Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Case Report

Wolcott‑Rallison syndrome due to the same mutation in EIF2AK3 (c.205G>T) in two unrelated families: A case report

  • Authors:
    • Ai Huang
    • Haiyan Wei
  • View Affiliations / Copyright

    Affiliations: Department of Endocrinology, Children's Hospital Affiliated to Zhengzhou University, Henan Children's Hospital, Zhengzhou Children's Hospital, Zhengzhou, Henan 450018, P.R. China
  • Pages: 2765-2768
    |
    Published online on: February 13, 2019
       https://doi.org/10.3892/etm.2019.7268
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Wolcott-Rallison syndrome (WRS) is a rare autosomal recessive disorder characterized by early-onset diabetes mellitus, skeletal dysplasia and growth retardation. Other associated disorders include severe liver and renal dysfunction, and central hypothyroidism. Mutations in the eukaryotic translation initiation factor 2α kinase 3 (EIF2AK3), which is located at chromosome 2p12, are responsible for this disorder. In the present case report, the case of a 3‑month old boy diagnosed as neonatal diabetes, who had acute liver failure soon afterwards is detailed. This diagnosis was confirmed through the identification of a novel nonsense mutation in exon 1 of EIF2AK3. The aim of the current case report was to raise awareness for patients with WRS with neonatal diabetes mellitus, particularly those with multiple systemic manifestations.

Introduction

Wolcott-Rallison syndrome (WRS) is a rare autosomal recessive disorder characterized by early-onset or permanent neonatal diabetes mellitus, skeletal dysplasia and growth retardation, and other variable multisystemic clinical manifestations, wherein the majority of patients succumb in infancy or childhood (1–5). Long-term regular insulin therapy has been demonstrated to improve survival rates (6,7). To date, <100 cases of WRS have been reported according to the literature. WRS is mostly reported in individuals from countries where consanguineous families are common (8). It has previously been demonstrated that mutations in the gene encoding eukaryotic translation initiation factor 2α kinase 3 (EIF2AK3) are responsible for WRS (4,5). In the present report, a novel mutation in EIF2AK3 (c.205G>T) was reported in a patient with WRS. Notably, both parents of this patient, who were from unrelated families, were heterozygous carriers for this mutation.

Case report

The patient was a Chinese boy born at 39 weeks via natural childbirth, with a birth weight of 3.2 kg. His parents were nonconsanguineous. In February 2016, at 3-months of age, the patient was diagnosed with neonatal diabetes mellitus at Wuhan Children's Hospital (Hubei, China). In June 2016, at 7-months of age, the patient was diagnosed with WRS and admitted to the Department of Endocrinology, Zhengzhou Children's Hospital (Zhengzhou, China). The patient presented with vomiting and a high blood glucose level. Experimental treatment with Glibenclamide (1 mg/kg/day; Shanxi YunPeng Pharmaceutical Co., Ltd., Taiyuan, China) was ineffective. The patient was discharged with a regimen of premixed insulin Novolin® 30R (1.0–1.5 U/kg; Novo Nordisk, Bagsværd, Denmark) three times daily.

At 7 months of age, the patient experienced fever of unknown origin, anorexia and vomiting. Anti-infective therapy was ineffective. Physical examinations revealed the following: Height, 65 cm; weight, 7.5 kg. No abnormal physical features, lethargy, or cardiopulmonary abnormalities were observed. The patient's liver was enlarged, extending ~2 cm below the rib cage. Blood glucose was detected using a glucose meter and test strips (Johnson & Johnson, New Brunswick, NJ, USA). The patient's blood glucose levels fluctuated between 2.7–19.0 mmol/l (normal range, 3.9–6.1 mmol/l). Blood C-peptide levels were detected using an electrochemical luminescence method (Roche Diagnostics, Basel, Switzerland). The patient's Blood C-peptide levels were 0.07 ng/ml, which was markedly lower than the normal range (1.1–4.4 ng/ml). Islet cell antibody (ICA) was detected using the indirect immunofluorescent method, while the glutamic acid decarboxylase antibody (GAD) was detected using immunoradiometric methods, according to the manufacturer's protocol (Roche Diagnostics). Both ICA and GAD tests were negative. Renal and thyroid function tests were normal. In addition, chest X-ray, cardiac enzyme levels and electrocardiogram were normal. A liver function test revealed elevated alanine transaminase (ALT) levels of 1,065.9 U/l (normal range, 0–45 U/l) and aspartate transaminase (AST) levels of 1,887.7 U/l (normal range, 0.35 U/l). An abdominal ultrasound exam revealed an enlarged liver.

The patient received an insulin aspart injection (NovoLog®; Medtronic, Minneapolis, MN, USA) to control blood glucose levels, delivering a large dose (1.0–2.0 units) before meals, with a total of 6 U/day. In addition, the patient also received aspartate ornithine and reduced glutathione injection (150 mg/kg; Qirui Pharmaceutical Co., Ltd., Wuhan, China) to protect liver function, and ceftazidime (300 mg/kg; Hailing Chemical Pharmaceutical Co., Ltd., Hainan, China) twice a day as anti-infection treatment.

Following treatment, the patient's blood glucose fluctuated between 4–9 mmol/l before meals, to 8–13 mmol/l after meals. Although the patient's body temperature and blood glucose levels became steady, the patient's liver function was evaluated, which revealed ALT levels of 6,677.2 U/l and AST levels of 8,976.5 U/l, with systemic edema due to hypoproteinemia. Ultimately, the patient received hemodialysis and was discharged 15 days later. The patient had regular follow-ups for six months, during which liver function was normal.

During hospitalization, blood samples were collected and DNA was extracted from the peripheral leukocytes of the patient and his parents. Written informed consent was obtained from the patient's parents prior to participation in the present case report. The EF2AK3 gene was amplified by polymerase chain reaction, followed by Sanger sequencing performed by Meiji Biomedical Technology Co. Ltd., Shanghai, China. Briefly, blood samples (2 ml) were collected and centrifuged at 13,400 × g for 2 min at room temperature. Subsequently, total DNA was extracted from peripheral leukocytes using the DNA extraction reagent (Tiangen Biotech Co., Ltd., Beijing, China), according to the manufacturer's protocol. To examine the 17 exons of EIF2AK3, DNA was amplified using the TIANamp blood DNA kit (Tiangen Biotech Co., Ltd.) using the specific primer pairs listed in Table I, according to the manufacturer's protocol. The following thermocycling conditions were used for the PCR: Initial denaturation at 94°C for 5 min; 38 cycles of 94°C for 30 sec, 62°C for 30 sec and 72°C for 45 sec. Sequencing analysis revealed that the patient was homozygous for a novel nonsense mutation, c.205G>T (P.Glu69Ter) in the EIF2AK3 gene (Fig. 1) and both parents were identified as heterozygous carriers for the mutation (Figs. 2 and 3). To the best of our knowledge, this mutation has not been reported previously. Family genealogy of both parents is presented in Fig. 4.

Figure 1.

Genetic testing results of the patient.

Figure 2.

Genetic testing results of the patient's father.

Figure 3.

Genetic testing results of the patient's mother.

Figure 4.

Genealogy of the patient's family.

Table I.

Primer pairs used for DNA sequencing.

Table I.

Primer pairs used for DNA sequencing.

ExonPrimer sequence (5′-3′)
    1F: GAGAGGCAGGCGTCAGTG
R: CGCGCGTAAACAAGTTGC
    2F: TGAGCATGTGGGATAAGTCC
R: TGCCCTAAAGGGACACAAAC
    3F: TCAGGATCAAGACTCCAGCTC
R: TGACAACCTCAGGGGAAAAT
    4F: GGAGTTGGTAATCTAACTGATGC
R: CCAACAGCAACATTATCTGAA
    5F: GCCCTCTTGTGGCATAAATC
R: CTGGGAGAGGAAGAACCGTA
    6F: GCCCTCTTGTGGCATAAATC
R: GGCACTCCTGAAGTAGGAAGG
    7F: CCCTCCCTGTTTTTGTTGAA
R: GGGCAAAGACAGTCAGGATT
    8F: CTGGGCCATTTGTTTAACTT
R: TGAAATTGTCTCCCAAGATG
    9F: TAGTTAAAGACGGGCCTATT
R: CAAGAGTAGCTTTGGTGGAG
10F: AAGACTGGAGGGATAGCAGT
R: AGATCTTAGGTCATTTCTTCTTTG
11F: TGAACTGATTTTCACATTACCAC
R: AATTGGCAGCACTTAGAACC
12F: GCCTTCAGGGTTGTCTTACT
R: CATTGTAATCACACAAGCAAA
13 (1)F: ACAGAGGGTGCAGTTCAGGT
R: CACAATGGTTGCCAATATCC
13 (2)F: AAGGTCAAGGGAGAGAACCT
R: ACCCTCTGCTCTCAGATGCTT
14F: CATGCACACCCACTGTACTT
R: CTGGAACACTACTGCCAGTTT
15F: CTTTGGGATTCAATAATGCT
R: CCAATCTGCTGGTATTAAGAA
16F: TGTGGAATCTGTGGGATGTC
R: TGCTAAGGACCGCTTACGTT
17F: TTTTGCCAGCACTGATTTTA
R: TTTCAAGTCTGCAATTTTGG

[i] F, forward; R, reverse.

Discussion

WRS is a rare autosomal recessive disease, which was initially described by Wolcott and Rallison in 1972 (1). It is characterized by early-onset diabetes mellitus, skeletal dysplasia and growth retardation. Other symptoms include severe liver and renal dysfunction, and central hypothyroidism (2–5). The majority of cases have been reported in countries with a high incidence of marriage between first cousins (9). Mutations in EIF2AK3, which is located at chromosome 2p12, are responsible for this disorder (4,5), and encodes for pancreatic endoplasmic reticulum kinase (PERK) (7). PERK is a major endoplasmic reticulum stress transducer in cells. Mutations in EIF2AK3 disrupt the expression and/or function of PERK, which blocks β cell development and impairs gluconeogenesis (6). This gene is highly expressed in the nucleus of pancreatic β cells and bone tissues (10), which comprise the major sites used for diagnosis of this disease. EIF2AK3 is expressed in the liver and kidney at a lower level, which leads to liver and kidney dysfunction, or even liver failure for patients with WRS (10). The prognosis of WRS is poor. Patients typically succumb to hepatic failure and renal failure at an early age (7). However, one patient was previously reported to live until 35 years of age and died without any symptoms (7).

According to previous studies, mutations of EIF2AK3 include nonsense, missense and framework drift mutations, among other types (7,11). In the present case report, the patient was homozygous for the c.205G>T (P.Glu69Ter) mutation of the EIF2AK3 gene which was identified to be a novel nonsense mutation. To the best of our knowledge, this mutation site has not yet been reported in China (6,12). In recent years, other novel mutations in EIF2AK3 have also been reported (13–16). In the present case report, the patient's parents were both heterozygous carriers for the same mutation. Although WRS typically occurs in families with consanguineous marriage (7,10), the present case report details a rare case where the patient's parents are nonconsanguineous, but carried the same mutation site.

The present patient presented permanent neonatal diabetes mellitus and transient liver failure, but no central hypothyroidism or kidney dysfunction, which demonstrates the diversity of clinical manifestations of the disease. It may therefore be hypothesized that this is due to variable expression of the EIF2AK3 gene, other modified genes, environmental factors and differences in disease management. The patient did not undergo skeletal X-ray, so it could not be determined whether he exhibited epiphyseal dysplasia.

In conclusion, the incidence of WRS is very low. In patients with neonatal diabetes mellitus, particularly those with multiple system manifestations, a diagnosis of WRS should be considered. A detailed history and physical examination may also be beneficial for diagnosis and treatment of WRS. Genetic testing, as the gold standard in diagnosing this disease, may provide guidance for prenatal diagnosis.

Acknowledgements

The authors would like to acknowledge and thank the patient's family members for their voluntary participation, as well as Professor Yiping Shen (Division of Genetics and Genomics, Boston Children's Hospital, Boston, MA, USA) for guiding this case report.

Funding

The present case report was supported by a grant from the Henan Province Science and Technology Department, Zhengzhou, China (grant no. 142102310139).

Availability of data and materials

Not applicable.

Authors' contributions

HW contributed to the conception and design. AH and HYW performed the data analyses and prepared the manuscript.

Ethics approval and consent to participate

Written informed consent was obtained from the patient's parents prior to participation in the present case report.

Patient consent for publication

Written informed consent was obtained from the patient's parents prior to participation in the present case report.

Competing interests

The authors declare that they have no competing interests.

References

1 

Wolcott CD and Rallison ML: Infancy-onset diabetes mellitus and multiple epiphyesal dysplasia. J Pediatr. 80:292–297. 1972. View Article : Google Scholar : PubMed/NCBI

2 

Bin-Abbas B, Shabid S, Hainu B and Ai-Ashwel A: Wolcott-Rallison syndrome: Clinical, radiological and histological findings in a Saudi child. Ann Saudi Med. 21:73–74. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Brickwood S, Bonthron DT, AI-Gazali LI, Piper K, Heam T, Wilson DI and Hanley NA: Wolcott-Rallison syndrome: Pathogenic insights into neonatal diabetes from new mutation and expression studies of EIF2AK3. J Med Genet. 40:685–689. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Iyer S, Korada M, Rainbow L, Kirk J, Brown RM, Shaw N and Barrett TG: Wolcott-Rallison syndrome: A clinical and genetic study of three children, novel mutation in EIF2AK3 and review of the literature. Acta Pardiatr. 3:1195–1201. 2004.

5 

Engelmann G, Meyburg J, Shahbek N, Al-Ali M, Hairetis MH, Baker AJ, Rodenburg RJ, Wenning D, Flechtenmacher C, Ellard S, et al: Recurrent acute liver failure and mitochondriopathy in a case of Wolcott-Rallison syndrome. J Inherit Metab Dis. 31:540–546. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Feng DR, Meng Y, Zhao SM, Shi HP, Wang WC and Huang SZ: Two novel EIF2AK3 mutations in a Chinese boy with Wolcott-Rallison syndrome. Zhonghua Er Ke Za Zhi. 49:301–305. 2011.(In Chinese). PubMed/NCBI

7 

Senée V, Vattem KM, Delépine M, Rainbow LA, Haton C, Lecoq A, Shaw NJ, Robert JJ, Rooman R, Diatloff-Zito C, et al: Wolcott-Rallison Syndrome: Clinical, genetic, and functional study of EIF2AK3 mutations and suggestion of genetic heterogeneity. Diabetes. 53:1876–1883. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Rubio-Cabezas O, Patch AM, Minton JA, Flanagan SE, Edghill EL, Hussain K, Balafrej A, Deeb A, Buchanan CR, Jefferson IG, et al: Wolcott-Rallison syndrome is the most common genetic cause of permanent neonatal diabetes in consanguineous families. J Clin Endocrinol Metab. 94:4162–4170. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Ozbek MN, Senée V, Aydemir S, Kotan LD, Mungan NO, Yuksel B, Julier C and Topaloglu AK: Wolcott-Rallison syndrome due to the same mutation (W522X) in EIF2AK3 in two unrelated families and review of the literature. Pediatr Diabetes. 11:279–285. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Tzakis AG, Nunnelley MJ, Tekin A, Buccini LD, Garcia J, Uchida K, Neville HL, Nares MA, Ruiz P and Bodamer O: Liver, pancreas and kidney transplantation for the treatment of Wolcott-Rallison syndrome. Am J Transplant. 15:565–567. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Delépine M, Nicolino M, Barrett T, Golamaully M, Lathrop GM and Julier C: EIF2AK3, encoding translation initiation factor 2-alpha kinase 3, is mutated in patients with Wolcott-Rallison syndrome. Nat Genet. 25:406–409. 2000. View Article : Google Scholar : PubMed/NCBI

12 

Sang Y, Liu M, Yang W, Yan J, Chengzhu and Ni G: A novel EIF2AK3 mutation leading to Wolcott-Rallison syndrome in a Chinese child. J Pediatr Endocrinol Metab. 24:181–184. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Gürbüz F, Yüksel B and Topaloğlu AK: Wolcott-rallison syndrome with novel EIF2AK3 gene mutation. J Clin Res Pediatr Endocrinol. 8:496–497. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Al-Sinani S, Al-Yaarubi S, Sharef SW, Al-Murshedi F and Al-Maamari W: Novel mutation in wolcott-rallison syndrome with variable expression in two omani siblings. Oman Med J. 30:138–141. 2015. View Article : Google Scholar : PubMed/NCBI

15 

De Franco E, Flanagan SE, Houghton JA, Lango Allen H, Mackay DJ, Temple IK, Ellard S and Hattersley AT: The effect of early, comprehensive genomic testing on clinical care in neonatal diabetes: An international cohort study. Lancet. 386:957–963. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Al-Aama JY, Al-Zahrani HS, Jelani M, Sabir HS, Al-Saeedi SA and Ahmed S: Novel splice site mutation in EIF2AK3 gene causes Wolcott-Rallison syndrome in a consanguineous family from Saudi Arabia. Congenit Anom (Kyoto). 58:39–40. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Huang A and Wei H: Wolcott‑Rallison syndrome due to the same mutation in EIF2AK3 (c.205G>T) in two unrelated families: A case report. Exp Ther Med 17: 2765-2768, 2019.
APA
Huang, A., & Wei, H. (2019). Wolcott‑Rallison syndrome due to the same mutation in EIF2AK3 (c.205G>T) in two unrelated families: A case report. Experimental and Therapeutic Medicine, 17, 2765-2768. https://doi.org/10.3892/etm.2019.7268
MLA
Huang, A., Wei, H."Wolcott‑Rallison syndrome due to the same mutation in EIF2AK3 (c.205G>T) in two unrelated families: A case report". Experimental and Therapeutic Medicine 17.4 (2019): 2765-2768.
Chicago
Huang, A., Wei, H."Wolcott‑Rallison syndrome due to the same mutation in EIF2AK3 (c.205G>T) in two unrelated families: A case report". Experimental and Therapeutic Medicine 17, no. 4 (2019): 2765-2768. https://doi.org/10.3892/etm.2019.7268
Copy and paste a formatted citation
x
Spandidos Publications style
Huang A and Wei H: Wolcott‑Rallison syndrome due to the same mutation in EIF2AK3 (c.205G>T) in two unrelated families: A case report. Exp Ther Med 17: 2765-2768, 2019.
APA
Huang, A., & Wei, H. (2019). Wolcott‑Rallison syndrome due to the same mutation in EIF2AK3 (c.205G>T) in two unrelated families: A case report. Experimental and Therapeutic Medicine, 17, 2765-2768. https://doi.org/10.3892/etm.2019.7268
MLA
Huang, A., Wei, H."Wolcott‑Rallison syndrome due to the same mutation in EIF2AK3 (c.205G>T) in two unrelated families: A case report". Experimental and Therapeutic Medicine 17.4 (2019): 2765-2768.
Chicago
Huang, A., Wei, H."Wolcott‑Rallison syndrome due to the same mutation in EIF2AK3 (c.205G>T) in two unrelated families: A case report". Experimental and Therapeutic Medicine 17, no. 4 (2019): 2765-2768. https://doi.org/10.3892/etm.2019.7268
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team