Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
June-2014 Volume 7 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2014 Volume 7 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes

  • Authors:
    • Ying Peng
    • Li Zhang
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, Department of Pathology, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, P.R. China, Laboratory of Pathology, Department of Pathology, West China Hospital, Sichuan University, Chengdu, Sichuan 610041, P.R. China
  • Pages: 1708-1712
    |
    Published online on: March 14, 2014
       https://doi.org/10.3892/etm.2014.1621
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Toll‑like receptors (TLRs) play an essential role in the activation and regulation of the innate and adaptive immune responses through the recognition of specific components of pathogens. TLR1/2 on the cell surface plays an important role in defending against Gram‑positive bacteria. The aim of the present study was to examine the expressional variation of immunomodulatory molecules in peripheral blood leukocytes (PBLs) treated with the TLR1/2 agonist, Pam3Cys. The quantitative polymerase chain reaction result showed dramatically increased expression of immune‑related factors treated with Pam3Cys. Antibody‑chip assays confirmed that activation of TLR1/2 could induce secretion of four important immune factors [interleukin (IL)‑6, IL‑8, macrophage inflammatory protein‑1α and interferon‑β). Western‑blot analysis indicated the upregulation of three significant signal kinase proteins (phosphorylated signal transducer and activator of transcription 3, extracellular signal‑related kinase and c‑Jun N‑terminal kinase 2). The study demonstrated that there were numerous molecules involved in the immune response of PBLs stimulated by the TLR1/2 ligand. Our future studies will focus on the mechanisms of these molecules in the TLR1/2 agonist‑mediated immune response.

Introduction

Toll-like receptors (TLRs) are key regulators of the innate and adaptive immune responses, and are activated by specific pathogen-associated molecular patterns (1). The activation of TLRs initiates a signaling cascade and induces the expression of various important pro-inflammatory cytokines and finally leads to the eradication of infecting microbes (2).

The expression of TLR has been shown for several immune cells, whereby the amount of expression and the combination of TLR differs from one type to another (3). In a human peripheral blood mononuclear cell (PBMC) survey, TLR1 was expressed in all cell types examined, while high expression of TLR2 was characteristic for monocytes (4). Among all TLR members, TLR1 usually interacts physically and functionally with TLR2, which appears to be involved in the discrimination of subtle changes in the lipid portion of lipoproteins (5).

The present study examined the in vitro responsiveness of PBLs from normal healthy volunteers to the TLR1/2 agonist in order to determine which types of immunomodulatory molecules are involved in the activation of the TLR1/2 pathway and in the promotion of the inflammatory status of PBLs.

Materials and methods

Isolation and stimulation of PBLs

Mixed PBLs were isolated from the blood of normal healthy volunteers using gradient centrifugation (800 × g for 20 min; Sigma-Aldrich, Oakville, ON, Canada), according to the manufacturers’ protocol. The PBLs (2×106) were treated with 100 ng/ml TLR1/2 agonist, Pam3Cys. The study was approved by the ethics committee of West China Hospital, Sichuan University, Chengdu, China. Written informed consent was obtained from all participants.

Reverse transcription and quantification PCR

At 4 h post-stimulation, total RNA was isolated using an RNeasy mini kit (Qiagen, Dusseldorf, Germany) from the Pam3Cys-treated and untreated groups. cDNA was synthesized using the ReverTra Ace quantitative polymerase chain reaction (qPCR) kit (FSQ-101; Toyobo, Kagoshima, Japan). The reverse transcription conditions were 65°C for 5 min, followed by 37°C for 15 min and 98°C for 5 min.

qPCR was performed using RealMaster Mix (SYBR Green; FP202; Tiangen, Beijing, China). The qPCR was performed in an iCycler iQTM Optical Module (Beckman Coulter, Fullerton, CA, USA) under the following conditions: One cycle at 95°C for 30 sec, then 40 cycles at 95°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec, followed by a melt curve from 55 to 95°C in 0.5°C increments and 10-sec intervals. The primers used are listed in Table I. All tests were conducted three times.

Table I

List of primers for qPCR analysis.

Table I

List of primers for qPCR analysis.

GeneForward primerReverse primerGenBank number
c-myc CAAGACTCCAGCGCCTTCTC GTTGAGTAACGAGCTGACCCCAM393287
CXCL2 AGGTGAAGTCCCCCGGAC GCCCATTCTTGAGTGTGGCTNM_002089
CXCL6 GCTGAGAGTAAACCCCAAAACGGGAGCACTGCGGGCCNM_002993
CCL26 CCAAGACCTGCTGCTTCCAA GAATTCATAGCTTCGCACCCANM_006072
CCL28 CTCGCCATCGTGGCCTT GCAATGGGAAGTATGGCTTCTGAF220210
IFN-β CAGCAATTTTCAGTGTCAGAAGCT TCATCCTGTCCTTGAGGCAGTM28622
IL-1β ACGAATCTCCGACCACCACT CCATGGCCACAACAACTGACM15330
IL-6 GACCCAACCACAAATGCCA GTCATGTCCTGCAGCCACTGM14584
IL-8 CTGGCCGTGGCTCTCTTG CCTTGGCAAAACTGCACCTTNM_000584
IL-15 GACCCCACCAAAGCTGGAC TCACAGTGCTGCTGTCTGCTGM90391
IP-10 TGAAATTATTCCTGCAAGCCAA CAGACATCTCTTCTCACCCTTCTTTNM_001565
ITGB3 TGCCGCCCTGCTCATCTGGA TCCTGCAATCGTGGCACAGGCNM_000212
MIP-1α AGCTGACTACTTTGAGACGAGCAG CGGCTTCGCTTGGTTAGGANM_002983
MIP-1β CTGCTCTCCAGCGCTCTCA GTAAGAAAAGCAGCAGGCGGNM_002984
RANTES GACACCACACCCTGCTGCT TACTCCTTGATGTGGGCACGNM_002985
PTEN ACCATAACCCACCACAGC CAGTTCGTCCCTTTCCAGNM_058074
GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTCJ04038

[i] qPCR, quantitative polymerase chain reaction; CXCL, chemokine (C-X-C motif) ligand; CCL, chemokine (C-C motif) ligand; IFN, interferon; IL, interleukin; IP-10, interferon γ-induced protein 10; ITGB3, integrin β3; MIP, macrophage inflammatory protein; RANTES, regulated upon activation, normal T cell expressed and secreted; PTEN, phosphatase and tensin homolog; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Antibody array

Conditioned media from TLR1/2-treated and untreated PBLs were analyzed for protein expression using RayBio Human Antibody Array C Series 1000 (RayBiotech; Norcross, GA, USA), according to the manufacturer’s instructions. Blots were analyzed with ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Western-blot analysis

Proteins of PBLs were extracted using a standard mammalian protein extraction reagent (Pierce, Rockford, IL, USA) containing protease inhibitor (Roche Applied Science, Indianapolis, IN, USA). Lysates were clarified by centrifugation at 13,000 × g for 10 min at 4°C. Protein concentration was measured using a Micro BCA Protein Assay kit (Pierce). The total protein at 20 μg was loaded on 15% SDS-polyacrylamide gels and transferred to nitrocellulose membranes (Invitrogen, Carlsbad, CA, USA). The membranes were blocked with 5% skimmed dried milk in Tris-buffered saline (TBS) containing 0.2% Tween-20 (TBST) for 1 h at room temperature, and then incubated at 4°C overnight with the primary antibodies (Table II). Next, the membranes were washed in TBST (3 times, 60 min) and incubated with secondary antibody conjugated to horseradish peroxidase (1:5000; Abcam, Cambridge, UK) for 1 h at room temperature. Antigen-antibody complexes were visualized using X-ray film following exposure to enhanced chemiluminescence reagent (Amersham Biosciences, Fairfield, CT, USA). The gray analysis of western blotting was completed using ImageJ software (National Institutes of Health).

Table II

Primary antibodies for western blotting.

Table II

Primary antibodies for western blotting.

NameCompanyCatalog numberMolecular weight, kDa
JNK2Abcam2037-154
ERKAbcam1171-144
pSTAT3Abcam2236-192
GAPDHAbcamab824537

[i] JNK, c-Jun N-terminal kinase; ERK, extracellular signal-regulated kinase; pSTAT, phosphorylated signal transducer and activator of transcription 3; GADPH, glyceraldehyde 3-phosphate dehydrogenase.

Data analysis

The qPCR data were analyzed using Bio-Rad iQ5 software. Glyceraldehyde 3-phosphate dehydrogenase was used as an internal control. Normal PBLs were used as a negative control. Results were expressed as the mean ± standard error of the mean using SPSS 16.0 (IBM, SPSS Statistics, Armonk, NY, USA). Values of P<0.05 and P<0.001 were considered to indicate a significant difference compared with the control group. The figures were completed using GraphPad Prism5 (GraphPad Software, Inc., LA Jolla, CA, USA).

Results

Detection of cytokine/chemokine secretion in supernatant

Supernatant from TLR1/2 agonist-treated and untreated PBLs was tested for the presence of secreted chemokines and cytokines by RayBio antibody-chip assays. A total of 20 molecules were chosen for detection [α-fetoprotein (AFP), albumin, E-Selectin, intracellular adhesion molecule 1 (ICAM-1), interferon (IFN)-α and -γ, interleukin (IL)-10, -12, -18, -1β, -4, -5, -6 and -8, monocyte chemoattractant protein (MCP)-1 and -3, macrophage inflammatory protein (MIP)-1α, Notch-1, transforming growth factor β and vascular endothelial growth factor]. The antibody-chip assay indicated that the TLR1/2 agonist resulted in the increased secretion of IL-6, IL-8, MIP-1α and IFN-β (Fig. 1). The most significant increase was in IL-6 (P<0.001), while the other three molecules (IL-8, MIP-1α and IFN-β) were not increased as significantly as IL-6 (P<0.05). Other target genes either did not result in detectable protein levels or had protein levels that remained the same.

Figure 1

Cytokine/chemokine secretion in supernatant. **P<0.001 and *P <0.05 versus control group. TLR1, Toll-like recepor 1; NL, normal control; Pam3Cys, TLR1 agonist-treated; IL, interleukin; MIP-1α, macrophage inflammatory protein; IFN, interferon.

Quantification survey of immunomodulatory genes by qPCR

Cytokine/chemokine expression variations were analyzed by qPCR in an effort to identify candidate genes responsible for TLR1/2 agonist-mediated changes in PBLs. Therefore, changes in the expression of these genes, either due to microenvironment or pathogen stimulation, could greatly affect the biological function of PBLs.

Four tumor-related genes were found to be expressed: Phosphatase and tensin homolog (PTEN), a well-known tumor suppressor; c-myc, an oncogene; ITGB3, an adhesion molecule; and IFN-β, a defense factor. Activation of TLR1/2 increased the expression of all selected genes (P<0.05); the most significant increase was detected in INF-β (P<0.001; Fig. 2A).

Figure 2

Detection of gene expression variation by qPCR. (A) Cancer related genes, (B) chemokines, (C) interleukins and (D) growth factors. **P<0.001 and *P<0.05 versus control group. qPCR, quantitative polymerase chain reaction; NL, normal control; Pam3Cys, TLR1 agonist-treated; PTEN, phosphatase and tensin homolog; IFN, interferon; ITGB3, integrin β3; CXCL, chemokine (C-X-C motif) ligand; CCL, chemokine (C-C motif) ligand; IL, interleukin; RANTES, regulated upon activation, normal T cell expressed and secreted; IP-10, interferon γ-induced protein 10; MIP, macrophage inflammatory protein.

In chemokine detection, the result indicated that the TLR1 agonist could increase the expression of chemokine (C-X-C motif) ligand 2 (CXCL2; P<0.001), CXCL6 (P<0.05) and chemokine (C-C motif) ligand 26 (CCL26; P<0.05), while the expression of CCL28 (P<0.05) was downregulated by Pam3Cys (Fig. 2B). The expression of other chemokines, including CCL21, CCL25, CXCL2 and CXCL3 remained the same along with the normal control (data not shown). In IL detection, it was found that all tested ILs were either upregulated, including IL-1β (P<0.001), IL-6 (P<0.05), IL-8 (P<0.001) and IL-15 (P<0.05) (Fig. 2C) or remained unchanged (IL-2, IL7, IL-9 and IL-18) when stimulated by the TLR1/2 agonist. Finally, growth factor detection was analyzed and the result showed that the expression of regulated upon activation, normal T cell expressed and secreted (RANTES; P<0.05) and interferon γ-induced protein 10 (IP-10; P<0.05) were increased, while MIP-1α (P<0.001) and MIP-1β (P<0.001) were inhibited by TLR1/2 stimulation (Fig. 2D).

TLR1/2 agonist activates the downstream signal kinase

Activation of downstream signaling molecules following Pam3Cys stimulation of PBLs was assessed by western-blot analysis (Fig. 3). Levels of phosphorylated signal transducer and activator of transcription 3 (pSTAT3), c-Jun N-terminal kinase 2 (JNK2) and extracellular signal-related kinase (ERK) were analyzed in the Pam3Cys-treated PBLs due to their significant role in the control of cell apoptosis, differentiation, migration and proliferation. The western-blot analysis indicated the increased expression of pSTAT3, JNK2 and ERK (Fig. 3A) stimulated by Pam3Cys. The gray analysis also confirmed that the protein level of pSTAT3 (P<0.001), JNK2 (P<0.001) and ERK (P<0.001) was significantly increased in the Pam3Cys-treated PBLs compared with the untreated group (Fig. 3B). Since pSTAT3 is mostly activated by IL-6 stimulation (6), this indicates that the TLR1/2 agonist, through increase in the expression of IL-6, plays an important role in immune response function of PBLs. This result also confirmed that ERK and JNK were important in the IL-1β-, IL-8- and MIP-1α-mediated immune response in PBLs caused by Pam3Cys stimulation (7,8).

Figure 3

Analysis of kinase signal protein expression by western blotting. (A) Western blotting result; (B) gray analysis of western blotting. **P<0.001; *P<0.05 versus control group. NL, normal control; Pam3Cys, TLR1 agonist-treated; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ERK, extracellular signal-related kinase; pSTAT3, phosphorylated signal transducer and activator of transcription 3; JNK2, c-Jun N-terminal kinase 2.

Discussion

TLR1 and 2 play an important role in detecting Gram-positive bacteria, and are involved in the recognition of a variety of microbial components such as lipoproteins (9). The current study examined the expressional variation of immunomodulatory molecules of PBL stimulated by the TLR1/2 agonist. The technique of in vitro stimulation of human PBLs with TLR agonists followed by quantification of cytokine expression is not novel. This approach can be used to identify the PBLs immunological signature and to understand the TLR signaling pathways. In particular, alterations in the expression of genes implicated in the following biological processes were analyzed: i) tumor-related genes, ii) chemokines, iii) interleukins, iv) growth factors.

Although a former study showed that the TLR1/2 agonist increased the release of IL-8 and TNF-α (10), the present results demonstrated that activation of TLR1/2 could induce expression of numerous immunomodulatory factors, including tumor-related genes (c-myc, PTEN, IFN-β and ITGB3), chemokines (CXCL2, CXCL and CCL26), ILs (IL-1β, IL-6, IL-8 and IL-15) and growth factors (MIP-1α and MIP-1β), and only three factors showed decreased expression (CCL28, RANTES and IP10). However in antibody-chip assays of supernatant, only four factors showed expressional variation (IL-6, IL-8, MIP-1α and IFN-β). The explanation for this was either that the increase in gene expression was not equal with the increase in protein level or that the treatment time was too short (4 h) to detect the late expression of numerous factors in the culture supernatant. The study also uncovered the fact that at least three kinase signal proteins (pSTAT3, JNK2 and ERK) were significantly induced by the TLR1/2 agonist, which indicated that there were a number of kinase signal pathways involved in the immune response that were induced by activation of the TLR1/2 ligand.

The key difference between the present study and the previous literature is that the present study surveyed more factors that were significant in promoting the pro-inflammatory status, while in the majority of other studies, only a few cytokines were detected. This difference may miss the complexity of the TLR1/2 response, including the increased expression of c-myc, PTEN and the CXCLs that was observed in Pam3Cys, which had not been reported previously.

This study examined a broader range of molecules, which were significant in immune modulation. The limitation of the study was that there was only one time-point (4 h) detected; the treatment time of TLR1/2 should therefore be extended, as certain later response molecules will fail to be detected. Based on this study, the enhanced TLR1/2-induced release of pro-inflammatory conditions by PBLs indicates a possible dysregulation in the innate immune system. Our further studies will extend the treatment time of the TLR1/2 agonist and broaden the signal pathway assay.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (grant no. 81300170).

References

1 

Akira S, Uematsu S and Takeuchi O: Pathogen recognition and innate immunity. Cell. 124:783–801. 2006. View Article : Google Scholar

2 

Miggin SM and O’Neill LA: New insights into the regulation of TLR signaling. J Leukoc Biol. 80:220–226. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Smith EL, Cools N, Lion E, et al: The Toll-like receptor 7/8 agonist resiquimod greatly increases the immunostimulatory capacity of human acute myeloid leukemia cells. Cancer Immunol Immunother. 59:35–46. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Hornung V, Rothenfusser S, Britsch S, et al: Quantitative expression of toll-like receptor 1–10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides. J Immunol. 168:4531–4537. 2002.

5 

Ozinsky A, Underhill DM, Fontenot JD, et al: The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors. Proc Natl Acad Sci USA. 97:13766–13771. 2000. View Article : Google Scholar : PubMed/NCBI

6 

Niemand C, Nimmesgern A, Haan S, et al: Activation of STAT3 by IL-6 and IL-10 in primary human macrophages is differentially modulated by suppressor of cytokine signaling 3. J Immunol. 170:3263–3272. 2003. View Article : Google Scholar : PubMed/NCBI

7 

Peyssonnaux C and Eychène A: The Raf/MEK/ERK pathway: new concepts of activation. Biol Cell. 93:53–62. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Chen YR and Tan TH: The c-Jun N-terminal kinase pathway and apoptotic signaling (Review). Int J Oncol. 16:651–652. 2000.PubMed/NCBI

9 

Alexopoulou L, Thomas V, Schnare M, et al: Hyporesponsiveness to vaccination with Borrelia burgdorferi OspA in humans and in TLR1- and TLR2-deficient mice. Nat Med. 8:878–884. 2002.PubMed/NCBI

10 

Kwok YH, Hutchinson MR, Gentgall MG and Rolan PE: Increased responsiveness of peripheral blood mononuclear cells to in vitro TLR 2, 4 and 7 ligand stimulation in chronic pain patients. PloS One. 7:e442322012. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Peng Y and Zhang L: Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes. Exp Ther Med 7: 1708-1712, 2014.
APA
Peng, Y., & Zhang, L. (2014). Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes. Experimental and Therapeutic Medicine, 7, 1708-1712. https://doi.org/10.3892/etm.2014.1621
MLA
Peng, Y., Zhang, L."Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes". Experimental and Therapeutic Medicine 7.6 (2014): 1708-1712.
Chicago
Peng, Y., Zhang, L."Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes". Experimental and Therapeutic Medicine 7, no. 6 (2014): 1708-1712. https://doi.org/10.3892/etm.2014.1621
Copy and paste a formatted citation
x
Spandidos Publications style
Peng Y and Zhang L: Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes. Exp Ther Med 7: 1708-1712, 2014.
APA
Peng, Y., & Zhang, L. (2014). Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes. Experimental and Therapeutic Medicine, 7, 1708-1712. https://doi.org/10.3892/etm.2014.1621
MLA
Peng, Y., Zhang, L."Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes". Experimental and Therapeutic Medicine 7.6 (2014): 1708-1712.
Chicago
Peng, Y., Zhang, L."Activation of the TLR1/2 pathway induces the shaping of the immune response status of peripheral blood leukocytes". Experimental and Therapeutic Medicine 7, no. 6 (2014): 1708-1712. https://doi.org/10.3892/etm.2014.1621
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team