Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
February-2016 Volume 4 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2016 Volume 4 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Expression profiling of microRNAs in optineurin (E50K) mutant transgenic mice

  • Authors:
    • Lin Gao
    • Bo Jiang
    • Dawei Lei
    • Xinrong Zhou
    • Huiping Yuan
  • View Affiliations / Copyright

    Affiliations: Department of Ophthalmology, The Second Affiliated Hospital, Harbin Medical University, Nangang, Harbin 150086, P.R. China
  • Pages: 193-196
    |
    Published online on: December 31, 2015
       https://doi.org/10.3892/br.2015.565
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

An E50K substitution in the transcription factor optineurin (OPTN) induces primary open‑angle glaucoma (POAG). To explore the potential role of microRNAs (miRNAs) in E50K OPTN‑induced POAG, miRNA expression profiling was performed on retinal samples from OPTN (E50K) transgenic and wild‑type mice. The retinas were collected from 30 transgenic and 30 wild‑type mice, and miRNA expression was evaluated using a genome‑wide miRNA microarray. miRNAs that were differentially expressed in retinal samples from OPTN (E50K) transgenic mice were identified and validated by reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR). Additional gene ontology and signaling pathway analyses were performed using bioinformatics tools. A total of 48 miRNAs exhibited increased or decreased expression in the retinas from OPTN (E50K) transgenic mice when compared with the expression in the retinas from wild‑type mice. A total of 5 miRNAs with increased expression in OPTN  (E50K) transgenic mice could be grouped into one cluster as they belong to the miR‑8 family and may act as regulators in the development of POAG in OPTN (E50K) transgenic mice. RT‑qPCR results confirmed significantly increased expression of miR‑141 in the retinas of OPTN (E50K) transgenic mice as compared to wild‑type mice. In conclusion, these results show that certain miRNAs are differentially expressed in the retinas of OPTN (E50K) transgenic mice and may play roles in the pathogenesis of POAG induced by OPTN (E50K).

Introduction

Glaucoma causes irreversible blindness and is characterized by optic nerve degeneration and visual field defects (1). Primary open-angle glaucoma (POAG) is the major form of glaucoma. An epidemiological study in Japan demonstrated that a large number of POAG cases were diagnosed as normal tension glaucoma (NTG) (2). Mutations in the optineurin (OPTN) gene that encodes amino acid substitutions, such as E50K, H486R and R545Q, have been associated with POAG and NTG (3–6). The substitution of glutamic acid by lysine at amino acid 50 (E50K) is exclusively associated with familial and sporadic forms of NTG (7). Previous studies have shown that E50K OPTN induces the apoptosis of retinal ganglion cells in transgenic mice models and progressive retinal degeneration exclusively in the peripheral region of the retinas, although the exact mechanism remains unclear (8).

MicroRNAs (miRNAs) bind to target messenger RNAs (mRNAs) and subsequently suppress protein expression via mRNA degradation or translational inhibition (9). Several reports have described the expression of miRNAs in the eye and specific miRNAs have been indicated in the pathogenesis of glaucoma. In one report, miRNA-24 was shown to regulate transforming growth factor β1 processing during cyclic mechanical stress in human trabecular network cells (10). It is unclear whether miRNAs contribute to pathogenesis in OPTN (E50K) transgenic mice. To address whether additional miRNAs could play a role in OPTN (E50K)-induced POAG pathogenesis, miRNA profiling was performed of the retinal samples from OPTN (E50K) transgenic mice and the differentially expressed miRNAs were identified. Differential expression of miRNAs was validated by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The identification of the differentially expressed miRNAs due to mutant OPTN (E50K) expression is likely to provide a foundation for studying the molecular pathways contributing to POAG.

Materials and methods

Animals and sample collection

All the animal experiments in the study were performed according to the tenets of the National Institutes of Health Guidelines and Regulations on the Care and Use of Animals in Research. Transgenic mice engineered to express the E50K mutant human OPTN in the retina were as described previously (11). Retinas from 8-month-old transgenic and wild-type mice were collected for genome-wide miRNA expression analysis. Retinas from 3 groups of 10 transgenic mice (E1, E2 and E3) and 3 groups of 10 wild-type mice (W1, W2 and W3) were pooled for analysis and independently analyzed for miRNA expression. Retinal samples were frozen at −80°C until analysis.

miRNA microarray study

miRNA microarray experiments were performed at CapitalBio Corp. (Beijing, China). Total RNA was extracted with TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) from retinal samples collected from transgenic and wild-type mice. Samples were labeled and hybridized to a GeneChip® miRNA Array (V3.0; Affymetrix, Santa Clara, CA, USA). Raw data were normalized and analyzed using the miRNA QC Tool software (Affymetrix). The analysis focused on miRNAs with a ≥1.5-fold expression difference in retinal samples from OPTN (E50K) transgenic mice as compared to wild-type control retinal samples.

miRNA target gene prediction and function analysis

Prediction of miRNA target genes was performed using a computational approach. The prediction of miRNA target genes was performed using 3 different miRNA target prediction algorithms: PicTar, miRanda v5 and TargetScan v6.0. For each algorithm, the potential binding sites in the mRNA 3′-untranslated region (3′-UTR) of target genes were identified according to specific base-pairing rules.

RT-qPCR miRNA analysis

To confirm the results from the miRNA microarray, RT-qPCR analysis of mmu-miR-141 was performed on the same total RNA used for microarray analysis. First-strand cDNA synthesis was performed from equal amounts of total RNA using an All-in-One™ miRNA First-Strand cDNA Synthesis kit (GeneCopoeia, Guangdong, China) according to the manufacturer's instructions. Primers were designed and synthesized by GeneCopoeia.

RT-qPCR was performed using the All-in-One™ qPCR Mix on LightCycler 480 system (Roche, Basel, Switzerland). The levels of an endogenous control, U6, were used to normalize the expression levels of each miRNA. All the reactions were performed in triplicate and included controls. The fold-change in miRNA expression was calculated using the comparative Ct method. Data are presented as the fold-change relative to expression in the retinal samples of wild-type mice.

Statistical analysis

All the results are expressed as the mean ± standard deviation. Statistical analysis was performed with the Student's t-test to identify statistically significant differences using commercial software (SigmaPlot; Systat Software Inc., San Jose, CA, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Global miRNA profiling in OPTN (E50K) transgenic and wild-type mice

Retinal miRNA expression patterns were evaluated using pooled retinal samples for 3 separate groups of 10 transgenic mice (E1, E2 and E3) and 10 wild-type mice (W1, W2 and W3). For each pooled sample, >2 µg of retinal RNA was harvested. Spectrophotometric analysis of RNA purity was performed by measuring absorbance at 260 and 280 nm. All samples exhibited 260/280 nm absorbance ratios >1.96, indicating isolation of high-quality retinal RNA.

Global miRNA expression patterns were determined for each sample by microarray analysis. The analysis focused on specific miRNAs exhibiting differential expression levels in the retinas from OPTN (E50K) transgenic mice as compared to wild-type mice by identifying miRNAs with a ≥1.5-fold-change in expression level and P≤0.05. Based on this threshold, 48 miRNAs were differentially expressed in OPTN (E50K) transgenic retinal samples as compared to wild-type retinal samples, representing 10% of the 48 miRNAs represented on the array (Table I). Of these, 5 miRNAs passed the Volcano plot filtering screen to identify miRNAs that were expressed at significantly different levels in transgenic versus wild-type retinas (P<0.05; false discovery rate, <0.05; Fig. 1A). Each of these miRNAs was upregulated 2.32–3.20-fold in the retinas of OPTN (E50K) transgenic mice compared to wild-type mice (Fig. 1B). mmu-miR-141 was focused on as it exhibited the largest increase in expression in retinal samples from transgenic mice and RT-qPCR was used to validate the miRNA microarray results. Consistent with the microarray results, RT-qPCR analysis demonstrated that mmu-miR-141 was expressed at significantly higher levels in the retinas of transgenic mice compared to wild-type mice (Fig. 2).

Figure 1.

MicroRNA (miRNA) profiles were performed on the retinas of optineurin (OPTN) (E50K) transgenic and wild-type mice. (A) Hierarchical clustering was performed with normalized miRNA data (fold-change ≥1.5) that passed the Student's t-test (P<0.05). A total of 5 miRNAs were identified based on significant expression differences in the retinas of OPTN (E50K) mutation transgenic mice as compared to wild-type mice. E1-E3 and W1-W3 represent miRNA expression data for three independent samples of pooled retinal RNA from OPTN (E50K) transgenic or wild-type mice, respectively. For each miRNA, the intensity of the red color reflects the expression levels. (B) Fold-change in miRNA expression in the retinas of OPTN (E50K) transgenic mice as compared to wild-type mice, determined by miRNA array.

Figure 2.

Validation of selected microarray data by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Relative expression levels of miR-141 were determined by RT-qPCR. mmu-miR-141 expression was markedly upregulated in the retinas of optineurin (E50K) transgenic mice compared to wild-type (WT) mice. Values are means ± standard deviation and are expressed relative to internal control (U6; n=3 for each group; *P<0.05, Student's t-test).

Table I.

MicroRNA (miRNA) profiles were performed on the retinas of optineurin (E50K) transgenic and wild-type mice. miRNAs are ranked in order of fold-change, from the largest to the smallest.

Table I.

MicroRNA (miRNA) profiles were performed on the retinas of optineurin (E50K) transgenic and wild-type mice. miRNAs are ranked in order of fold-change, from the largest to the smallest.

miRNA IDFold-changemiRNA sequence
mmu-miR-1413.2023 UAACACUGUCUGGUAAAGAUGG
mmu-miR-4512.8473 AAACCGUUACCAUUACUGAGUU
mmu-miR-200a2.6426 UAACACUGUCUGGUAACGAUGU
mmu-miR-483*2.5317 UCACUCCUCCCCUCCCGUCUU
mmu-miR-3057-3p2.4620 UCCCACAGGCCCAGCUCAUAGC
mmu-miR-877*2.4260 UGUCCUCUUCUCCCUCCUCCCA
mmu-miR-3102-3p.22.4235 CUCUACUCCCUGCCCCAGCCA
mmu-miR-4292.3851 UAAUACUGUCUGGUAAUGCCGU
mmu-miR-3085-3p2.3604 UCUGGCUGCUAUGGCCCCCUC
mmu-miR-7122.3241 CUCCUUCACCCGGGCGGUACC
mmu-miR-2232.2929 UGUCAGUUUGUCAAAUACCCCA
mmu-miR-2112.2731 UUCCCUUUGUCAUCCUUUGCCU
mmu-miR-31*2.2721 UGCUAUGCCAACAUAUUGCCAUC
mmu-miR-27a2.0945 UUCACAGUGGCUAAGUUCCGC
mmu-miR-39632.0212 UGUAUCCCACUUCUGACAC
mmu-miR-1a2.0141 UGGAAUGUAAAGAAGUAUGUAU
mmu-miR-39681.9957 CGAAUCCCACUCCAGACACCA
mmu-miR-200b1.9956 UAAUACUGCCUGGUAAUGAUGA
mmu-miR-200a*1.9578 CAUCUUACCGGACAGUGCUGGA
mmu-let-7b*1.9529 CUAUACAACCUACUGCCUUCCC
mmu-miR-30921.8662 GAAUGGGGCUGUUUCCCCUCC
mmu-miR-200b*1.8444 CAUCUUACUGGGCAGCAUUGGA
mmu-miR-211.8270 UAGCUUAUCAGACUGAUGUUGA
mmu-miR-2051.7966 UCCUUCAUUCCACCGGAGUCUG
mmu-miR-2031.7911 GUGAAAUGUUUAGGACCACUAG
mmu-miR-30721.7820 UGCCCCCUCCAGGAAGCCUUCU
mmu-miR-27a*1.7546 AGGGCUUAGCUGCUUGUGAGCA
mmu-miR-30e1.7120 UGUAAACAUCCUUGACUGGAAG
mmu-miR-28c1.6958 AGGAGCUCACAGUCUAUUGA
mmu-miR-1843b-5p1.6886 AUGGAGGUCUCUGUCUGACUU
mmu-miR-1221.6574 UGGAGUGUGACAAUGGUGUUUG
mmu-miR-467d*1.6427 AUAUACAUACACACACCUACAC
mmu-miR-34c*1.6416 AAUCACUAACCACACAGCCAGG
mmu-miR-148a1.6200 UCAGUGCACUACAGAACUUUGU
mmu-miR-1298*1.5997 CAUCUGGGCAACUGAUUGAACU
mmu-miR-19491.5995 CUAUACCAGGAUGUCAGCAUAGUU
mmu-miR-15a1.5988 UAGCAGCACAUAAUGGUUUGUG
mmu-miR-4971.5903 CAGCAGCACACUGUGGUUUGUA
mmu-miR-51271.5743 UCUCCCAACCCUUUUCCCA
mmu-miR-200c1.5620 UAAUACUGCCGGGUAAUGAUGGA
mmu-miR-467b*1.5491 AUAUACAUACACACACCAACAC
mmu-miR-205*1.5424 GAUUUCAGUGGAGUGAAGCUCA
mmu-miR-744*1.5254 CUGUUGCCACUAACCUCAACCU
mmu-miR-1401.5219 CAGUGGUUUUACCCUAUGGUAG
mmu-miR-1431.5215 UGAGAUGAAGCACUGUAGCUC
mmu-miR-19b1.5059 UGUGCAAAUCCAUGCAAAACUGA
mmu-miR-106b1.5015 UAAAGUGCUGACAGUGCAGAU
mmu-miR-335-5p1.5000 UCAAGAGCAAUAACGAAAAAUGU
Computational prediction of potential target genes and network analysis

Candidate target genes for mmu-miR-141 were identified using three commonly used prediction algorithms to reduce the unpredictable number of false positives: PicTar, miRanda and TargetScan. The results of the miRNA-mRNA regulatory network analysis indicated that mmu-miR-141 belonged to the miR-8 family. The miR-8 family also includes mmu-miR-200a, mmu-miR-200b, mmu-miR-200c and mmu-miR-429, all of which were upregulated in the retinas of OPTN (E50K) transgenic mice by microarray but did not achieve statistical significance.

Discussion

The OPTN E50K mutation is the only mutation currently confirmed to play a causative role in NTG pathogenesis (2). Transgenic mice that overexpress OPTN E50K provide a model system for elucidating the molecular mechanisms leading to POAG (8). While the majority of previous studies have focused on direct protein-protein interactions, differences in the expression levels of core proteins have also been noted and may contribute to POAG pathogenesis. The mechanisms accounting for differential expression of proteins indicated in POAG are not clear.

miRNAs can regulate gene expression through sequence complementarity to the 3′-UTRs of target mRNAs. miRNA binding to target mRNAs can result in translational repression through mRNA degradation or translational inhibition (12). Accumulating evidence suggests that miRNAs act as novel cellular senescence regulators. However, there is little information regarding the potential involvement of miRNAs in the mediating effects originating from the expression of mutant proteins associated with disease processes, such as OPTN (E50K). The present results suggest that the miRNAs miR-141, miR-200a, miR-200b, miR-200c and miR-429, which all belong to the miR-8 family, may be critical regulators of POAG induced by the OPTN (E50K) mutation.

The miR-8 family has been demonstrated to regulate numerous biological processes, including the response to osmotic stress in zebrafish embryos (13) and the response to steroid signaling in Drosophila (14). miR-200b, miR-200c and miR-429 are TBK1 gene-related miRNAs according to the miRbase database. The E50K mutation in OPTN may enhance its interaction with TBK1 and affect OPTN function by rendering OPTN insoluble (15). However, no experiments have been performed to fully elucidate the mechanisms by which the OPTN (E50K) mutation induces POAG to date. Therefore, further research to understand the interaction of the OPTN (E50K) mutation with TBK1 could improve the management of POAG.

In conclusion, the present study identified a number of differentially expressed miRNAs in the retinas of OPTN (E50K) mutant transgenic mice. The results suggest several noteworthy directions for future research aimed at elucidating the role of miRNAs in glaucoma pathogenesis. Detailed analyses of miRNA expression patterns and the impact on retinal cell function may contribute to our understanding of the pathophysiological processes leading to POAG.

Acknowledgements

The present study was funded by the National Natural Science Foundation of China (grant no. 81271000) and the Major State Basic Research Development Program of China (973 Program, grant no. 2011CB707502). The authors thank Dr Peter Wilker for editing the manuscript.

References

1 

Quigley HA and Broman AT: The number of people with glaucoma worldwide in 2010 and 2020. Br J Ophthalmol. 90:262–267. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Iwase A, Suzuki Y, Araie M, Yamamoto T, Abe H, Shirato S, Kuwayama Y, Mishima HK, Shimizu H, Tomita G, et al: Tajimi Study Group, Japan Glaucoma Society: The prevalence of primary open-angle glaucoma in Japanese: The Tajimi Study. Ophthalmology. 111:1641–1648. 2004. View Article : Google Scholar : PubMed/NCBI

3 

Rezaie T, Child A, Hitchings R, Brice G, Miller L, Coca-Prados M, Héon E, Krupin T, Ritch R, Kreutzer D, et al: Adult-onset primary open-angle glaucoma caused by mutations in optineurin. Science. 295:1077–1079. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Aung T, Rezaie T, Okada K, Viswanathan AC, Child AH, Brice G, Bhattacharya SS, Lehmann OJ, Sarfarazi M and Hitchings RA: Clinical features and course of patients with glaucoma with the E50K mutation in the optineurin gene. Invest Ophthalmol Vis Sci. 46:2816–2822. 2005. View Article : Google Scholar : PubMed/NCBI

5 

Leung YF, Fan BJ, Lam DS, Lee WS, Tam PO, Chua JK, Tham CC, Lai JS, Fan DS and Pang CP: Different optineurin mutation pattern in primary open-angle glaucoma. Invest Ophthalmol Vis Sci. 44:3880–3884. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Fuse N, Takahashi K, Akiyama H, Nakazawa T, Seimiya M, Kuwahara S and Tamai M: Molecular genetic analysis of optineurin gene for primary open-angle and normal tension glaucoma in the Japanese population. J Glaucoma. 13:299–303. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Alward WL, Kwon YH, Kawase K, Craig JE, Hayreh SS, Johnson AT, Khanna CL, Yamamoto T, Mackey DA, Roos BR, et al: Evaluation of optineurin sequence variations in 1,048 patients with open-angle glaucoma. Am J Ophthalmol. 136:904–910. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Chi ZL, Akahori M, Obazawa M, Minami M, Noda T, Nakaya N, Tomarev S, Kawase K, Yamamoto T, Noda S, et al: Overexpression of optineurin E50K disrupts Rab8 interaction and leads to a progressive retinal degeneration in mice. Hum Mol Genet. 19:2606–2615. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Xiao F, Zuo Z, Cai G, Kang S, Gao X and Li T: miRecords: An integrated resource for microRNA-target interactions. Nucleic Acids Res. 37:(Database). D105–D110. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Luna C, Li G, Qiu J, Epstein DL and Gonzalez P: MicroRNA-24 regulates the processing of latent TGFβ1 during cyclic mechanical stress in human trabecular meshwork cells through direct targeting of FURIN. J Cell Physiol. 226:1407–1414. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Meng Q, Xiao Z, Yuan H, Xue F, Zhu Y, Zhou X, Yang B, Sun J, Meng B, Sun X, et al: Transgenic mice with overexpression of mutated human optineurin(E50K) in the retina. Mol Biol Rep. 39:1119–1124. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Ambros V: MicroRNAs: Tiny regulators with great potential. Cell. 107:823–826. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Flynt AS, Thatcher EJ, Burkewitz K, Li N, Liu Y and Patton JG: miR-8 microRNAs regulate the response to osmotic stress in zebrafish embryos. J Cell Biol. 185:115–127. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Jin H, Kim VN and Hyun S: Conserved microRNA miR-8 controls body size in response to steroid signaling in Drosophila. Genes Dev. 26:1427–1432. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Minegishi Y, Iejima D, Kobayashi H, Chi Z-L, Kawase K, Yamamoto T, Seki T, Yuasa S, Fukuda K and Iwata T: Enhanced optineurin E50K-TBK1 interaction evokes protein insolubility and initiates familial primary open-angle glaucoma. Hum Mol Genet. 22:3559–3567. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao L, Jiang B, Lei D, Zhou X and Yuan H: Expression profiling of microRNAs in optineurin (E50K) mutant transgenic mice. Biomed Rep 4: 193-196, 2016.
APA
Gao, L., Jiang, B., Lei, D., Zhou, X., & Yuan, H. (2016). Expression profiling of microRNAs in optineurin (E50K) mutant transgenic mice. Biomedical Reports, 4, 193-196. https://doi.org/10.3892/br.2015.565
MLA
Gao, L., Jiang, B., Lei, D., Zhou, X., Yuan, H."Expression profiling of microRNAs in optineurin (E50K) mutant transgenic mice". Biomedical Reports 4.2 (2016): 193-196.
Chicago
Gao, L., Jiang, B., Lei, D., Zhou, X., Yuan, H."Expression profiling of microRNAs in optineurin (E50K) mutant transgenic mice". Biomedical Reports 4, no. 2 (2016): 193-196. https://doi.org/10.3892/br.2015.565
Copy and paste a formatted citation
x
Spandidos Publications style
Gao L, Jiang B, Lei D, Zhou X and Yuan H: Expression profiling of microRNAs in optineurin (E50K) mutant transgenic mice. Biomed Rep 4: 193-196, 2016.
APA
Gao, L., Jiang, B., Lei, D., Zhou, X., & Yuan, H. (2016). Expression profiling of microRNAs in optineurin (E50K) mutant transgenic mice. Biomedical Reports, 4, 193-196. https://doi.org/10.3892/br.2015.565
MLA
Gao, L., Jiang, B., Lei, D., Zhou, X., Yuan, H."Expression profiling of microRNAs in optineurin (E50K) mutant transgenic mice". Biomedical Reports 4.2 (2016): 193-196.
Chicago
Gao, L., Jiang, B., Lei, D., Zhou, X., Yuan, H."Expression profiling of microRNAs in optineurin (E50K) mutant transgenic mice". Biomedical Reports 4, no. 2 (2016): 193-196. https://doi.org/10.3892/br.2015.565
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team