Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
April-2018 Volume 8 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 8 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Characterization of human dental pulp cells grown in chemically defined serum‑free medium

  • Authors:
    • Sakiko Fujii
    • Katsumi Fujimoto
    • Noriko Goto
    • Yoshimitsu Abiko
    • Asayo Imaoka
    • Jinchang Shao
    • Kazuko Kitayama
    • Masami Kanawa
    • Agung Sosiawan
    • Ketut Suardita
    • Fusanori Nishimura
    • Yukio Kato
  • View Affiliations / Copyright

    Affiliations: Department of Dental Science for Health Promotion, Graduate School of Biomedical and Health Sciences, Hiroshima University, Hiroshima 734‑8553, Japan, Department of Dental and Medical Biochemistry, Graduate School of Biomedical and Health Sciences, Hiroshima University, Hiroshima 734‑8553, Japan, Department of Pediatric Dentistry, Graduate School of Biomedical and Health Sciences, Hiroshima University, Hiroshima 734‑8553, Japan, Department of Biochemistry and Molecular Biology, Nihon University School of Dentistry at Matsudo, Matsudo, Chiba 271‑8587, Japan, Two Cells Co., Ltd., Hiroshima 734‑0816, Japan, Natural Science Center for Basic Research and Development, Hiroshima University, Hiroshima 734‑8553, Japan, Department of Dental Public Health, Faculty of Dental Medicine, Airlangga University, Surabaya, East Java 60132, Indonesia, Department of Conservative Dentistry, Faculty of Dental Medicine, Airlangga University, Surabaya, East Java 60132, Indonesia
    Copyright: © Fujii et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 350-358
    |
    Published online on: February 16, 2018
       https://doi.org/10.3892/br.2018.1066
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Dental pulp cells (DPCs) are promising candidates for use as transplantable cells in regenerative medicine. However, ex vivo expansion of these cells typically requires culture media containing fetal bovine serum, which may cause infection and immunological reaction following transplantation. In addition, the proliferation and differentiation of DPCs markedly depend upon serum batches. Therefore, the present study examined whether DPCs could be expanded under serum‑free conditions. DPCs obtained from four donors were identified to proliferate actively in the serum‑free medium, STK2, when compared with those cells in control medium (Dulbecco's modified Eagle's medium containing 10% serum). The high proliferative potential with STK2 was maintained through multiple successive culture passages. DNA microarray analyses demonstrated that the gene expression profile of DPCs grown in STK2 was similar to that of cells grown in the control medium; however, a number of genes related to cell proliferation, including placental growth factor and inhibin‑βE, were upregulated in the STK2 cultures. Following induction of osteogenesis, DPCs grown in STK2 induced alkaline phosphatase activity and calcification at higher levels compared with the control medium cultures, indicating maintenance of differentiation potential in STK2. This serum‑free culture system with DPCs may have applications in further experimental studies and as a clinical strategy in regenerative medicine.

Introduction

Dental pulp cells (DPCs), the resident mesenchymal stromal cells in dental pulp tissue, may be isolated as migrating cells from pulp tissue explants or as colony-forming cells in low-density cultures (1,2). These cells are able to differentiate into dentin, bone, periodontal ligament, fat, vascular cells and nerve-like cells in vitro and in vivo (1,3–15). DPCs and bone marrow-derived mesenchymal stem cells (BM-MSCs) have similar differentiation potentials, though the growth activity of DPCs may be greater than that of BM-MSCs (1,13,16).

DPCs, as well as BM-MSCs, are promising in cell-based therapy for various diseases including ischemia (6) and spinal cord injury (15). Fetal bovine serum (FBS) has been used for ex vivo expansion of DPCs; however, this carries a risk of contamination with prions or viruses. Furthermore, the proliferation activity and differentiation potential of DPCs depends upon the batch of serum (17). Therefore, serum-free, chemically defined media should be used for the expansion of DPCs destined for clinical application (17).

A range of serum-free media have been developed for culturing adult and embryonic stem cells (17). In the present study, a culture of DPCs under serum-free conditions was attempted using STK2, a serum-free medium for BM-MSCs. Previous studies have demonstrated that STK2 is suitable for ex vivo expansion of BM-MSCs. For instance, when compared with Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS, STK2 further increased the proliferation of BM-MSCs (18), but did not promote the growth of immortalized human gingival fibroblasts or cancer cell lines (19). In addition, neural crest and endometrial carcinoma cells grown in STK2 exhibited mesenchymal-like features (20,21). Therefore, the present study examined whether STK2 could support the proliferation of human DPCs. In addition, the differentiation ability of DPCs grown in STK2 was assessed.

Materials and methods

Culture media

STK2 was purchased from DS Pharma Biomedical (Osaka Japan). DMEM (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) supplemented with 10% FBS (HyClone; GE Healthcare Life Sciences, Logan, UT, USA) and 1X antibiotic-antimycotic containing 100 U/ml penicillin, 100 g/ml streptomycin and 0.25 g/ml amphotericin B (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used as control medium. α-minimal essential medium (α-MEM) supplemented with 10% FBS, 100 nM dexamethasone (Sigma-Aldrich; Merck KGaA), 50 mg/l ascorbic acid 2-phosphate (Sigma-Aldrich; Merck KGaA) and 10 mM β-glycerophosphate (Tokyo Chemical Industry, Co., Ltd., Tokyo, Japan) was used for induction of osteogenesis.

Cells

Healthy upper third molars were obtained from 4 healthy female donors (aged 23–27 years) at Hiroshima University Hospital (Hiroshima, Japan) from April 2008 to March 2009 with informed consent following a protocol approved by the Ethics Committee at Hiroshima University (approval no. D88-2). Fibroblast-like cells were grown out from tooth pulp tissue explants individually derived from the donors and were used as DPC lines (DPCs-2, DPCs-3, DPCs-4 and DPCs-5), as previously described (22). BM-MSCs (lot no. OF3853) from a 20-year-old female donor were obtained from Lonza Group, Ltd. (Basel, Switzerland).

Cell growth

The DPCs grown out from tissue explants were harvested with 0.2% trypsin and 0.02% EDTA in phosphate-buffered saline (PBS). The cells were seeded onto 10 cm plastic tissue culture dishes at a 1:5 split ratio and incubated with 10 ml DMEM supplemented with 10% FBS (DMEM/10% FBS) at 37°C in 95% air and 5% CO2. For experimentation, cells obtained from 3rd-6th passage cultures were seeded at 5×103 cells/cm2 into each well of a 12-well plate (Corning Incorporated, Corning, NY, USA) with 1.0 ml STK2 or DMEM/10% FBS. The cultures were fed with the respective media every 2–3 days. When cultures became 80–90% confluent, the cells were incubated with Accutase (Innovative Cell Technologies, Inc., San Diego, CA, USA) for 3 min at 37°C, and the number of dispersed cells was counted. These cells were then sub-cultured at the same initial density with the respective media, and cell counting was repeated as above until the experiment endpoint (37 days).

For a Cell Counting Kit-8 (CCK-8) assay, DPCs obtained from 4th-6th passage cultures were seeded on 96-well plates (Corning Incorporated) at 5×103, 1×104 or 2×104 cells/cm2, and incubated in 0.1 ml STK2 or DMEM/10% FBS at 37°C in 95% air and 5% CO2. The human BM-MSCs were also used as a positive control. At 7 days after cell seeding, 0.01 ml of a WST-8 solution (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was added to the culture medium, and the cultures were incubated for 1 h at 37°C in 95% air and 5% CO2. The absorbance of the medium at 450 nm was measured with a microplate reader (VersaMax; Molecular Devices, LLC, Sunnyvale, CA, USA).

Alizarin Red S staining

DPCs were seeded on 24-well plates at 5×103 cells/cm2 and incubated for 7 days in 0.5 ml STK2 or DMEM/10% FBS at 37°C in 95% and 5% CO2. When the cultures became 100% confluent, cells were incubated with osteogenesis induction medium for 14, 21 and 28 days. The cell layers were washed twice with PBS, and fixed with 97% ethanol for 10 min at room temperature. They were then washed twice with PBS, and incubated for 30 min with 1% Alizarin Red S solution (Sigma-Aldrich; Merck KGaA) at room temperature. Finally, the cell layers were washed with water, and the red staining indicating calcium deposition was observed by naked eye.

Alkaline phosphatase (ALP) activity

DPCs were seeded on 48-well plates at 5×103 cells/cm2 and incubated in 0.3 ml STK2 or DMEM/10% FBS at 37°C in 95% air and 5% CO2. When the cultures became confluent, cells were incubated with osteogenesis induction medium for 0, 4, 8, 12 and 16 days. The cell layers were washed twice with saline, incubated for 15 min with 0.25 ml 1% Nonidet P-40 (NP-40) solution (Sigma-Aldrich; Merck KGaA), and then homogenized with the same solution for 1 min on ice. Using the cell extract and LabAssay ALP (Wako Pure Chemical Industries, Ltd., Osaka, Japan), ALP activity was determined according to the manufacturer's instructions. In this assay, p-nitrophenylphosphate is hydrolyzed into p-nitrophenol and phosphoric acid by ALP. The released p-nitrophenol exhibiting yellow color was optically measured at 405 nm as the enzyme activity. The quantity of DNA in the cell extract was determined using a Quant-iT PicoGreen dsDNA Assay kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Fluorescence was measured at an excitation of 480 nm and emission of 520 nm. Enzyme activity was expressed as nmol/min/µg DNA.

DNA microarray

DPCs-2, −3 and −4 from 5th passage cultures were seeded on 10 cm plastic tissue culture dishes at 5×103 cells/cm2 and incubated in STK2 or DMEM/10% FBS at 37°C in 95% air and 5% CO2. Total RNA was isolated with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.,), an RNeasy Mini kit (Qiagen, Inc., Valencia, CA, USA) and a TURBO DNA-Free kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) 24 h after the cultures became confluent. cDNA was synthesized using a GeneAmp RNA PCR kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). Labeled cRNA was synthesized using a Quick Amp Labeling kit (Agilent Technologies, Inc., Santa Clara, CA, USA), and hybridization was performed on a DNA microarray (SurePrint G3 Human, 8×60k; Agilent Technologies, Inc.), according to the manufacturer's protocols. Finally, the mRNA expression levels were analyzed using Agilent GeneSpring GX version 12 software (Agilent Technologies, Inc.). A correlation coefficient was calculated in GeneSpring to compare the gene expression profiles in DPCs cultured in DMEM/10% FBS with those in DPCs cultured in STK2. The resulting raw data have been deposited in the Gene Expression Omnibus database (GSE97199; http://www.ncbi.nlm.nih.gov/geo/) (23).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated as described above and cDNA was synthesized using the GeneAmp RNA PCR kit as described previously (24). Quantitative real-time PCR analysis was performed using an ABI Prism 7900HT Sequence Detection System with the included software (SDS version 2.4; Applied Biosystems; Thermo Fisher Scientific, Inc.,), based on the ΔΔCq method (25). The cDNA was amplified using a Universal PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) with appropriate forward and reverse primers (Table I) with a primer kit for eukaryotic 18S rRNA (Applied Biosystems; Thermo Fisher Scientific, Inc.) used as an endogenous control. The PCR cycling conditions comprised of incubation at 50°C for 2 min, denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. TaqMan probes (Table I) were purchased from Roche Diagnostics (Basel, Switzerland). Data were normalized against 18S ribosomal RNA levels.

Table I.

Primer and probe sequences used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primer and probe sequences used for reverse transcription-quantitative polymerase chain reaction.

GenePrimer (5′-3′)Roche universal probe no.
TXNIPF: CTTCTGGAAGACCAGCCAAC85
R: GAAGCTCAAAGCCGAACTTG
PGA3F: CCCGTCTTTGACAACATCTG81
R: ATCACCACGCTGCCACTC
TNNT1F: GACTACATGGGGGAGGAACA17
R: GCCATCAGGTCGAACTTCTC
SCRG1F: TGTTACTGCAACTTCAGCGAAT44
R: TTGCAAGGAATCACGAAAGA
INHBEF: CAGGGAGTGTGGCTCCAG52
R: TGTAGGCTGAAGTGGAGTCTGT
GLI1F: CAGGGAGGAAAGCAGACTGA76
R: ACTGCTGCAGGATGACTGG

[i] TXNIP, thioredoxin interacting protein; PGA3, pepsinogen 3; TNNT1, troponin T type 1 (skeletal, slow); SCRG1, stimulator of chondrogenesis 1; INHBE, inhibin-βE; GLI1, GLI family zinc finger 1; F, forward; R, reverse.

Statistical analysis

Experiments were performed at least in triplicate. Results are expressed as the mean ± standard deviation. Differences between groups were analyzed by two-way analysis of variance (ANOVA) with Sidak's post hoc test for multiple comparisons. In all analyses, P<0.05 indicated statistically significant differences between values.

Results

STK2 medium enhances the proliferation of DPCs

The effects of STK2 on the proliferation of four DPC lines (DPCs-2, DPCs-3, DPCs-4 and DPCs-5) were examined. These cells were seeded at low, medium or high density (5×103, 1×104 or 2×104 cells/cm2, respectively) and incubated in STK2 or DMEM/10% FBS. Cell numbers were determined by CCK-8 assay on day 7. The majority of the cell lines exhibited higher growth rates in STK2 than in DMEM/10% FBS under conditions of low and medium initial cell densities (Fig. 1A-D). However, at high initial cell density, STK2 did not enhance the growth rates of the DPCs-3 and DPCs-4 cell lines compared with DMEM/10% FBS (Fig. 1B and C). By contrast, STK2 enhanced the proliferation of human BM-MSCs at the low, medium and high initial cell densities, compared with DMEM/10% FBS (P<0.0001; Fig. 1E). In addition, at the low initial density, DPCs-5 cells obtained from 3rd-6th passage continued to proliferate actively in STK2 through successive passages (Fig. 2).

Figure 1.

Effects of STK2 on the proliferation of four DPC lines. The DPC lines (A) DPCs-2, (B) DPCs-3, (C) DPCs-4 and (D) DPCs-5, and (E) BM-MSCs were seeded at the indicated initial densities and exposed to DMEM/10% FBS or STK2. Cell number was estimated on day 7 by Cell Counting Kit-8 assay. Values are the means ± standard deviation of at least three replicate cultures. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 vs. DMEM/10% FBS at the same cell density. DPCs, dental pulp cells; BM-MSCs, bone marrow-derived mesenchymal stem cells; DMEM/10% FBS, Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum.

Figure 2.

Growth curve of DPCs grown in STK2. DPCs-5 cells were seeded at low density (5×103 cells/cm2) and exposed to STK2. When the cultures approached confluence, the cells were harvested with Accutase and a population was transferred into a new dish with STK2 to allow continued cell growth. The cumulative cell numbers are shown. Values are the means ± standard deviation of four replicate cultures. DPCs, dental pulp cells.

Comparison of gene expression levels in cells cultured in DMEM/10% FBS or STK2

The gene expression profiles of DPCs (DPCs-2, −3 and −4) that had been grown in STK2 or DMEM/10% FBS were compared. Overall, the gene expression profile was only marginally altered by the medium (correlation coefficient between the two media = 0.97 to 0.99; data not shown). A total of 155, 38 and 8 genes were upregulated by more than 2-, 5- and 10-fold, respectively, in DPCs grown in STK2, while 254, 106 and 37 genes were downregulated by more than 2-, 5- and 10-fold, respectively. Tables II and III list the top 20 genes upregulated and downregulated by STK2, respectively. The upregulated genes included those involved in proliferation [including thioredoxin interacting protein (TXNIP), platelet factor 4 variant 1, placental growth factor and inhibin-βE (INHBE)], metabolism [including pepsinogen 3 (PGA3) and alcohol dehydrogenase 1A] and differentiation [including troponin T type 1 (TNNT1), stimulator of chondrogenesis 1 (SCRG1), hairy/enhancer-of-split related with YRPW motif 1 and GLI family zinc finger 1 (GLI1)]. Indeed, the mRNA levels of TXNIP, PGA3, TNNT1, SCRG1, INHBE and GLI1 were increased in DPCs grown in STK2, compared with their levels in DMEM/10% FBS cultures, as confirmed by RT-qPCR (Fig. 3).

Figure 3.

RT-qPCR analyses of gene expression in DPCs grown in DMEM/10% FBS or STK2. DPCs (DPCs-2, DPCs-3 and DPCs-4) were cultured in DMEM/10% FBS or STK2 for 7 days. The mRNA levels of (A) TXNIP, (B) PGA3, (C) TNNT1, (D) SCRG1, (E) INHBF and (F) GLI1 were quantified by RT-qPCR analysis. Values are the means ± standard deviation of four replicate cultures. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 vs. DMEM/10% FBS in the same cell line. DPCs, dental pulp cells; DMEM/10% FBS, Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum; TXNIP, thioredoxin interacting protein; PGA3, pepsinogen 3; TNNT1, troponin T type 1; SCRG1, stimulator of chondrogenesis 1; INHBE, inhibin-βE; GLI1, GLI family zinc finger 1; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

Table II.

Top 20 upregulated genes in dental pulp cells grown in STK2 relative to those in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum.

Table II.

Top 20 upregulated genes in dental pulp cells grown in STK2 relative to those in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum.

Gene symbolGene nameNCBI IDFold change
TXNIPThioredoxin interacting proteinNM_006472101.0
PGA3Pepsinogen 3NM_001079807   23.0
TNNT1Troponin T type 1NM_003283   19.2
SCRG1Stimulator of chondrogenesis 1NM_007281   17.9
HEY1 Hairy/enhancer-of-split related with YRPW motif 1NM_001040708   15.0
ADH1AAlcohol dehydrogenase 1ANM_000667   12.7
PF4V1Platelet factor 4 variant 1NM_002620   11.2
PGFPlacental growth factorNM_002632   10.8
INHBEInhibin-βENM_031479     9.8
GLI1GLI family zinc finger 1NM_005269     9.7
PLAC1Placenta-specific 1NM_021796     9.2
NDUFA4L2NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2NM_020142     8.8
FER1L4Fer-1-like protein 4NR_024377     8.7
LRRC15Leucine rich repeat containing 15NM_130830     8.6
ZP1Zona pellucida glycoprotein 1NM_207341     8.4
ADH1CAlcohol dehydrogenase 1CNM_000669     8.2
MGC16121Hypothetical protein MGC16121NR_024607     8.1
ANXA8L2Annexin A8-like 2NM_001630     8.0
CA9Carbonic anhydrase IXNM_001216     7.5
BCL11AB-cell CLL/lymphoma 11ANM_022893     7.4

Table III.

Top 20 downregulated genes in dental pulp cells grown in STK2 relative to those in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum.

Table III.

Top 20 downregulated genes in dental pulp cells grown in STK2 relative to those in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum.

Gene symbolGene nameNCBI IDFold change
HTR2B5-Ηydroxytryptamine receptor 2BNM_00086751.0
GPNMBGlycoprotein nmbNM_00100534045.4
NPTX1Neuronal pentraxin INM_00252238.8
NTN1Netrin 1NM_00482236.3
SLC16A6Solute carrier family 16 member 6NM_00469435.5
PTGDSProstaglandin D2 synthaseNM_00095432.8
RRAGDRas-related GTP binding DNM_02124430.4
A2M α2-macroglobulinNM_00001430.1
CLDN1Claudin 1NM_02110124.0
SPON2Spondin 2NM_01244523.2
NFIBNuclear factor I/BNM_00559623.2
BIRC3Baculoviral IAP repeat-containing 3NM_00116522.2
KCNJ2Potassium voltage-gated channel subfamily J member 2NM_00089121.2
MALLMal, T-cell differentiation protein-likeNM_00543419.5
GRIA4Glutamate ionotropic receptor AMPA type subunit 4NM_00107724418.5
SLC7A14Solute carrier family 7 member 14NM_02094918.1
SCG2Secretogranin IINM_00346917.9
AGT AngiotensinogenNM_00002917.9
GPX3Glutathione peroxidase 3NM_00208417.3
ANO1Anoctamin 1NM_01804315.4
STK2 medium enhances osteogenic differentiation in DPCs

Subsequently, it was determined whether DPCs incubated in STK2 maintained their differentiation potential via Alizarin Red S staining (Fig. 4). DPCs (DPCs-2, −3, −4 and −5) were seeded at a low density and expanded for 7 days in STK2 or DMEM/10% FBS. When these cultures became confluent, they were exposed to osteogenesis induction medium for up to 28 days. On days 21 and 28, DPCs-2 and DPCs-3 expanded in STK2 exhibited more extensive calcification than those expanded in DMEM/10% FBS (Fig. 4A and B), while DPCs-4 exhibited extensive calcification on days 21 and 28 irrespective of the medium (Fig. 4C), probably due to the higher differentiation potential of this cell line. The calcification level of DPCs-5 grown in STK2 was higher than that of cells grown in DMEM/10 FBS on day 28 but lower on day 21 (Fig. 4D).

Figure 4.

Effects of pre-culture in STK2 on calcification in DPCs. The DPC lines (A) DPCs-2, (B) DPCs-3, (C) DPCs-4 and (D) DPCs-5 were seeded at low density (5×103 cells/cm2) and pre-cultured for 7 days in DMEM/10% FBS or STK2. When cultures reached confluence, the cells were cultured in osteogenesis induction medium for up to 28 days. The calcified matrix was stained with Alizarin Red S on the indicated days following the exposure to osteogenesis induction medium. DPCs, dental pulp cells; DMEM/10% FBS, Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum.

The effects of STK2 pre-culture on ALP activity were also assessed. Following exposure of the cell cultures to osteogenesis induction medium, ALP activity began to increase on day 4 or 8, depending on the cell line and medium (Fig. 5). All cell lines grown in STK2 exhibited greater ALP activity than those grown in DMEM/10% FBS (Fig. 5).

Figure 5.

Effects of pre-culture in STK2 on ALP activity in DPCs. The dental pulp cell lines (A) DPCs-2, (B) DPCs-3, (C) DPCs-4 and (D) DPCs-5 were seeded at low density (5×103 cells/cm2) and pre-cultured for 7 days in DMEM/10% FBS or STK2. When cultures reached confluence, the cells were cultured in osteogenesis induction medium for up to 16 days. ALP activity was determined on the indicated days following the exposure to osteogenesis induction medium. Values are the means ± standard deviation of four replicate cultures. *P<0.05, **P<0.01, ***P<0.001 and ****P<0.0001 vs. DMEM/10% FBS on the same day. ALP, alkaline phosphatase; DPCs, dental pulp cells; DMEM/10% FBS, Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum.

Discussion

DPCs have been reported to have stem cell-like properties (6,7,10,15,26), and are thereby expected to be a source of transplantable cells in regenerative medicine for dental (7,9,27), bone (10,11), vascular (6,12) and nerve diseases (26,28). However, it is necessary for safe and stable cell therapy to establish a serum-free culture system for DPCs, since the use of serum has the potential risk of viral contamination and the components in serum vary depending on batch. In the present study, human DPCs were successfully cultured in a serum-free condition. DPCs were efficiently grown in STK2 with maintained osteogenic potential. This finding may promote clinical applications of DPCs in regenerative medicine.

Various serum-free media have a lower proliferation-promoting activity than serum-containing media. However, in the current study, DPCs generally proliferated at a higher rate in STK2 than in DMEM/10% FBS. The increased proliferation in STK2 was consistently observed with the four DPC lines examined, even though an optimum batch of FBS was used, selected from more than 10 batches. It may be speculated that FBS contains not only growth factors but also growth inhibitors and proteases, which decrease the growth rate of DPCs.

DNA microarray analysis demonstrated that the gene expression profiles of DPCs grown in STK2 and DMEM/10% FBS were similar. Thus, STK2 did not induce gross changes in the phenotypic expression of DPCs even in the absence of serum, suggesting that STK2 may be used for routine cultures of DPCs. It was identified that the number of downregulated genes was greater than that of upregulated genes in STK2 cultures, relative to DMEM/10% FBS cultures, which may be due to the absence of certain serum compounds, including proteins and other biologically active molecules, in the serum-free medium. While most genes exhibited no marked changes in gene expression levels, 38 genes were upregulated more than 5-fold in STK2-cultured cells. Some of these genes, including placental growth factor and INHBE, may account for the growth-promoting effect of STK2. Further experiments, including small interfering RNA knockdowns, are required to reveal which upregulated genes serve a role in the STK2-mediated simulation of proliferation.

Another important finding was the maintenance of the differentiation potential of DPCs under serum-free conditions. DPCs expanded in STK2 generally exhibited greater increases in ALP activity and calcified matrix following exposure to osteogenesis induction medium than cells expanded in DMEM/10% FBS. This may be due to the presence of certain proteins in serum, but not in STK2, that decrease the osteogenic potential of DPCs. DPCs are able to differentiate into adipocytes, chondrocytes and neural cells as well as osteoblasts (1,11). In future studies, our group plans to assess whether DPCs expanded in STK2 maintain their potency for differentiation into these cell types.

STK2 was originally developed using human BM-MSCs in order to create a serum-free culture medium for MSCs (17). Indeed, STK2 has been reported to exert a significantly greater proliferation effect on BM-MSCs compared with DMEM/10% FBS or Lonza MSCGMTM MSC growth medium (18). In addition, Sawada et al (29) demonstrated that a number of genes related to cell proliferation, including insulin-like growth factor binding protein 6, NRAS proto-oncogene, phosphoinositide-3-kinase regulatory subunit 3 and Jun proto-oncogene, were upregulated in BM-MSCs following culture in STK2 through DNA microarray analysis. However, these upregulated genes were not similar to those of the present study, probably due to differences in experimental conditions. The present study assessed DPCs in STK2 culture for 7 days, whereas Sawada's group used BM-MSCs cultured in STK2 for 50 days. Although it is difficult to directly compare the effect of STK2 on human DPCs and BM-MSCs due to inter-individual variations, STK2 appeared to be more effective for BM-MSCs than for DPCs in the current assays, since STK2 enhanced the proliferation of human BM-MSCs under all conditions of initial cell density. Modifications of the composition of STK2 may be required to optimize the expansion and differentiation of DPCs, despite STK2 being sufficient in supporting proliferation and maintaining the differentiation potency of DPCs.

A recent study demonstrated that STK2 could induce differentiation into mesenchymal-like cells; by culturing in STK2, human pluripotent stem cells-derived neural crest cells were induced into MSCs, which expressed specific cell surface markers and were able to differentiate into osteogenic, chondrogenic and adipogenic cells (20). In addition, STK2 induced the epithelial-mesenchymal transition when endometrial carcinoma cell lines transformed into mesenchymal-like cells (21). In the current study, it was demonstrated that DPCs proliferated more actively in STK2 than in DMEM/10% FBS while maintaining their osteogenic potential. Therefore, the serum-free culture system with STK2 may be useful for basic experimental research and cell therapy applications with DPCs as well as BM-MSCs.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Grant-in-Aid for Challenging Exploratory Research (grant no. 24659876) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

Availability of data and materials

The datasets generated and/or analyzed during the current study are available in the Gene Expression Omnibus (GEO) repository, with accession number GSE97199 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE97199).

Authors' contributions

SF, KF, FN and YK conceived and designed the experiments. SF, NG, AI, KK, MK, AS and KS performed the experiments. SF, KF, YA, AI and MK analyzed the data, and SF, KF, NG, JS, MK and YK interpreted the data. JS and KK contributed reagents/materials/analysis tools. SF, KF and YK wrote the paper.

Ethics approval and consent to participate

Ethical approval for the study protocols was provided by Hiroshima University according to the guidelines of its Ethics Committee (approval no. D88-2). The healthy samples from donors at Hiroshima University Hospital were obtained with informed consent. The donor sample from Lonza Group, Ltd. (Basel, Switzerland) was initially donated after obtaining permission for research use by informed consent and legal authorization.

Consent for publication

Not applicable.

Competing interests

YK is a director of Two Cells Co., Ltd., and JS is an employee of Two Cells Co., Ltd. All other authors declare no competing interests.

Glossary

Abbreviations

Abbreviations:

DPCs

dental pulp cells

BM-MSCs

bone marrow-derived mesenchymal stem cells

FBS

fetal bovine serum

DMEM

Dulbecco's modified Eagle's medium

α-MEM

α-minimal essential medium

PBS

phosphate-buffered saline

DMEM/10% FBS

DMEM supplemented with 10% FBS

CCK-8

Cell Counting Kit-8

ALP

alkaline phosphatase

RT-qPCR

reverse transcription-quantitative polymerase chain reaction

TXNIP

thioredoxin interacting protein

PGA3

pepsinogen 3

TNNT1

troponin T type 1

SCRG1

stimulator of chondrogenesis 1

INHBE

inhibin-βE

GLI1

GLI family zinc finger 1

References

1 

Gronthos S, Mankani M, Brahim J, Robey PG and Shi S: Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci USA. 97:pp. 13625–13630. 2000; View Article : Google Scholar : PubMed/NCBI

2 

Stanislawski L, Carreau JP, Pouchelet M, Chen ZH and Goldberg M: In vitro culture of human dental pulp cells: Some aspects of cells emerging early from the explant. Clin Oral Investig. 1:131–140. 1997. View Article : Google Scholar : PubMed/NCBI

3 

Couble ML, Farges JC, Bleicher F, Perrat-Mabillon B, Boudeulle M and Magloire H: Odontoblast differentiation of human dental pulp cells in explant cultures. Calcif Tissue Int. 66:129–138. 2000. View Article : Google Scholar : PubMed/NCBI

4 

He H, Yu J, Liu Y, Lu S, Liu H, Shi J and Jin Y: Effects of FGF2 and TGFbeta1 on the differentiation of human dental pulp stem cells in vitro. Cell Biol Int. 32:827–834. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Iohara K, Zheng L, Ito M, Tomokiyo A, Matsushita K and Nakashima M: Side population cells isolated from porcine dental pulp tissue with self-renewal and multipotency for dentinogenesis, chondrogenesis, adipogenesis, and neurogenesis. Stem Cells. 24:2493–2503. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Iohara K, Zheng L, Wake H, Ito M, Nabekura J, Wakita H, Nakamura H, Into T, Matsushita K and Nakashima M: A novel stem cell source for vasculogenesis in ischemia: Subfraction of side population cells from dental pulp. Stem Cells. 26:2408–2418. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Iohara K, Imabayashi K, Ishizaka R, Watanabe A, Nabekura J, Ito M, Matsushita K, Nakamura H and Nakashima M: Complete pulp regeneration after pulpectomy by transplantation of CD105+ stem cells with stromal cell-derived factor-1. Tissue Eng Part A. 17:1911–1920. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Min JH, Ko SY, Cho YB, Ryu CJ and Jang YJ: Dentinogenic potential of human adult dental pulp cells during the extended primary culture. Hum Cell. 24:43–50. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Shi S, Bartold PM, Miura M, Seo BM, Robey PG and Gronthos S: The efficacy of mesenchymal stem cells to regenerate and repair dental structures. Orthod Craniofac Res. 8:191–199. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Sloan AJ and Waddington RJ: Dental pulp stem cells: What, where, how? Int J Paediatr Dent. 19:61–70. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Spath L, Rotilio V, Alessandrini M, Gambara G, De Angelis L, Mancini M, Mitsiadis TA, Vivarelli E, Naro F, Filippini A and Papaccio G: Explant-derived human dental pulp stem cells enhance differentiation and proliferation potentials. J Cell Mol Med. 14(6b): 1–1644. 2010.

12 

Tran-Hung L, Mathieu S and About I: Role of human pulp fibroblasts in angiogenesis. J Dent Res. 85:819–823. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Yamada Y, Fujimoto A, Ito A, Yoshimi R and Ueda M: Cluster analysis and gene expression profiles: A cDNA microarray system-based comparison between human dental pulp stem cells (hDPSCs) and human mesenchymal stem cells (hMSCs) for tissue engineering cell therapy. Biomaterials. 27:3766–3781. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Liu H, Gronthos S and Shi S: Dental pulp stem cells. Methods Enzymol. 419:99–113. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Sakai K, Yamamoto A, Matsubara K, Nakamura S, Naruse M, Yamagata M, Sakamoto K, Tauchi R, Wakao N, Imagama S, et al: Human dental pulp-derived stem cells promote locomotor recovery after complete transection of the rat spinal cord by multiple neuro-regenerative mechanisms. J Clin Invest. 122:80–90. 2012.PubMed/NCBI

16 

Nakamura S, Yamada Y, Katagiri W, Sugito T, Ito K and Ueda M: Stem cell proliferation pathways comparison between human exfoliated deciduous teeth and dental pulp stem cells by gene expression profile from promising dental pulp. J Endod. 35:1536–1542. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Gottipamula S, Muttigi MS, Kolkundkar U and Seetharam RN: Serum-free media for the production of human mesenchymal stromal cells: A review. Cell Prolif. 46:608–627. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Ishikawa I, Sawada R, Kato Y, Tsuji K, Shao J, Yamada T, Kato R and Tsuchiya T: Effectivity of the novel serum-free medium STK2 for proliferating human mesenchymal stem cells. Yakugaku Zasshi. 129:381–384. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Tsugeno Y, Sato F, Muragaki Y and Kato Y: Cell culture of human gingival fibroblasts, oral cancer cells and mesothelioma cells with serum-free media, STK1 and STK2. Biomed Rep. 2:644–648. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Fukuta M, Nakai Y, Kirino K, Nakagawa M, Sekiguchi K, Nagata S, Matsumoto Y, Yamamoto T, Umeda K, Heike T, et al: Derivation of mesenchymal stromal cells from pluripotent stem cells through a neural crest lineage using small molecule compounds with defined media. PLoS One. 9:e1122912014. View Article : Google Scholar : PubMed/NCBI

21 

Inoue H, Takahashi H, Hashimura M, Eshima K, Akiya M, Matsumoto T and Saegusa M: Cooperation of Sox4 with β-catenin/p300 complex in transcriptional regulation of the Slug gene during divergent sarcomatous differentiation in uterine carcinosarcoma. BMC Cancer. 16:532016. View Article : Google Scholar : PubMed/NCBI

22 

Fujii S, Fujimoto K, Goto N, Kanawa M, Kawamoto T, Pan H, Srivatanakul P, Rakdang W, Pornprasitwech J, Saskianti T, et al: Characteristic expression of MSX1, MSX2, TBX2 and ENTPD1 in dental pulp cells. Biomed Rep. 3:566–572. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Edgar R, Domrachev M and Lash AE: Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res. 30:207–210. 2002. View Article : Google Scholar : PubMed/NCBI

24 

Sasamoto T, Fujimoto K, Kanawa M, Kimura J, Takeuchi J, Harada N, Goto N, Kawamoto T, Noshiro M, Suardita K, et al: DEC2 is a negative regulator for the proliferation and differentiation of chondrocyte lineage-committed mesenchymal stem cells. Int J Mol Med. 38:876–884. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Nakashima M, Iohara K and Sugiyama M: Human dental pulp stem cells with highly angiogenic and neurogenic potential for possible use in pulp regeneration. Cytokine Growth Factor Rev. 20:435–440. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Nakashima M, Iohara K, Murakami M, Nakamura H, Sato Y, Ariji Y and Matsushita K: Pulp regeneration by transplantation of dental pulp stem cells in pulpitis: A pilot clinical study. Stem Cell Res Ther. 8:612017. View Article : Google Scholar : PubMed/NCBI

28 

Song M, Lee JH, Bae J, Bu Y and Kim EC: Human dental pulp stem cells are more effective than human bone marrow-derived mesenchymal stem cells in cerebral ischemic injury. Cell Transplant. 26:1001–1016. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Sawada R, Yamada T, Tsuchiya T and Matsuoka A: Microarray analysis of the effects of serum-free medium on gene expression changes in human mesenchymal stem cells during the in vitro culture. Yakugaku Zasshi. 130:1387–1393. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Fujii S, Fujimoto K, Goto N, Abiko Y, Imaoka A, Shao J, Kitayama K, Kanawa M, Sosiawan A, Suardita K, Suardita K, et al: Characterization of human dental pulp cells grown in chemically defined serum‑free medium. Biomed Rep 8: 350-358, 2018.
APA
Fujii, S., Fujimoto, K., Goto, N., Abiko, Y., Imaoka, A., Shao, J. ... Kato, Y. (2018). Characterization of human dental pulp cells grown in chemically defined serum‑free medium. Biomedical Reports, 8, 350-358. https://doi.org/10.3892/br.2018.1066
MLA
Fujii, S., Fujimoto, K., Goto, N., Abiko, Y., Imaoka, A., Shao, J., Kitayama, K., Kanawa, M., Sosiawan, A., Suardita, K., Nishimura, F., Kato, Y."Characterization of human dental pulp cells grown in chemically defined serum‑free medium". Biomedical Reports 8.4 (2018): 350-358.
Chicago
Fujii, S., Fujimoto, K., Goto, N., Abiko, Y., Imaoka, A., Shao, J., Kitayama, K., Kanawa, M., Sosiawan, A., Suardita, K., Nishimura, F., Kato, Y."Characterization of human dental pulp cells grown in chemically defined serum‑free medium". Biomedical Reports 8, no. 4 (2018): 350-358. https://doi.org/10.3892/br.2018.1066
Copy and paste a formatted citation
x
Spandidos Publications style
Fujii S, Fujimoto K, Goto N, Abiko Y, Imaoka A, Shao J, Kitayama K, Kanawa M, Sosiawan A, Suardita K, Suardita K, et al: Characterization of human dental pulp cells grown in chemically defined serum‑free medium. Biomed Rep 8: 350-358, 2018.
APA
Fujii, S., Fujimoto, K., Goto, N., Abiko, Y., Imaoka, A., Shao, J. ... Kato, Y. (2018). Characterization of human dental pulp cells grown in chemically defined serum‑free medium. Biomedical Reports, 8, 350-358. https://doi.org/10.3892/br.2018.1066
MLA
Fujii, S., Fujimoto, K., Goto, N., Abiko, Y., Imaoka, A., Shao, J., Kitayama, K., Kanawa, M., Sosiawan, A., Suardita, K., Nishimura, F., Kato, Y."Characterization of human dental pulp cells grown in chemically defined serum‑free medium". Biomedical Reports 8.4 (2018): 350-358.
Chicago
Fujii, S., Fujimoto, K., Goto, N., Abiko, Y., Imaoka, A., Shao, J., Kitayama, K., Kanawa, M., Sosiawan, A., Suardita, K., Nishimura, F., Kato, Y."Characterization of human dental pulp cells grown in chemically defined serum‑free medium". Biomedical Reports 8, no. 4 (2018): 350-358. https://doi.org/10.3892/br.2018.1066
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team