Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
June-2016 Volume 37 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2016 Volume 37 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway

  • Authors:
    • Yi Ma
    • Xun Gong
    • Yingli Mo
    • Saizhu Wu
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong 510515, P.R. China, Department of Cardiology, Changsha Central Hospital, Changsha, Hunan 410004, P.R. China
  • Pages: 1652-1660
    |
    Published online on: April 11, 2016
       https://doi.org/10.3892/ijmm.2016.2554
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Oxidative stress-mediated proliferation of vascular smooth muscle cells (VSMCs) contributes to plaque formation and the progression of atherosclerosis. Polydatin is a derivative of resveratrol, and is widely present in certain herbal medications used for the treatment of cardiovascular diseases. In the present study, we examined whether polydatin was capable of attenuating VSMC proliferation induced by oxidative stress as well as the potential involvement of the endothelial nitric oxide synthetase (eNOS)/SIRT1 pathway. Briefly, VSMCs were exposed to H2O2 for 24 h in the absence or presence of polydatin (10-100 µM) prior to performing a cell proliferation assay. In mechanistic studies, the cells were incubated with the silent information regulator 1 (SIRT1) inhibitor, EX527, or the eNOS inhibitor, L-NAME, prior to polydatin treatment. The results showed that polydatin inhibited VSMC proliferation and the level of reactive oxygen species, increased the expression of Kip1/p27, SIRT1 and eNOS, whereas the expression of cyclin B1, Cdk1 and c-myc was decreased. The number of cells in the G2/M phase was increased. Pre-treatment with L-NAME attenuated the inhibitory effects of polydatin on cell proliferation, inhibited the expression of SIRT1 and the phosphorylation of eNOS. Pre-treatment with EX527 also attenuated the inhibitory effects of polydatin on cell proliferation, but failed to reduce the activation of eNOS and the production of nitric oxide. Taken together, these findings suggest that, polydatin inhibited the oxidative stress-induced proliferation of VMSCs by activating the eNOS/SIRT1 pathway.

Introduction

Drinking wine in moderation, in particular red wine, may lower the incidence of cardiovascular diseases, presumably due in part to the benefits of resveratrol in the wine (1). Polydatin is a glycoside derivative of resveratrol, and widely present in various plant sources including red wine, grapes skins and Japanese knotweed (2). Polydatin is an ingredient of many herbal medications used for the treatment of cardiovascular diseases in China. Similar to resveratrol, polydatin has antioxidant (3), anti-inflammatory (4) and anti-ageing (5) effects.

It has been shown that oxidative stress promotes the proliferation of vascular smooth muscle cells (VSMCs) and induces blood vessel remodeling (6), thereby contributing to the pathogenesis of atherosclerosis (7,8). Consequently, inhibiting VSMC proliferation may be used as a future therapeutic strategy for the treatment of atherosclerosis. Previous studies have indicated that polydatin may protect cardiac function from acute injury by reducing oxidative stress and inhibiting sarcoplasmic reticulum Ca2+ leakage (9), inhibiting platelet aggregation and intercellular cell adhesion molecule-1 (ICAM-1) expression, and weakening white blood cell-endothelial cell adhesion (10). However, the effect of polydatin on the oxidative stress-induced proliferation of VSMCs remains unclear.

Silent information regulator 1 (SIRT1) is a key factor that regulates cell responses to oxidative stress by deacetylating non-histone targets (11). Inhibiting SIRT1 expression has been demonstrated to accelerate cell senescence and promote cell injury (12,13). Knockdown of SIRT1 by small interfering RNA in HUVECs resulted in impaired antioxidant ability (14). A previous study from this laboratory revealed that the expression of SIRT1 was reduced in ageing (15). The improvement of endothelial function in the thoracic artery of ageing rats by atorvastatin was associated with the increased expression of SIRT1 and endothelial nitric oxide synthase (eNOS) (15).

In the present study, we demonstrated that polydatin inhibited the oxidative stress-induced proliferation of VSMCs. We then examined the potential role of the eNOS/SIRT1 pathway with EX527, a SIRT1 inhibitor, and L-NAME, an eNOS inhibitor.

Materials and methods

Cell culture

VSMCs were isolated from the thoracic aorta of 12-week-old male Sprague-Dawley rats (Experimental Animal Center, Southern Medical University, Guangzhou, China) as previously described (16). The present study was performed in strict accordance with the Guide for the Care and Use of Laboratory Animals (15). Experimental procedures were approved by the Animal Research Committee of Nanfang Hospital. The purity of the isolated VSMCs was verified using immunohistochemical staining of smooth muscle α-actin. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; PAA Laboratories GmbH, Australia), in a humidified incubator containing 5% CO2 at 37°C. VSMCs at 4–6 passages, and at 40% confluence, were used for the experiments.

Treatment

In the preliminary dose-finding experiments, VSMCs were exposed to the vehicle (0.1% DMSO) and 100 µM H2O2 (Sigma-Aldrich, St. Louis, MO, USA) (14) in the absence or presence of polydatin (purity ≥98%, HPLC) (10, 50 or 100 µM; Baoji Herbest Bio-Tech Co., Ltd., Baoji, China) for 24 h prior to performing a cell proliferation assay using a CCK-8 assay kit (Beyotime Institute of Biotechnology, Nantong, China), as previously described (17). Absorbance was measured with an enzyme-linked microplate assay reader (Thermo Fisher Scientific, Waltham, MA, USA) at 450 nm. In the subsequent set of experiments, the cells were treated with 100 µM eNOS inhibitor L-NAME (18) or 10 µM SIRT1 inhibitor EX527 (both from Sigma-Aldrich) (13) for 2 h prior to treatment with H2O2 and polydatin (100 µM).

Measurement of reactive oxygen species (ROS), superoxide dismutase (SOD) and nitric oxide (NO) levels

Re-suspended cells were incubated in pre-warmed DMEM containing 2,7-dichlorofluorescein diacetate (H2DCFDA; Gibco) fluorescent probe (5 µM) at 37°C for 30 min. The cells were washed with PBS twice. Intracellular ROS was examined using a spectrofluorometer (Agilent Technologies, Inc., Palo Alto, CA, USA) at an excitation wavelength of 485 nm and an emission wavelength of 530 nm, as previously described (19). A thiobarbituric acid method was used to detect SOD with WST-1 assay kit (Jiancheng Bioengineering Institute, Nanjing, China) (20). NO in the supernatant was examined using a Total Nitric Oxide Assay kit (Jiancheng Bioengineering Institute), as previously described (21). Since NO is rapidly converted to nitrite (NO2−) and further to nitrate (NO3−), NO content was reflected by nitrite plus nitrate, as measured with Griess reagent.

Western blot analysis

Total protein was measured using a bicinchoninic acid (BCA) method. Samples containing 50 µg protein were separated by 10% SDS-PAGE and transferred to PVDF membranes (Millipore, Bedford, MA, USA). The membranes were blocked with 5% non-fat milk in Tris-buffered saline containing 0.1% Tween-20 at room temperature for 1.5 h, and then incubated overnight at 4°C with anti-Kip1/p27 antibody (1:500), anti-cyclin B1 antibody (1:500), anti-cyclin dependent kinase (Cdk)1 antibody (1:500), anti-c-myc antibody (1:1,000), phosphorylated (p-) (Ser1177)-eNOS antibody (1:250), anti-eNOS antibody (1:250) or anti-SIRT antibody (1:500). Polyclonal primary antibodies against SIRT1, p-(Ser1177)-eNOS and eNOS were purchased from Cell Signaling Technology, Inc. (Boston, MA, USA) and Kip1/p27, cyclin B1, Cdk1 and c-myc were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Following incubation with a horseradish peroxidase (HRP)-conjugated secondary antibody (Bio-Rad, Hercules, CA, USA) for 1 h, the blots were visualized using an enhanced chemiluminescence (ECL) method. Bands of interest were quantified using Image J software (National Institutes of Health, Bethesda, MD, USA). β-actin (1:1,000; ZSGB-BIO, Beijing, China) was used as the loading control.

Cell cycle analysis

The cells were fixed with ice-cold 70% ethanol for 4 h, washed with PBS twice and stained with propidium iodide (PI). A minimum of 1×103 cells/sample were counted. Cells in distinct cell cycles were characterized by DNA amount (G0/G1 cells, diploid; S cells, DNA synthesis between diploid and tetraploid; and G2/M cells, tetraploid) using flow cytometry (FCM; Beckman Coulter, Inc., Brea, CA, USA), as previously reported (22).

Reverse transcription quantitative-polymerase chain reaction (RT-qPCR)

Total RNA was extracted with RNAiso Plus (Takara Bio, Dalian, China) using a phenol-chloroform method. Reverse transcription was carried out in 20 µl reaction mixture containing 1 µg total RNA. The primers were designed using GenBank sequences and Primer-BLAST (Table I). The resulting cDNA was amplified using a SYBR-Green PCR method. Initial denaturation was performed at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 45 sec. SIRT1 and eNOS mRNA were calculated using a comparative threshold cycle (Ct) method (ΔΔCt method) with β-actin as a reference.

Table I

Primers used for RT-qPCR.

Table I

Primers used for RT-qPCR.

Target mRNAForward primer (5′ to 3′)Reverse primer (5′ to 3′)
SIRT1 ACAACCTCCTGTTGGCTGATGAGA AGAATTGTTCGAGGATCGGTGCCA
eNOS GGATCCAGTGGGGGAAACTG TGGCTGAACGAAGATTGCCT
β-actin CCCATCTATGAGGGTTACGC TTTAATGTCACGCACGATTTC

[i] SIRT1, silent information regulator 1; eNOS, endothelial nitric oxide synthase.

Statistical methods

Data were presented as the means ± standard deviation (SD) for at least three sets of independent experiments and analyzed using one-way analysis of variance (ANOVA), followed by post-hoc analysis for pairwise comparison: LSD method upon homogeneity of variance, Dunnett's t-test. P<0.05 (two-sided test) was considered to indicate a statistically significant difference. Statistical analyses were performed using SPSS 13.0 software (SPSS Inc., Chicago, IL, USA).

Results

Effect of polydatin on proliferation

Polydatin attenuated H2O2-induced VSMC proliferation in a concentration-dependent manner (P<0.05 at 50 and 100 µM vs. H2O2-treated group alone; Fig. 1A). Polydatin concentrations of 50 and 100 µM were selected for subsequent experiments.

Figure 1

Effects of polydatin on vascular smooth muscle cells (VSMCs) under H2O2-induced oxidative stress. VSMCs were incubated with either vehicle (DMSO) or 10–100 µM polydatin in the presence of H2O2 (100 µM) for 24 h. (A) Cell proliferation in different groups. (B) Superoxide dismutase (SOD) activity of VSMCs in different groups. (C) Nitric oxide (NO) level of VSMCs in different groups. (D) ROS level of VSMCs in different groups. Data are presented as the means ± SD; n=5 per group. *P<0.05 vs. control group; #P<0.05 vs. H2O2-treated group alone.

Effects of polydatin on ROS, SOD, NO, eNOS and SIRT1

At 50 and 100 µM, polydatin significantly decreased the level of ROS, and increased the activity of SOD and the level of NO (P<0.05 vs. H2O2-treated group alone; Fig. 1B–D). Polydatin (100 µM) increased the mRNA level of SIRT1 and eNOS in cells exposed to H2O2 (P<0.05 vs. 50 µM polydatin-treated group; Fig. 2A and B). The results obtained with western blot analysis were generally consistent with the mRNA findings (Fig. 2C).

Figure 2

Effects of polydatin on the mRNA level and protein expression of silent information regulator 1 (SIRT1) and eNOS. (A) Measurement of SIRT1 mRNA level in different groups. (B) Measurement of eNOS mRNA level in different groups. (C) Measurement of SIRT1 and eNOS protein expression in different groups. Data are presented as the means ± SD; n=3 per group. *P<0.05 vs. H2O2-treated group alone; #P<0.05 vs. H2O2 combined with 50 µM polydatin treatment group.

Effects of polydatin on the cell cycle

Treatment with polydatin increased the number of cells in the G2/M phase (from 3.78±0.26 to 15.62±0.22% and 23.31±0.34% at 50 and 100 µM, respectively) and decreased the number of cells in the G0/G1 phase (from 92.15±0.19 to 77.02±0.31% and 66.30±0.18% at 50 and 100 µM, respectively) (P<0.05 at 50 and 100 µM vs. H2O2-treated group alone; Fig. 3).

Figure 3

Effects of polydatin on the cell cycle of vascular smooth muscle cells (VSMCs) in the presence of H2O2. Cells were co-treated with different concentrations of polydatin (50 and 100 µM) and H2O2 or vehicle-treated control for 24 h. Cell cycle analysis was then performed by measuring the cellular DNA content. Data are presented as the means ± SD; n=3 per group. *P<0.05 vs. control group; #P<0.05 vs. H2O2-treated group alone.

Effects of polydatin on the cell cycle proteins

H2O2 treatment alone increased cyclin B1 and Cdk1 and decreased Kip1/p27 (P<0.05 vs. the control group; Fig. 4A). Polydatin decreased cyclin B1 and Cdk1 expression and increased Kip1/p27 expression in cells exposed to H2O2 (P<0.05 vs. the H2O2-treated group alone). H2O2 increased the protein level of c-myc. Polydatin inhibited such a response (P<0.05 vs. the H2O2-treated group alone; Fig. 4B).

Figure 4

Effects of polydatin on cell cycle-related protein levels in the presence of H2O2. (A) Kip1/p27, cyclin B1 and Cdk1. (B) c-myc. The total cellular lysis products for protein extraction were prepared and adjusted for western blot analysis with proper dilutions of specific antibodies for Kip1/p27, cyclin B1, Cdk1, c-myc and β-actin. Data are presented as the means ± SD; n=3 per group. *P<0.05 vs. H2O2-treated group alone; #P<0.05 vs. H2O2 combined with 50 µM polydatin treatment group.

Effects of L-NAME and EX527 pre-treatment

The CCK-8 assay revealed that polydatin inhibited VSMC proliferation (Fig. 5A). L-NAME pre-treatment reversed the effects of polydatin on SOD activity (Fig. 5B) and ROS levels (Fig. 5D). Additionally, L-NAME pre-treatment decreased NO levels (Fig. 5C). Polydatin (100 µM) increased the phosphorylation of eNOS protein (p-eNOS) at Ser1177 of its catalytic subunit, and L-NAME treatment attenuated such a response (P<0.05; Fig. 5E).

Figure 5

Effects of L-NAME in vascular smooth muscle cells (VSMCs). (A) Measurement of cell proliferation in VSMCs treated with L-NAME. (B) Measurement of SOD activity in different groups. (C) Measurement of NO levels in different groups. (D) Measurement of ROS levels in different groups. (E) Quantification of silent information regulator 1 (SIRT1), p-eNOS and eNOS protein expression in different groups detected by western blot analysis. Data are presented as the means ± SD of three independent experiments. *P<0.05 vs. H2O2-treated group alone; #P<0.05 vs. H2O2 combined with 100 µM polydatin treatment group.

EX527 pre-treatment attenuated the anti-proliferative effects of polydatin (Fig. 6A). EX527 pre-treatment also decreased SOD activity (Fig. 6B) and increased ROS levels (Fig. 6D). EX527 pre-treatment significantly decreased SIRT1 expression at the protein level (P<0.05). There was no decrease in NO levels (Fig. 6C), and eNOS and p-eNOS expression at the protein level (Fig. 6E). L-NAME and EX527 pre-treatment decreased the expression of Kip1/p27 at the protein level, and increased cyclin B1 (Fig. 7).

Figure 6

Effects of EX527 in vascular smooth muscle cells (VSMCs). (A) Meaurement of cell proliferation in VSMCs treated with EX527. (B) Measurement of SOD activity in different groups. (C) Measurement of NO levels in different groups. (D) Measurement of ROS levels in different groups. (E) Quantification of silent information regulator 1 (SIRT1), p-eNOS and eNOS protein expression in different groups detected by western blot analysis. Data are presented as the means ± SD of three independent experiments. *P<0.05 vs. H2O2-treated group alone; #P<0.05 vs. H2O2 combined with 100 µM polydatin treatment group.

Figure 7

Effects of L-NAME and EX527 on polydatin-mediated cyclin B1 and Kip1/p27 protein expression in vascular smooth muscle cells (VSMCs). The cells were treated with L-NAME (100 µM) or EX527 (10 µM) for 2 h, and then treated with polydatin and H2O2 for 24 h. The total cellular protein extracts were prepared and adjusted for western blot analysis with appropriate dilutions of specific antibodies for cyclin B1, Kip1/p27 and β-actin. Data are presented as the means ± SD (n=3). *P<0.05 vs. H2O2 combined with 100 µM polydatin treatment group.

Discussion

The results from the present study have shown that polydatin, an analog of resveratrol, attenuated the proliferation of VSMCs under oxidative stress. Such an effect may be attributed to G2/M-phase arrest, an increased antioxidant capacity, and activation of the eNOS-SIRT1 signaling pathway in the VSMCs.

Resveratrol has been previously reported to have anti-proliferative (23), antioxidant (24) and anti-aging (25,26) properties in vitro and in vivo. Polydatin, also known as piceid, is a derivative of resveratrol. Polydatin and resveratrol have been demonstrated to produce their effects via the stilbene synthesis pathway (27). Previous studies have indicated that stilbene derivatives with more phenolic moieties and an increased number of OH groups on the phenol ring have improved biological effects compared with resveratrol (28), including lower toxicity, better anticancer activities and sirtuin activation (29). Hydroxystilbene analogues with more hydroxyl groups on the phenol rings of the stilbene structure tend to have higher anti-radical activity than resveratrol (29). Polydatin has more potent anti-proliferative effects on intestinal epithelial cells than resveratrol (30), possibly due to an increased number of hydroxyl groups on the ring-structure.

Cell proliferation is accompanied by the activation of cell cycle proteins (31). The cell cycle is controlled by many factors, including cyclins/CDK complexes and CDK inhibitors (CDKI) (32). High activity of the cyclin B1/CDK complex allows the progression of cells through the G2/M phase, and thus, is critical for mitosis (33). Previous findings have shown that resveratrol inhibited VSMC proliferation by inducing cell cycle arrest and increasing DNA synthesis (22). The results from the present study indicated that the promotion of VSMC proliferation by oxidative stress was accompanied by an increased expression of cyclin B1 and Cdk1, and a decreased expression of Kip1/p27 (Fig. 4). A previous study indicated that the downregulation of CDKI and Kip1/p27, interfered with G2/M arrest in response to DNA injury stress, thereby increasing genetic instability (34). Consistent with those findings, our data indicated that polydatin inhibited oxidative stress-induced VSMC proliferation, in part by arresting the cell cycle at the G2/M phase (Fig. 3). This finding is associated with the upregulation of CDKI and Kip1/p27, and the downregulation of cyclin B1 and Cdk1. Pre-treatment with the eNOS inhibitor, L-NAME, or the SIRT1 inhibitor, EX527, attenuated Kip1/p27 expression, and increased cyclin B1 levels (Fig. 7). These results indicated that the effect of polydatin on VSMC proliferation is mediated by eNOS and SIRT1.

The c-myc is an important oncogene that regulates cell growth. Activation of c-myc promotes the proliferation of many cells, including VSMCs (35). In our study, c-myc expression was significantly increased by H2O2 and this response was inhibited by polydatin.

Resveratrol is a trihydroxy stilbene that is effective against oxidative stress and in the treatment of cardiovascular diseases (36). Numerous stilbene analogues have been developed based on the structure of resveratrol. A previous study indicated that polydatin and resveratrol possess scavenging activity against hydroxyl radicals in vitro (36). To evaluate the effect of polydatin on H2O2-treated VSMCs, we assessed NO, SOD, and ROS levels. In our experiments, the levels of NO and SOD were significantly increased following treatment with 50 and 100 µM polydatin, with a concomitant decrease in ROS levels. The results suggested that polydatin plays an anti-oxidant role by increasing the cellular oxidative tolerance to extracellular oxidative environmental change, as well as by eliminating ROS caused by oxidative stress in VSMCs.

eNOS regulates VSMC proliferation (37). Several protein kinases, including Akt/PI3K and AMPK, activated eNOS by phosphorylating Ser1177 in response to various stimuli (38,39). A previous study showed that resveratrol increased eNOS mRNA and protein expression levels and promoted NO production in endothelial cells (40). Resveratrol has been shown to inhibit rat aortic VSMC proliferation through estrogen receptor-dependent NO production (41). The present study demonstrated that the inhibition of eNOS by H2O2 was accompanied by a decreasing NO expression level. Although eNOS/NO expression by polydatin was not equivalent to the restoration of VSMC function in the normal control group in the present study. Thus, polydatin may attenuate VSMC prolife ration. In our experiments, L-NAME, a reversible eNOS inhibitor, downregulated the expression of eNOS, SIRT1 and Kip1/p27, with the concomitant upregulation of cyclin B1 protein expression. We hypothesized that L-NAME reversed the inhibitory effects of polydatin on cell proliferation by inhibiting eNOS expression.

SIRT1 regulates many pathways for nutrient bioavailability, cellular energy status and various receptor signaling pathways. SIRT1 has been proven to inhibit oxidative stress (42), interact with eNOS to improve vascular function and retard endothelial senescence (43). Resveratrol induced VSMC differentiation by stimulating SIRT1 and AMPK (44). SIRT1 was regulated by NO when shuttled between the nucleus and cytosol, upregulated ROS scavengers, Mn-SOD and catalase, and catabolized toxic H2O2, which in turn was detoxified to water (45). SIRT1 is a crucial regulator of radical scavengers and transcriptional activation, and inhibits inflammatory expression via induction of eNOS (46,47). Thus, the SIRT1-eNOS/NO signaling pathway may be regarded as a potential target against atherosclerosis (48). In the present study, the expression of SIRT1 protein in VSMCs was significantly induced by polydatin. The peak effect on SIRT1 expression at 100 µM polydatin positively correlated with eNOS expression, suggesting that SIRT1 maybe involved in NO synthesis.

EX527, a specific inhibitor of SIRT1, did not affect the expression of eNOS in VSMCs. We hypothesize that SIRT1 may act as antioxidant regulator by activating upstream eNOS/NO in VSMCs. Taken together with the findings regarding cell cycle-related proteins, results of the present study suggest that SIRT1 functions as a vital regulator of the anti-proliferative effect of polydatin in VSMCs.

There are some limitations to our study. Firstly, it remains undetermined whether polydatin and resveratrol are capable of enhancing the activation of the eNOS/SIRT1 pathway in VSMCs. Secondly, the H2O2 model does not faithfully represent the in vivo oxidative damage microenvironment. Thirdly, the present study did not include the AMPK/eNOS pathway, which is apparently important for cell proliferation.

In conclusion, our study has demonstrated that polydatin improves oxidative stress-related changes by increasing SOD levels, ameliorating the level of ROS, inhibiting cell proliferation, upregulating eNOS/NO-SIRT1 expression during H2O2-induced oxidative damage in VSMCs. The present findings may contribute to the development of strategies for the prevention and treatment of oxidative lesions in the vasculature by targeting the eNOS/NO-SIRT1 pathway.

Acknowledgments

This study was supported by grants from the Science and Technology Item of Guangdong Province (2010B031500013) and the National Basic Research Program of China (2007CB507404).

References

1 

Das S and Das DK: Resveratrol: a therapeutic promise for cardiovascular diseases. Recent Patents Cardiovasc Drug Discov. 2:133–138. 2007. View Article : Google Scholar

2 

Chen H, Tuck T, Ji X, Zhou X, Kelly G, Cuerrier A and Zhang J: Quality assessment of Japanese knotweed (Fallopia japonica) grown on Prince Edward Island as a source of resveratrol. J Agric Food Chem. 61:6383–6392. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Du QH, Peng C and Zhang H: Polydatin: a review of pharmacology and pharmacokinetics. Pharm Biol. 51:1347–1354. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Chen L, Lan Z, Lin Q, Mi X, He Y, Wei L, Lin Y, Zhang Y and Deng X: Polydatin ameliorates renal injury by attenuating oxidative stress-related inflammatory responses in fructose-induced urate nephropathic mice. Food Chem Toxicol. 52:28–35. 2013. View Article : Google Scholar

5 

Wen H, Gao X and Qin J: Probing the anti-aging role of polydatin in Caenorhabditis elegans on a chip. Integr Biol (Camb). 6:35–43. 2014. View Article : Google Scholar

6 

Blanc A, Pandey NR and Srivastava AK: Synchronous activation of ERK 1/2, p38mapk and PKB/Akt signaling by H2O2 vascular smooth muscle cells: potential involvement in vascular 2 2 in disease (Review). Int J Mol Med. 11:229–234. 2003.PubMed/NCBI

7 

Jiang D, Li D and Wu W: Inhibitory effects and mechanisms of luteolin on proliferation and migration of vascular smooth muscle cells. Nutrients. 5:1648–1659. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Lan TH, Huang XQ and Tan HM: Vascular fibrosis in atherosclerosis. Cardiovasc Pathol. 22:401–407. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Jiang X, Liu W, Deng J, Lan L, Xue X, Zhang C, Cai G, Luo X and Liu J: Polydatin protects cardiac function against burn injury by inhibiting sarcoplasmic reticulum Ca2+ leak by reducing oxidative modification of ryanodine receptors. Free Radic Biol Med. 60:292–299. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Zhao KS, Jin C, Huang X, Liu J, Yan WS, Huang Q and Kan W: The mechanism of polydatin in shock treatment. Clin Hemorheol Microcirc. 29:211–217. 2003.

11 

Salminen A, Kaarniranta K and Kauppinen A: Crosstalk between oxidative stress and SIRT1: Impact on the aging process. Int J Mol Sci. 14:3834–3859. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Zhang H, Zhai Z, Wang Y, Zhang J, Wu H, Wang Y, Li C, Li D, Lu L, Wang X, et al: Resveratrol ameliorates ionizing irradiation-induced long-term hematopoietic stem cell injury in mice. Free Radic Biol Med. 54:40–50. 2013. View Article : Google Scholar

13 

Zarzuelo MJ, López-Sepúlveda R, Sánchez M, Romero M, Gómez-Guzmán M, Ungvary Z, Pérez-Vizcaíno F, Jiménez R and Duarte J: SIRT1 inhibits NADPH oxidase activation and protects endothelial function in the rat aorta: implications for vascular aging. Biochem Pharmacol. 85:1288–1296. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Kao CL, Chen LK, Chang YL, Yung MC, Hsu CC, Chen YC, Lo WL, Chen SJ, Ku HH and Hwang SJ: Resveratrol protects human endothelium from H2O2-induced oxidative stress and senescence via SirT1 activation. J Atheroscler Thromb. 17:970–979. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Gong X, Ma Y, Ruan Y, Fu G and Wu S: Long-term atorvastatin improves age-related endothelial dysfunction by ameliorating oxidative stress and normalizing eNOS/iNOS imbalance in rat aorta. Exp Gerontol. 52:9–17. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Salabei JK, Cummins TD, Singh M, Jones SP, Bhatnagar A and Hill BG: PDGF-mediated autophagy regulates vascular smooth muscle cell phenotype and resistance to oxidative stress. Biochem J. 451:375–388. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Ni L, Li T, Liu B, Song X, Yang G, Wang L, Miao S and Liu C: The protective effect of Bcl-xl overexpression against oxidative stress-induced vascular endothelial cell injury and the role of the Akt/eNOS pathway. Int J Mol Sci. 14:22149–22162. 2013. View Article : Google Scholar : PubMed/NCBI

18 

San Martin A, Foncea R, Laurindo FR, Ebensperger R, Griendling KK and Leighton F: Nox1-based NADPH oxidase- derived superoxide is required for VSMC activation by advanced glycation end-products. Free Radic Biol Med. 42:1671–1679. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Botden IP, Oeseburg H, Durik M, Leijten FP, Van Vark-Van Der, Zee LC, Musterd-Bhaggoe UM, Garrelds IM, Seynhaeve AL, Langendonk JG, Sijbrands EJ, et al: Red wine extract protects against oxidative-stress-induced endothelial senescence. Clin Sci (Lond). 123:499–507. 2012. View Article : Google Scholar

20 

Wang Q, Zhou H, Gao H, Chen SH, Chu CH, Wilson B and Hong JS: Naloxone inhibits immune cell function by suppressing superoxide production through a direct interaction with gp91phox subunit of NADPH oxidase. J Neuroinflammation. 9:322012. View Article : Google Scholar

21 

Miranda KM, Espey MG and Wink DA: A rapid, simple spectrophotometric method for simultaneous detection of nitrate and nitrite. Nitric Oxide. 5:62–71. 2001. View Article : Google Scholar : PubMed/NCBI

22 

Shi Y, Hou X, Zhang X, Wang Y, Chen Y and Zou J: Inhibition of oxidized-phospholipid-induced vascular smooth muscle cell proliferation by resveratrol is associated with reducing Cx43 phosphorylation. J Agric Food Chem. 61:10534–10541. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Prasad K: Resveratrol, wine, and atherosclerosis. Int J Angiol. 21:7–18. 2012. View Article : Google Scholar :

24 

Gutiérrez-Pérez A, Cortés-Rojo C, Noriega-Cisneros R, Calderón-Cortés E, Manzo-Avalos S, Clemente-Guerrero M, Godínez-Hernández D, Boldogh I and Saavedra-Molina A: Protective effects of resveratrol on calcium-induced oxidative stress in rat heart mitochondria. J Bioenerg Biomembr. 43:101–107. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Han X, Ling S, Gan W, Sun L, Duan J and Xu JW: 2,3,5,4′-tetra-hydroxystilbene-2-O-β-d-glucoside ameliorates vascular senescence and improves blood flow involving a mechanism of p53 deacetylation. Atherosclerosis. 225:76–82. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Park SJ, Ahmad F, Philp A, Baar K, Williams T, Luo H, Ke H, Rehmann H, Taussig R, Brown AL, et al: Resveratrol ameliorates aging-related metabolic phenotypes by inhibiting cAMP phosphodiesterases. Cell. 148:421–433. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Robb EL and Stuart JA: The stilbenes resveratrol, pterostilbene and piceid affect growth and stress resistance in mammalian cells via a mechanism requiring estrogen receptor beta and the induction of Mn-superoxide dismutase. Phytochemistry. 98:164–173. 2014. View Article : Google Scholar

28 

Yang H, Baur JA, Chen A, Miller C, Adams JK, Kisielewski A, Howitz KT, Zipkin RE and Sinclair DA: Design and synthesis of compounds that extend yeast replicative lifespan. Aging Cell. 6:35–43. 2007. View Article : Google Scholar

29 

Szekeres T, Fritzer-Szekeres M, Saiko P and Jäger W: Resveratrol and resveratrol analogues - structure-activity relationship. Pharm Res. 27:1042–1048. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Storniolo CE, Quifer-Rada P, Lamuela-Raventos RM and Moreno JJ: Piceid presents antiproliferative effects in intestinal epithelial Caco-2 cells, effects unrelated to resveratrol release. Food Funct. 5:2137–2144. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Bicknell KA, Surry EL and Brooks G: Targeting the cell cycle machinery for the treatment of cardiovascular disease. J Pharm Pharmacol. 55:571–591. 2003. View Article : Google Scholar : PubMed/NCBI

32 

Bonelli P, Tuccillo FM, Borrelli A, Schiattarella A and Buonaguro FM: CDK/CCN and CDKI alterations for cancer pro gnosis and therapeutic predictivity. Biomed Res Int. 2014:3610202014. View Article : Google Scholar

33 

Wang Z, Fan M, Candas D, Zhang TQ, Qin L, Eldridge A, Wachsmann-Hogiu S, Ahmed KM, Chromy BA, Nantajit D, et al: Cyclin B1/Cdk1 coordinates mitochondrial respiration for cell-cycle G2/M progression. Dev Cell. 29:217–232. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Payne SR, Zhang S, Tsuchiya K, Moser R, Gurley KE, Longton G, deBoer J and Kemp CJ: p27kip1 deficiency impairs G2/M arrest in response to DNA damage, leading to an increase in genetic instability. Mol Cell Biol. 28:258–268. 2008. View Article : Google Scholar :

35 

Wang J, Liu K, Shen L, Wu H and Jing H: Small interfering RNA to c-myc inhibits vein graft restenosis in a rat vein graft model. J Surg Res. 169:e85–e91. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Su D, Cheng Y, Liu M, Liu D, Cui H, Zhang B, Zhou S, Yang T and Mei Q: Comparision of piceid and resveratrol in anti-oxidation and antiproliferation activities in vitro. PLoS One. 8:e545052013. View Article : Google Scholar

37 

Huang J, Li LS, Yang DL, Gong QH, Deng J and Huang XN: Inhibitory effect of ginsenoside Rg1 on vascular smooth muscle cell proliferation induced by PDGF-BB is involved in nitric oxide formation. Evid Based Complement Alternat Med. 2012:3143952012. View Article : Google Scholar : PubMed/NCBI

38 

Gonon AT, Widegren U, Bulhak A, Salehzadeh F, Persson J, Sjöquist PO and Pernow J: Adiponectin protects against myocardial ischaemia-reperfusion injury via AMP-activated protein kinase, Akt, and nitric oxide. Cardiovasc Res. 78:116–122. 2008. View Article : Google Scholar : PubMed/NCBI

39 

Trott DW, Luttrell MJ, Seawright JW and Woodman CR: Aging impairs PI3K/Akt signaling and NO-mediated dilation in soleus muscle feed arteries. Eur J Appl Physiol. 113:2039–2046. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Takahashi S and Nakashima Y: Repeated and long-term treatment with physiological concentrations of resveratrol promotes NO production in vascular endothelial cells. Br J Nutr. 107:774–780. 2012. View Article : Google Scholar

41 

Ekshyyan VP, Hebert VY, Khandelwal A and Dugas TR: Resveratrol inhibits rat aortic vascular smooth muscle cell proliferation via estrogen receptor dependent nitric oxide production. J Cardiovasc Pharmacol. 50:83–93. 2007. View Article : Google Scholar : PubMed/NCBI

42 

Hori YS, Kuno A, Hosoda R and Horio Y: Regulation of FOXOs and p53 by SIRT1 modulators under oxidative stress. PLoS One. 8:e738752013. View Article : Google Scholar : PubMed/NCBI

43 

Potente M and Dimmeler S: NO targets SIRT1: A novel signaling network in endothelial senescence. Arterioscler Thromb Vasc Biol. 28:1577–1579. 2008. View Article : Google Scholar : PubMed/NCBI

44 

Thompson AM, Martin KA and Rzucidlo EM: Resveratrol induces vascular smooth muscle cell differentiation through stimulation of SirT1 and AMPK. PLoS One. 9:e854952014. View Article : Google Scholar : PubMed/NCBI

45 

Tanno M, Kuno A, Horio Y and Miura T: Emerging beneficial roles of sirtuins in heart failure. Basic Res Cardiol. 107:2732012. View Article : Google Scholar : PubMed/NCBI

46 

Xia N, Strand S, Schlufter F, Siuda D, Reifenberg G, Kleinert H, Förstermann U and Li H: Role of SIRT1 and FOXO factors in eNOS transcriptional activation by resveratrol. Nitric Oxide. 32:29–35. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Takizawa Y, Kosuge Y, Awaji H, Tamura E, Takai A, Yanai T, Yamamoto R, Kokame K, Miyata T, Nakata R and Inoue H: Up-regulation of endothelial nitric oxide synthase (eNOS), silent mating type information regulation 2 homologue 1 (SIRT1) and autophagy-related genes by repeated treatments with resveratrol in human umbilical vein endothelial cells. Br J Nutr. 110:2150–2155. 2013. View Article : Google Scholar : PubMed/NCBI

48 

Ota H, Eto M, Ogawa S, Iijima K, Akishita M and Ouchi Y: SIRT1/eNOS axis as a potential target against vascular senescence, dysfunction and atherosclerosis. J Atheroscler Thromb. 17:431–435. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ma Y, Gong X, Mo Y and Wu S: Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway. Int J Mol Med 37: 1652-1660, 2016.
APA
Ma, Y., Gong, X., Mo, Y., & Wu, S. (2016). Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway. International Journal of Molecular Medicine, 37, 1652-1660. https://doi.org/10.3892/ijmm.2016.2554
MLA
Ma, Y., Gong, X., Mo, Y., Wu, S."Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway". International Journal of Molecular Medicine 37.6 (2016): 1652-1660.
Chicago
Ma, Y., Gong, X., Mo, Y., Wu, S."Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway". International Journal of Molecular Medicine 37, no. 6 (2016): 1652-1660. https://doi.org/10.3892/ijmm.2016.2554
Copy and paste a formatted citation
x
Spandidos Publications style
Ma Y, Gong X, Mo Y and Wu S: Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway. Int J Mol Med 37: 1652-1660, 2016.
APA
Ma, Y., Gong, X., Mo, Y., & Wu, S. (2016). Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway. International Journal of Molecular Medicine, 37, 1652-1660. https://doi.org/10.3892/ijmm.2016.2554
MLA
Ma, Y., Gong, X., Mo, Y., Wu, S."Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway". International Journal of Molecular Medicine 37.6 (2016): 1652-1660.
Chicago
Ma, Y., Gong, X., Mo, Y., Wu, S."Polydatin inhibits the oxidative stress-induced proliferation of vascular smooth muscle cells by activating the eNOS/SIRT1 pathway". International Journal of Molecular Medicine 37, no. 6 (2016): 1652-1660. https://doi.org/10.3892/ijmm.2016.2554
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team