholar
|
|
20
|
Roudier J, Balandraud N and Auger I: How
RA associated HLA-DR molecules contribute to the development of
antibodies to citrullinated proteins: The hapten carrier model.
Front Immunol. 13(930112)2022.PubMed/NCBI View Article : Google Scholar
|
|
21
|
Fu J, Nogueira SV, Drongelen VV, Coit P,
Ling S, Rosloniec EF, Sawalha AH and Holoshitz J: Shared
epitope-aryl hydrocarbon receptor crosstalk underlies the mechanism
of gene-environment interaction in autoimmune arthritis. Proc Natl
Acad Sci USA. 115:4755–4760. 2018.PubMed/NCBI View Article : Google Scholar
|
|
22
|
Soliman AF, Egaila SES, Ali AI, Azab NI
and Al-Gohary HH: HLA-DRB1 alleles in Egyptian rheumatoid arthritis
patients: Relations to anti-cyclic citrullinated peptide
antibodies, disease activity and severity. Egypt Rheumatol.
38:269–275. 2016.
|
|
23
|
Al-Yasiri IK, Al-Mousawi JK and Al-Mohana
AM: Evaluation of some genetic factors in rheumatoid arthritis
patients in Iraq. Iraqi J Biotechnol. 13:66–74. 2013.
|
|
24
|
Aljoboury BA, Alta'ee AH and Alrubaie SJ:
Association of HLA-DRB1 gene polymorphism in rheumatoid arthritis
patients in Babylon Province, Iraq. Indian J Forensic Med Toxicol.
14:855–860. 2020.
|
|
25
|
del Rincón I, Battafarano DF, Arroyo RA,
Murphy FT and Escalante A: Heterogeneity between men and women in
the influence of the HLA-DRB1 shared epitope on the clinical
expression of rheumatoid arthritis. Arthritis Rheum. 46:1480–1488.
2002.PubMed/NCBI View Article : Google Scholar
|
|
26
|
Albarzinji N, Ismael SA and Albustany D:
Association of rheumatoid arthritis and its severity with human
leukocytic antigen-DRB1 alleles in Kurdish region in North of Iraq.
BMC Rheumatol. 6(4)2022.PubMed/NCBI View Article : Google Scholar
|
|
27
|
Castro F, Acevedo E, Ciusani E, Angulo JA,
Wollheim FA and Sandberg-Wollheim M: Tumour necrosis factor
microsatellites and HLA-DRB1*, HLA-DQA1*, and HLA-DQB1* alleles in
Peruvian patients with rheumatoid arthritis. Ann Rheum Dis.
60:791–795. 2001.PubMed/NCBI View Article : Google Scholar
|
|
28
|
England BR, Sayles H, Michaud K, Caplan L,
Davis LA, Cannon GW, Sauer BC, Solow EB, Reimold AM, Kerr GS, et
al: Cause-specific mortality in male US veterans with rheumatoid
arthritis. Arthritis Care Res (Hoboken). 68:36–45. 2016.PubMed/NCBI View Article : Google Scholar
|
|
29
|
Jiang X, Trouw LA, van Wesemael TJ, Shi J,
Bengtsson C, Källberg H, Malmström V, Israelsson L, Hreggvidsdottir
H, Verduijn W, et al: Anti-CarP antibodies in two large cohorts of
patients with rheumatoid arthritis and their relationship to
genetic risk factors, cigarette smoking and other autoantibodies.
Ann Rheum Dis. 73:1761–1768. 2014.PubMed/NCBI View Article : Google Scholar
|
|
30
|
Zhuo J, Xia Q, Sharma N, Gao S, Lama S,
Cui J, Feathers V, Shadick N and Weinblatt ME: The role of shared
epitope in rheumatoid arthritis prognosis in relation to
anti-citrullinated protein antibody positivity. Rheumatol Ther.
9:637–647. 2022.PubMed/NCBI View Article : Google Scholar
|
|
31
|
Romão VC and Fonseca JE: Etiology and risk
factors for rheumatoid arthritis: A state-of-the-art review. Front
Med (Lausanne). 8(689698)2021.PubMed/NCBI View Article : Google Scholar
|
|
32
|
Wu CY, Yang HY and Lai JH:
Anti-citrullinated protein antibodies in patients with rheumatoid
arthritis: Biological effects and mechanisms of immunopathogenesis.
Int J Mol Sci. 21(4015)2020.PubMed/NCBI View Article : Google Scholar
|
|
33
|
Jung SM, Park YJ, Park KS and Kim KJ:
Clinical implications of shared epitope and anti-citrullinated
peptide antibody in patients with rheumatoid arthritis. J Rheum
Dis. 29:171–180. 2022.PubMed/NCBI View Article : Google Scholar
|
|
34
|
Karlson EW, Chang SC, Cui J, Chibnik LB,
Fraser PA, De Vivo I and Costenbader KH: Gene-environment
interaction between HLA-DRB1 shared epitope and heavy cigarette
smoking in predicting incident rheumatoid arthritis. Ann Rheum Dis.
69:54–60. 2010.PubMed/NCBI View Article : Google Scholar
|
|
35
|
Roh S: Smoking as a preventable risk
factor for rheumatoid arthritis: Rationale for smoking cessation
treatment in patients with rheumatoid arthritis. J Rheum Dis.
26:12–19. 2019.
|
|
36
|
Hirose W, Harigai M, Amano K, Hidaka T,
Itoh K, Aoki K, Nakashima M, Nagasawa H, Komano Y and Nanki T:
TOF-ABT Study Group. Impact of the HLA-DRB1 shared epitope on
responses to treatment with tofacitinib or abatacept in patients
with rheumatoid arthritis. Arthritis Res Ther.
23(228)2021.PubMed/NCBI View Article : Google Scholar
|
|
37
|
Wysocki T, Onska M and Paradowska-Gorycka
A: Current understanding of an emerging role of HLA-DRB1 gene in
rheumatoid arthritis-from research to clinical practice. Cells.
9(1127)2020.PubMed/NCBI View Article : Google Scholar
|
|
38
|
Ishikawa Y and Terao C: The impact of
cigarette smoking on risk of rheumatoid arthritis: A narrative
review. Cells. 9(475)2020.PubMed/NCBI View Article : Google Scholar
|
