Open Access

Allicin suppresses the migration and invasion in cervical cancer cells mainly by inhibiting NRF2

  • Authors:
    • Qiumei Zhang
    • Dongmei Yang
  • View Affiliations

  • Published online on: December 17, 2018     https://doi.org/10.3892/etm.2018.7104
  • Pages: 1523-1528
  • Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Emerging evidence has demonstrated the antitumor activity of allicin in various tumors. However, little study has been carried out on the functional role of allicin in cervical cancer. Our data showed that allicin suppressed cervical cancer cell viability in a time‑ and dose‑dependent manner. Allicin treatment could reverse H2O2‑induced reactive oxygen species accumulation. Meanwhile, levels of glutathione and superoxide dismutase were increased, but malondialdehyde was decreased after allicin incubation for 48 h. Furthermore, TUNEL staining showed that H2O2 treatment induced cell apoptosis, but allicin treatment could decrease cell apoptosis. Western blot assay showed that allicin could suppress the expression of nuclear factor erythroid 2‑related factor 2 (NRF2) and heme oxygenase 1. We also showed that NRF2 prompted SiHa cell proliferation and reduced SiHa cell apoptosis. More importantly, allicin‑inactivated phosphoinositide 3‑kinase/protein kinase B (PI3K/AKT) signaling could be partially reversed by overexpressing of NRF2. We also evaluated cell apoptosis in SiHa cells transfected with plasmid NRF2. Our data showed that allicin‑induced cell apoptosis (43.5±3.8%) could largely be abolished by upregulation of NRF2 (12.3±2.08%). In summary, our data showed allicin was effective in suppressing the malignant phenotype of cervical cancer cells mainly by inhibiting the expression of NRF2, showing the potential clinical benefits of allicin in cervical cancer patients.

Introduction

Cervical cancer is one of the most common cancer among females in the world. It is estimated that approximately over 500,000 new cases are reported each year (1). Previous studies have indicated that human papilloma virus (HPV) infection is the major cause of cervical cancer (2,3). Undoubtedly, long term exposure to oxidative stress by cervical epithelial tissues will lead to the persistent, chronic viral infections, thereby causing genetic rearrangements and genomic instability due to the integration of the viral genome (4,5).

In the normal physiological status, an antioxidant system in cervical epithelial tissue can maintain the homeostasis through nuclear factor erythroid 2-related factor 2 (NRF2) (6,7). NRF2 mainly binds to the antioxidant response element (ARE) in target gene promoters thereby maintaining redox balance (8). Increasing evidence has shown that upregulation of NRF2 tightly correlated with multiple tumor development and progression (9,10). It is showed that NRF2 protects normal cells from transformation and enhances cancer cell proliferation and survival (11). Therefore, it is important to maintain NRF2 at a normal status for the prevention and treatment of cervical cancer patients.

Allicin (diallyl thiosulfinate) is the major component present in freshly crushed garlic, and it is also a key active compounds of garlic (12,13). In the past years, allicin has been extensively applied in the clinic based on the characteristics of anti-inflammatory, anti-microbial, cardiovascular protection, and immunity functions (14,15). Emerging evidence has demonstrated the antitumor activity of allicin in gastric carcinoma, breast cancer, and glioblastoma mainly by inhibiting cell proliferation and inducing cell apoptosis (16,17). However, the functional role of allicin in cervical cancer cells and the potential molecular mechanism is still unknown.

In the present study, we found that allicin significantly suppressed cervical cancer proliferation and migration mainly by inhibiting the expression of NRF2, thereby maintaining the intracellular oxidative homeostasis.

Materials and methods

Cell culture and transfections

SiHa cells (ATCC; Manassas, VA, USA), a human cervical squamous cell carcinoma cell line, were cultured in RPMI-1640 plus 10% calf serum and 1% penicillin/streptomycin in a 5% CO2 humidified incubator at 37°C.

Transient transfection

NRF2 in the eukaryotic expression vector pcDNA3.1, and NRF2 siRNA, and the scrambled sequence (CCAACCAGUUGACAGUGAACUCAUU/CAAACUGACAGAAGUUGACAAUUAU) were constructed by GenePharma (Shanghai, China).

In brief, SiHa cells were seeded in 6-well plates and grown to 60–80% confluence overnight. Transfection complexes were formed with Lipofectamine RNAiMAX (Invitrogen, CA, USA) in Opti-MEMI (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to manufacturer guidelines. All transfections were performed in triplicate. Cell proliferation was determined by counting cells 24, 48, and 72 h after transfection.

RNA isolation and qRT-PCR

Total RNA was isolated from SiHa cells using Trizol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. RNA was reverse transcribed into cDNA using the Prime-Script one-step RT-PCR kit (C28025-032, Invitrogen; Thermo Fisher Scientific, Inc.). Detailed RT-PCR procedure was described as follows: 95°C for 10 min followed by 50 cycles of 95°C for 10 sec, 55°C for 10 sec, 72°C for 5 sec; 99°C for 1 sec; 59°C for 15 sec; 95°C for 1 sec; then cooling to 40°C. The relative expression levels were calculated with the 2−∆∆Cq method and experiments were repeated in triplicate. The primers used were listed as follows: NRF2-forward primer: 5′-TCAGCGACGGAAAGAGTATGA-3′ and reverse primer: 5′-CCACTGGTTTCTGACTGGATGT-3′.

Protein isolation and western blotting

Firstly, protease inhibitors (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) were added to cell lysates and maintained on ice for 15 min. Then, cell lysates were centrifuged at 12,000 × g for 10 min at 4°C. And the supernatant was collected and were boiled for 5 min in sample buffer. All the samples were separated on 12% gels by SDS-PAGE and transferred to polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA). Then, the membranes was blocked in 10% skim milk for 40 min at 37°C. A primary antibody against NRF2 (Abcam, Cambridge, MA, USA) or β-Actin (Sangon, Shanghai, China) was added overnight to blots at 4°C. Blots were washed in PBS Tween three times, after which the secondary antibody (horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G; Zhongshan Gold Bridge, Beijing, China) was added at room temperature for 2 h. Chemiluminescent substrate (Thermo Fisher Scientific, Inc.) was added to visualize bands. Quantity One software was used to quantify the intensity of each band and was normalized to the intensity of the internal control β-actin.

Detection of reactive oxygen species

Cells were seeded at 1×104 cells per well into 96-well plates and treated with 40 nM allicin. The cells were incubated for 48 h at 37°C and 5% CO2. At the end of the incubation period, cells were washed twice in PBS and incubated in 200 µM ROS Fluorescent Probe-DHE (Vigorous, Beijing, China) for 15 min (Sigma-Aldrich; Merck KGaA).

Analyses of cell cycle and apoptotic changes by flow cytometry

SiHa cells were seeded in 6-well culture plates at a density of 5×104 cells/well in RPMI 1640 supplemented with 10% calf serum and 1% penicillin/streptomycin. After allicin treatment for 48 h, cell cycle distributions were examined by measuring PI-fluorescence with a BD FACS Calibur flow cytometer (BD Biosciences, San Jose, CA, USA) through an FL-2 filter (585 nm).

Annexin V staining was performed to evaluate apoptosis. Control and treated SiHa cells were added at 5×105 cells/ml in binding buffer (10 mM HEPES [(4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid] [Ph 7.4], 140 mM NaCl, 2.5 mM CaCl2). FITC-Annexin V (10 µl) in 190 µl of cell suspension was incubated for 10 min at room temperature. Cell mixtures were centrifuged and resuspended in 190 µl binding buffer, and 10 µl PI (1 mg/ml) solution was added. Then, the cells were washed with cold PBS and resuspended at a final concentration of 1×106 cells/ml. FITC-Annexin V (5 µl) and propidium iodide were gently mixed and incubated with the cells for 15 min at a room temperature. After incubation, the samples were analyzed by flow cytometry within 1 h. The Annexin V and PI+ represented necrotic cells, the Annexin V+ and PI+ represented late apoptotic cell, the Annexin V+ and PI represented early apoptotic cell, and the Annexin V and PI represented normal cells.

Transwell migration and invasion assays

Migration and invasion assays were performed as previously described. Migration was evaluated in Transwell cell culture chambers with 6.5-mm-diameter polycarbonate membrane filters containing 8-µm pores (Corning Incorporated, Corning, NY, USA). Cells were added in 100 ml serum-free media to the upper chamber. The lower chamber contained 600 ml culture media with 10% calf serum. After 10 h at 37°C, cells were removed from the upper surface of the membrane with a cotton swab. Filters were fixed in methanol for 20 min and stained with Giemsa solution for 30 min. The number of cells that had migrated were counted. Five random fields (Nikon ECLIPSE TS100; Nikon Corporation, Tokyo, Japan) were counted per well, and the mean was calculated. The membrane of the upper chamber of the transwell was pre-coated with 100 ml of a 1 mg/ml solution of Matrigel (BD Biosciences, Franklin Lakes, NJ, USA).

TUNEL assay

Cells were stained by terminal deoxy-nucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL; In situ Cell Death Detection kit; Roche Diagnostics, Basel, Switzerland). In brief, cells were fixed in 4% paraformaldehyde, added permeabilisation solution, and incubated with TUNEL reaction mixture. TUNEL positive cells and total cells were counted and percent apoptotic cells calculated.

Statistical analysis

The data are represented as the mean ± standard error of the mean (SEM). The two-tailed unpaired Student's t-tests were used for comparisons of two groups. The ANOVA multiple comparison test (SPSS 13.0; SPSS, Inc., Chicago, IL, USA) followed by Turkey post hoc test were used for comparisons of two more groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Allicin suppressed SiHa cell viability in time- and dose-dependent manner

Firstly, we analyzed the effects of allicin on SiHa cell viability. As shown in Fig. 1A, treatment with 5, 20 and 50 nM allicin significantly decreased cell viability by 10.2, 27.8 and 43.1%, respectively. Furthermore, incubation of 20 nM allicin reduced SiHa cell viability by 12.3, 24.3 and 38.9 at 24, 48 and 72 h (Fig. 1B).

Allicin-induced accumulation of reactive oxygen species and SiHa cell apoptosis

Next, we evaluated the role of allicin in the accumulation of ROS. Compared with blank control, H2O2 treatment markedly increased the fluorescence density of DHE, but allicin treatment could reverse H2O2-induced ROS accumulation (Fig. 2A). We also quantified the contents of glutathione (GSH), superoxide dismutase (SOD) and malondialdehyde (MDA) contents. Our data showed that H2O2 treatment decreased GSH and SOD contents, but increased MDA content (Fig. 2B-D). In contrast, GSH and SOD contents were increased, but MDA was decreased after allicin incubation for 48 h (Fig. 2B-D). Futhermore, TUNEL staining showed H2O2 treatment induced cell apoptosis, but allicin treatment could decrease cell apoptosis (Fig. 2E).

Allicin inhibited the expression of NRF2 in SiHa cells

NRF2 is a key transcription factor that is widely involved in the regulation of antioxidant genes. Thus, we evaluated the expression of NRF2 after allicin treatment. As shown in Fig. 3, treatment with allicin significantly suppressed the level of NRF2. Furthermore, heme oxygenase 1 (HO-1), an antioxidant enzyme regulated by NRF2, was decreased by allicin incubation (Fig. 3).

NRF2 prompted SiHa cell proliferation and reduced SiHa cell apoptosis

Furthermore, we explored the effects of NRF2 in SiHa cell proliferation and apoptosis. Our data showed that overexpressing NRF2 significantly enhanced SiHa cell migration and invasion capacity (Fig. 4A and B). Furthermore, overexpressing NRF2 could largely reverse H2O2-induced cell apoptosis (Fig. 4C).

Allicin suppressed the malignant phenotype of SiHa cells by inhibiting NRF2

We further evaluated whether allicin inhibits SiHa cell proliferation through suppressing NRF2. Thus, a full-length human NRF2 was successfully transfected into SiHa cells in the presence or absence of allicin. Compared with normal control, transfection of NRF2 significantly enhanced the activation of PI3K/AKT signaling (Fig. 5A). However, pre-incubation of allicin could decrease the phosphorylation levels of PI3K/AKT and the protein level of Bcl-2 (Fig. 5A). In contrast, allicin-inactivated PI3K/AKT signaling and Bcl-2 expression could partially reversed by overexpressing of NRF2 (Fig. 5A). We also evaluated cell apoptosis in SiHa cells transfected with pNRF2. Our data showed that overexpressing of NRF2 decreased cell apoptosis rate by 3.1±0.54% (Fig. 5B). More importantly, allicin-induced cell apoptosis (43.5±3.8%) could largely be abolished by upregulation of NRF2 (12.3±2.08%). These data indicated that allicin induced SiHa cell apoptosis mainly by suppressing the expression of NRF2.

Discussion

Cervical cancer is ranked as the second most common cancer in women worldwide (18,19). A most important feature of cervical cancer is the high mortality rate, which is mainly attributed to the lack of effective therapies for women with high-grade cervical cancer (20). It is reported that high-risk human papillomaviruses (HPVs) is a key causal factor for cervical cancer (21). And HPV infection is also suggested to correlate with other anogenital cancers as well as a small fraction of head & neck cancer (22). Therefore, it is important to identify effective prevention methods of human cervical cancers.

Allicin is characterized by antitumor effect in multiple cancers through suppressing cancer cell growth and increasing cell apoptosis (23,24). For example, allicin is reported to sensitize hepatocellular carcinoma (HCC) cells to 5-FU induced apoptosis mainly by modulating ROS-mediated mitochondrial pathway, showing the application of allicin as a novel chemotherapy regimen in HCC (25). In addition, allicin is reported to enhance MGC-803 human gastric carcinoma cell apoptosis by activating the p38 mitogen-activated protein kinase/caspase-3 signaling pathway (26). In the current study, we mainly evaluated the role of allicin in the malignant proliferation of cervical cancer cells. Our data showed that allicin suppressed cervical cancer viability in a time- and dose-dependent manner. Further study revealed that allicin inhibited cervical cancer cell proliferation and migration. These data showed an antitumor role of allicin in cervical cancer cells.

These above findings prompts us to further explore the underlying mechanism in which allicin modulates the progression of cervical cancer. Here, we mainly focused on NRF2, an anti-oxidant enzyme. It is reported that abnormal activation of NRF2 enhances the expression of enzymes for the detoxification of chemical carcinogens, thereby leading to the protection against carcinogenicity, mutagenicity and various toxicity (27,28). Increasing evidence has showed the protective role of NRF2 in intracellular oxidative stress, chemotherapeutic agents and radiotherapy (29,30). However, disruption of NRF2 also enables the cells towards carcinogens, which resulting in the development of inflammation and cancer formation (31,32). Therefore, it is important to maintain the expression of NRF2 in normal status, or else the excessive NRF2 expression confers to the abberant survival of cancer cells.

Here, we found that treatment with allicin could significantly suppress the expression of NRF2 and the downstream enzyme, HO-1. Meanwhile, we also evaluated the functional role of NRF2 on cervical cancer cell proliferation. We found that overexpressing of NRF2 enhanced cervical cancer cell invasion and migration, indicating an oncogenic role of NRF2 in cervical cancer cells. More importantly, allicin-induced cell apoptosis could largely be abolished by overexpressing of NRF2, indicating the antitumor role of allicin in cervical cancer cells mainly by suppressing NRF2.

In summary, our data showed allicin was effective to suppress the malignant phenotype of cervical cancer cells mainly by inhibiting the expression of NRF2, showing the potential clinical benefits of allicin in cervical cancer patients.

References

1 

Ma JQ, Tuersun H, Jiao SJ, Zheng JH, Xiao JB and Hasim A: Functional role of NRF2 in cervical carcinogenesis. PLoS One. 10:e01338762015. View Article : Google Scholar : PubMed/NCBI

2 

Feng Y, Wang Y, Jiang C, Fang Z, Zhang Z, Lin X, Sun L and Jiang W: Nicotinamide induces mitochondrial-mediated apoptosis through oxidative stress in human cervical cancer HeLa cells. Life Sci. 181:62–69. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Alvarez-Olmedo DG, Biaggio VS, Koumbadinga GA, Gómez NN, Shi C, Ciocca DR, Batulan Z, Fanelli MA and O'Brien ER: Recombinant heat shock protein 27 (HSP27/HSPB1) protects against cadmium-induced oxidative stress and toxicity in human cervical cancer cells. Cell Stress Chaperones. 22:357–369. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Chen L, Wang L, Shen H, Lin H and Li D: Anthelminthic drug niclosamide sensitizes the responsiveness of cervical cancer cells to paclitaxel via oxidative stress-mediated mTOR inhibition. Biochem Biophys Res Commun. 484:416–421. 2017. View Article : Google Scholar : PubMed/NCBI

5 

Souza RP, Bonfim-Mendonca PS, Gimenes F, Ratti BA, Kaplum V, Bruschi ML, Nakamura CV, Silva SO, Maria-Engler SS and Consolaro ME: Oxidative stress triggered by apigenin induces apoptosis in a comprehensive panel of human cervical cancer-derived cell lines. Oxid Med Cell Longev. 2017:15127452017. View Article : Google Scholar : PubMed/NCBI

6 

Shah P, Trinh E, Qiang L, Xie L, Hu WY, Prins GS, Pi J and He YY: Arsenic induces p62 expression to form a positive feedback loop with nrf2 in human epidermal keratinocytes: Implications for preventing arsenic-induced skin cancer. Molecules. 22:E1942017. View Article : Google Scholar : PubMed/NCBI

7 

Bao L, Wu J, Dodson M, Rojo de la Vega EM, Ning Y, Zhang Z, Yao M, Zhang DD, Xu C and Yi X: ABCF2, an Nrf2 target gene, contributes to cisplatin resistance in ovarian cancer cells. Mol Carcinog. 56:1543–1553. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Cho HY, Kim K, Kim YB, Kim H and No JH: Expression patterns of Nrf2 and keap1 in ovarian cancer cells and their prognostic role in disease recurrence and patient survival. Int J Gynecol Cancer. 27:412–419. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Duong HQ, You KS, Oh S, Kwak SJ and Seong YS: Silencing of NRF2 reduces the expression of aldh1a1 and aldh3a1 and sensitizes to 5-fu in pancreatic cancer cells. Antioxidants (Basel). 6:E522017. View Article : Google Scholar : PubMed/NCBI

10 

Fabrizio FP, Costantini M, Copetti M, la Torre A, Sparaneo A, Fontana A, Poeta L, Gallucci M, Sentinelli S, Graziano P, et al: Keap1/Nrf2 pathway in kidney cancer: Frequent methylation of KEAP1 gene promoter in clear renal cell carcinoma. Oncotarget. 8:11187–11198. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Gonzalez-Donquiles C, Alonso-Molero J, Fernandez-Villa T, Vilorio-Marqués L, Molina AJ and Martín V: The NRF2 transcription factor plays a dual role in colorectal cancer: A systematic review. PLoS One. 12:e01775492017. View Article : Google Scholar : PubMed/NCBI

12 

Huang H, Zheng F, Dong X, Wu F, Wu T and Li H: Allicin inhibits tubular epithelial-myofibroblast transdifferentiation under high glucose conditions in vitro. Exp Ther Med. 13:254–262. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Gruhlke MC, Nicco C, Batteux F and Slusarenko AJ: The effects of allicin, a reactive sulfur species from garlic, on a selection of mammalian cell lines. Antioxidants (Basel). 6:E12016. View Article : Google Scholar : PubMed/NCBI

14 

Chen X, Pang S, Lin J, Xia J and Wang Y: Allicin prevents oxidized low-density lipoprotein-induced endothelial cell injury by inhibiting apoptosis and oxidative stress pathway. BMC Complement Altern Med. 16:1332016. View Article : Google Scholar : PubMed/NCBI

15 

Ding G, Zhao J and Jiang D: Allicin inhibits oxidative stress-induced mitochondrial dysfunction and apoptosis by promoting PI3K/AKT and CREB/ERK signaling in osteoblast cells. Exp Ther Med. 11:2553–2560. 2016. View Article : Google Scholar : PubMed/NCBI

16 

Li S, Chen S, Yang W, Liao L, Li S, Li J, Zheng Y and Zhu D: Allicin relaxes isolated mesenteric arteries through activation of PKA-KATP channel in rat. J Recept Signal Transduct Res. 37:17–24. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Yang D, Lv Z, Zhang H, Liu B, Jiang H, Tan X, Lu J, Baiyun R and Zhang Z: Activation of the Nrf2 signaling pathway involving KLF9 plays a critical role in allicin resisting against arsenic trioxide-induced hepatotoxicity in rats. Biol Trace Elem Res. 176:192–200. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Mahmoodi P, Motamedi H, Seyfi Abad Shapouri MR, Bahrami Shehni M and Kargar M: Molecular detection and typing of human papillomaviruses in paraffin-embedded cervical cancer and pre-cancer tissue specimens. Iran J Cancer Prev. 9:e37522016.PubMed/NCBI

19 

Kim M, Kim YS, Kim H, Kang MY, Park J, Lee DH, Roh GS, Kim HJ, Kang SS, Cho GJ, et al: O-linked N-acetylglucosamine transferase promotes cervical cancer tumorigenesis through human papillomaviruses E6 and E7 oncogenes. Oncotarget. 7:44596–44607. 2016.PubMed/NCBI

20 

Piroozmand A, Mostafavi Zadeh SM, Madani A, Soleimani R, Nedaeinia R, Niakan M, Avan A, Manian M, Moradi M and Eftekhar Z: The association of high risk human papillomaviruses in patients with cervical cancer: an evidence based study on patients with squamous cell dysplasia or carcinoma for evaluation of 23 human papilloma virus genotypes. Jundishapur J Microbiol. 9:e327282016. View Article : Google Scholar : PubMed/NCBI

21 

Gu Y, Ma C, Zou J, Zhu Y, Yang R, Xu Y and Zhang Y: Prevalence characteristics of high-risk human papillomaviruses in women living in Shanghai with cervical precancerous lesions and cancer. Oncotarget. 7:24656–24663. 2016. View Article : Google Scholar : PubMed/NCBI

22 

Zandnia F, Doosti A, Mokhtari-Farsani A, Kardi MT and Movafagh A: Application of multiplex PCR for rapid and sensitive detection of human papillomaviruses in cervical cancer. Pak J Med Sci. 32:444–447. 2016.PubMed/NCBI

23 

Müller A, Eller J, Albrecht F, Prochnow P, Kuhlmann K, Bandow JE, Slusarenko AJ and Leichert LI: Allicin induces thiol stress in bacteria through s-allylmercapto modification of protein cysteines. J Biol Chem. 291:11477–11490. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Tu G, Zhang YF, Wei W, Li L, Zhang Y, Yang J and Xing Y: Allicin attenuates H2O2-induced cytotoxicity in retinal pigmented epithelial cells by regulating the levels of reactive oxygen species. Mol Med Rep. 13:2320–2326. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Zou X, Liang J, Sun J, Hu X, Lei L, Wu D and Liu L: Allicin sensitizes hepatocellular cancer cells to anti-tumor activity of 5-fluorouracil through ROS-mediated mitochondrial pathway. J Pharmacol Sci. 131:233–240. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Zhang X, Zhu Y, Duan W, Feng C and He X: Allicin induces apoptosis of the MGC-803 human gastric carcinoma cell line through the p38 mitogen-activated protein kinase/caspase-3 signaling pathway. Mol Med Rep. 11:2755–2760. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Jiang XY, Zhu XS, Xu HY, Zhao ZX, Li SY, Li SZ, Cai JH and Cao JM: Diallyl trisulfide suppresses tumor growth through the attenuation of Nrf2/Akt and activation of p38/JNK and potentiates cisplatin efficacy in gastric cancer treatment. Acta Pharmacol Sin. 38:1048–1058. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Kontostathi G, Zoidakis J, Makridakis M, Lygirou V, Mermelekas G, Papadopoulos T, Vougas K, Vlamis-Gardikas A, Drakakis P, Loutradis D, et al: Cervical cancer cell line secretome highlights the roles of transforming growth factor-beta-induced protein ig-h3, peroxiredoxin-2 and nrf2 on cervical carcinogenesis. Biomed Res Int. 2017:41807032017. View Article : Google Scholar : PubMed/NCBI

29 

Krajka-Kuźniak V, Paluszczak J and Baer-Dubowska W: The Nrf2-ARE signaling pathway: An update on its regulation and possible role in cancer prevention and treatment. Pharmacol Rep. 69:393–402. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Lisek K, Walerych D and Del Sal G: Mutant p53-Nrf2 axis regulates the proteasome machinery in cancer. Mol Cell Oncol. 4:e12179672016. View Article : Google Scholar : PubMed/NCBI

31 

Lu K, Alcivar AL, Ma J, Foo TK, Zywea S, Mahdi A, Huo Y, Kensler TW, Gatza ML and Xia B: NRF2 induction supporting breast cancer cell survival is enabled by oxidative stress-induced DPP3-KEAP1 interaction. Cancer Res. 77:2881–2892. 2017. View Article : Google Scholar : PubMed/NCBI

32 

Mandal A, Bhatia D and Bishayee A: Anti-Inflammatory mechanism involved in pomegranate-mediated prevention of breast cancer: the role of NF-κB and Nrf2 Signaling pathways. Nutrients. 9:E4362017. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

March 2019
Volume 17 Issue 3

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Zhang, Q., & Zhang, Q. (2019). Allicin suppresses the migration and invasion in cervical cancer cells mainly by inhibiting NRF2. Experimental and Therapeutic Medicine, 17, 1523-1528. https://doi.org/10.3892/etm.2018.7104
MLA
Zhang, Q., Yang, D."Allicin suppresses the migration and invasion in cervical cancer cells mainly by inhibiting NRF2". Experimental and Therapeutic Medicine 17.3 (2019): 1523-1528.
Chicago
Zhang, Q., Yang, D."Allicin suppresses the migration and invasion in cervical cancer cells mainly by inhibiting NRF2". Experimental and Therapeutic Medicine 17, no. 3 (2019): 1523-1528. https://doi.org/10.3892/etm.2018.7104