The association of LMP7 and TAP2 gene polymorphisms with treatment response to interferon/ribavirin in patients with genotype 1 chronic hepatitis C

  • Authors:
    • Feng Zang
    • Yinan Yao
    • Mei Liu
    • Haozhi Fan
    • Ming Yue
    • Mingzhu Chen
    • Jie Wang
    • Rongbin Yu
    • Peng Huang
  • View Affiliations

  • Published online on: October 10, 2017     https://doi.org/10.3892/ijmm.2017.3180
  • Pages: 1983-1990
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

Previous studies have highlighted the important role of genes related to antigen presentation in the spontaneous clearance of hepatitis C virus. The present study aimed to explore the association between TAP, LMP and tapasin gene polymorphism and treatment response in chronic hepatitis C virus (CHC) patients. Six single nucleotide polymorphisms in TAP, LMP and tapasin genes were genotyped among 352 Chinese genotype 1 CHC patients with pegylated interferon-α and ribavirin (pegIFN-α/RBV) treatment. There were 232 cases achieving sustained virological response (SVR), which yielded an SVR rate of 65.9%. LMP7 rs2071543 variant genotypes [additive model: odds ratio (OR), 0.52; 95% confidence interval (CI), 0.33-0.82; P=0.005] and TAP2 rs1800454 variant genotypes (additive model: OR, 0.66; 95% CI, 0.45‑0.98; P=0.039) were suggested to decrease the possibility of achieving an SVR. After conducting combined effect analysis of rs2071543 and rs1800454, the authors found that the SVR rate was lower among patients carrying more unfavorable rs1800454-A and rs2071543-A alleles, and the SVR rate of carrying 3-4 alleles was 20%. In addition, carrying two unfavorable alleles led to significantly decreased possibility for SVR (OR, 0.30; 95% CI, 0.14-0.61; P=0.001). Multivariate stepwise analysis indicated that rs2071543, rs1800454, glucose, α-fetoprotein, platelets and baseline viral load were risk factors of SVR that were independent of each other. The area under the curve (AUC) consisting of all the above factors produced an AUC of 0.704 (95% CI, 0.647‑0.761; P<0.001). The line charts indicated that the drop in viral load was significantly faster in GG patients than in GC/CC patients during the whole therapy, which was in accordance with the decline of viral load in rs2071543. The present study illustrated that the carriage of LMP7 rs2071543-AA and TAP2 rs1800454-AA had a negative effect on treatment response to pegIFN-α/RBV among genotype 1 patient with CHC in a Chinese Han population.

Introduction

Chronic hepatitis C virus (CHC) infection is a major global health problem with ~200 million people infected and 700,000 people dying from hepatitis C-related liver diseases each year (1). China was considered to have a particularly high prevalence of 0.43% in the general population with 29 million hepatitis C virus (HCV) infected individuals (2,3). Over 70% of acutely infected persons progress into chronic HCV infection, that consequently causes progressive liver fibrosis and hepatocellular carcinoma (4,5).

Although successful execution of direct-acting antiviral therapy (DAA) was recently approved in western countries according to the World Health Organization (WHO 2017) (6). The combination therapy of pegylated interferon-α (pegIFN-α) plus ribavirin (RBV) (pegIFN-α/RBV) was still the most effective treatment for patients with HCV infection in developing countries, such as China due to economic reasons and curative concerns (7). Even though progression to severe liver disease could be prevented in 54–63% of patients through antiviral treatment with pegIFN-α/RBV, the fact that some patients treated with pegIFN-α/RBV failing to achieve sustained virological response (SVR) or experienced side effects should not be neglected (8,9). Therefore, it is important to identify the factors that may affect the response to treatment given that interaction between the virus and host genetics has been theorized to be an important determinant of treatment response and the natural course of hepatitis C (10,11).

A genetic association study clarified that the human leukocyte antigen (HLA) was an essential genetic factor that regulated immune response and may be one of the tactics used by HCV to avoid immune clearance (12). Furthermore, various HLA alleles involved in the immune response were demonstrated to be linked to spontaneous clearance of HCV infection and even be potentially predictive for HCV treatment response (13). Studies to date about HLA alleles mainly focused on the HLA class I and II genes regions, by contrast, the study on non-classic genes located among classic regions was limited, such as LMP2/LMP7 genes, TAP1/TAP2 genes and tapasin genes (1417). These genes, however, have been found in a previous study of the authors to be related to HCV susceptibility and spontaneous clearance.

In the present study, the authors genotyped the TAP gene, LMP7 gene and tapasin gene to investigate the possible association of HLA gene polymorphisms with treatment response to pegIFN-α/RBV in 352 patients with CHC.

Patients and methods

Participants

A total of 352 participants were enrolled in the study from Jurong People's Hospital (Zhenjiang, China). All participants were the patients with genotype 1 CHC identified by the diagnosis of infectious disease in hospital or by doctor visits, and this infection was suspected to come from their former remunerated blood donation behaviors. This study protocol was approved by the institutional review board of Nanjing Medical University (Nanjing, China). All participants provided written informed consent. Interviews for donation history and other risk factors were conducted with signed informed consent from April, 2011 to January, 2016.

Those eligible subjects for the study were included if they received antiviral treatment of pegIFN-α/RBV for the first time and HCV antibody presented positive continually for more than six months. Subjects who were co-infected with hepatitis B virus or human immunodeficiency virus, or suffered from other types of liver diseases, alcoholic diseases, metabolic liver diseases and previous interferon and/or ribavirin therapy during the trial were excluded.

Investigation

Each participant was interviewed face-to-face using a structured and standardized questionnaire administered by trained interviewers. Demographic data, history of common diseases and therapeutic processes were collected for each subject. After the interview, a blood sample of ~10 ml was collected as a source of genomic DNA for serological tests and host DNA genotyping. The authors followed up these participants and detected viral load at on-treatment week 0, 4, 12, 24 and 48 and post-treatment week 24. SVR was defined as HCV RNA below the assay's lower limit of quantitation at post-treatment week 24. Rapid virological response (RVR) was defined as HCV RNA down two logarithmic or below the assay's lower limit of quantitation at post-treatment week 4. Completed early virological response (cEVR) was defined as HCV RNA below the assay's lower limit of quantitation at on-treatment week 12.

Finally, 352 cases with HCV infection (anti-HCV positive) were divided into two groups: 232 sustained virological response cases (SVR) and 120 non-sustained virological response cases (non-SVR).

Laboratory testing

Sera and HCV antibody (anti-HCV) were detected by ELISA (S20130002; Beijing Wantai Biological Pharmacy Enterprise Co., Ltd., Beijing, China) under the manufacturers' instructions. Blood biochemical tests were undertaken by Roche Module P800 Automatic Biochemical Analyzer (Roche Diagnostics GmbH, Basel, Switzerland). Total RNA was extracted from the serum using TRIzol LS Reagent, and HCV RNA was detected by RT-PCR with specific primers using PrimeScript RT-PCR kit (DRR014S; Takara Biotechnology Co., Ltd., Dalian, China).

Single nucleotide polymorphisms (SNPs) selection and genotyping assays

The information of SNPs in four candidate genes (TAP1, TAP2, LMP7 and tapasin) was obtained from the NCBI dbSNP database (http://www.ncbi.nlm.nih.gov/SNP) and the Chinese Han population database of HapMap (http://www.hapmap.org). All the SNPs were filtered with the criteria: MAF (minor allele frequency) ≥0.05. A total of 6 SNPs (TAP1 rs1135216, TAP2 rs1800454, LMP7 rs2071543, tapasin rs9277972, rs1059288 and rs2282851) were chosen for genotyping.

DNA extraction was performed by protease K digestion and phenol-chloroform purification. Genotyping was performed by using a TaqMan allelic discrimination assay on the ABI PRISM 7900 HT sequence detection system (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). PCR was performed according to recommended thermal profile: 50°C for 2 min (preheating), 95°C for 10 min (preincubation) followed by 40 cycles at 95°C for 15 sec (denaturation) and 60°C for 1 min (annealing). Table I presents the TaqMan minor groove-binding (TaqMan-MGB) probes and specific forward/reverse PCR primers used in this study (Nanjing BioSteed BioTechnologies Co., Ltd., Nanjing, China). Two blank controls and five repeated samples were assigned to each 384-well format for quality control, and a 100% concordance was achieved.

Table I

Primers and probes for TaqMan allelic discrimination.

Table I

Primers and probes for TaqMan allelic discrimination.

PolymorphismSequence (5′-3′)
TAP1 rs1135216
 PrimerF: CACACATGTGGCTATACCGTTCTC
R: TCGCTGACCCCCTGACA
 Probe FAM-TGCAGAGGTAGGCG-MGB
HEX-TCTGCAGAGGTAGACG-MGB
TAP2 rs1800454
 PrimerF: CCTGGAACGCGCCTTGTA
R: CCTTTCACAACCACTCTGGTATCTT
 Probe FAM-TGCTCGTAAGGAGG-MGB
HEX-CTGCTCATAAGGAGG-MGB
LMP7 rs2071543
 PrimerF: GCGACCCTCCACTCCTCA
R: GGACACTACAGTTTCTCTATGCGATCT
 Probe FAM-CCGACCTTCATTCC-MGB
HEX-CCGACCTGCATTC-MGB
Tapasin rs9277972
 PrimerF: GTCTAGGTCCTTCAGGTAGAAGTAATCTTT
R: CTAAGTGAAATTGCATACTGTTTTTACTCTAC
 Probe FAM-CCTATAAGGTTAAACTGTTCT-MGB
HEX-CCTATAAGGTTTAACTGTTCT-MGB
Tapasin rs1059288
 PrimerF: TGGGCCTTAGGTCCCTATGC
R: AAGTGATCGTGTGAGTCGTCGTT
 Probe FAM-CAGACAGGCCGGTC-MGB
HEX-ACAGACAGGCCAGTC-MGB
Tapasin rs2282851
 PrimerF: CCTCATTCTTGAATTATCTGCACAGT
R: GCCCAGGAGTCAGAAGCTTTT
 Probe FAM-CCACGTCTCAGCCTA-MGB
HEX-CCACGTCCCAGCCT-MGB

[i] F, forward; R, reverse.

Statistical analysis

Data were scrutinized and then entered a database using EpiData 3.1 by two different studies for further analysis. Differences in general demographic characteristics were calculated by the Student's t-test or one-way analysis of variance and the Chi-square (χ2) test. Dominant and additive genetic models were used in the analysis of each SNP. Associations between SNPs and the treatment response of HCV infection were estimated by calculating the odds ratios (ORs) with 95% confidence intervals (CIs). Adjustments for age, sex, baseline viral load, glucose (GLU), α-fetal protein (AFP), albumin (ALB) and platelets were conducted with the use of the regression analysis. To evaluate ability of the genetic and clinical factors to predict HCV treatment response, the area under the curve (AUC) of the receiver operating characteristic was calculated. Line and bar charts were used to present the viral load at each follow-up time-point. All statistical analyses were two sided, and P<0.05 was considered to indicate a statistically significant difference. The trend analysis was calculated with Cochran-Armitage trend test. All the statistical analyses were performed using the STATA software (version 12.0; StataCorp LLC, College Station, TX, USA).

Results

Demographic characteristics of the study populations

The basic characteristics of 232 cases that achieved an SVR (SVR) and 120 cases who did not achieve an SVR (non-SVR) were available in the study. The rate of SVR was 65.9%. Patients with low viral load and high levels of GLU, AFP, TP, ALB and platelets at baseline were more likely to achieved an SVR, as presented in Table II.

Table II

Baseline characteristics of CHC patients treated with IFN/RBV.

Table II

Baseline characteristics of CHC patients treated with IFN/RBV.

VariablesN-SVR (n=120)SVR (n=232)P-value
Mean age, year53.41±8.1453.6±8.500.783
Age ≥5083 (69.2)159 (68.5)0.903
Male (%)29 (24.2)57 (24.6)0.934
AST ≥40 U/l (%)70 (58.3)121 (52.2)0.270
ALT ≥40 U/l (%)79 (65.8)138 (59.5)0.245
GGT ≥50 (U/l)51 (42.5)77 (33.2)0.085
GLU > 6.01 (mmol/l)49 (40.8)61 (26.3)0.005a
AFP >7.02 (ng/ml)50 (41.7)65 (28.0)0.010a
T3 (nmol/l)1.54±0.491.50±0.720.593
T4 (nmol/l)128.67±32.96123.50±31.010.147
Anti-TPO ≥35 I/ml14 (11.67)35 (15.09)0.380
Base HCV-RNA6.18±0.755.82±1.260.004a
TP (g/l)77.87±5.9278.51±5.920.335
ALB (g/l)42.56±4.1043.87±4.060.005a
Platelets (109/l)122.51±59.65137.19±52.480.018a
 Abnormal53 (44.2)61 (26.3)0.001a
 Normal67 (55.8)171 (73.7)
WBC (109/l)4.88±2.625.02±1.780.555
 Abnormal45 (37.5)73 (31.5)0.256
 Normal75 (62.5)159 (68.5)
Hemoglobin (g/l)132.83±17.50134.07±16.020.506
 Abnormal22 (18.3)31 (13.4)0.216
 Normal98 (81.7)201 (86.6)

a P<0.05. CHC, chronic hepatitis C virus; IFN-α, interferon-α; RBV, ribavirin; N-SVR, non-sustained virological response; SVR, sustained virological response; AST, aspartate transaminase; ALT, alanine amino-transferase; GGT, γ-glutamyl transpeptidase; GLU, glucose; AFP, α-fetal protein; TP, total protein; ALB, albumin; WBC, white blood cell.

Association of candidate SNPs with SVR

The allelic frequencies of candidate genes (TAP1 rs1135216, TAP2 rs1800454, LMP7 rs2071543, tapasin rs9277972, rs1059288 and rs2282851) between SVR and non-SVR groups were compared in Table III. The observed genotype frequencies of these SNPs in the remaining subjects with different HCV status were all in Hardy-Weinberg equilibrium (all P≥0.05). LMP7 rs2071543-A variant and TAP2 rs1800454-A variants were related to a decreased possibility of achieving an SVR.

Table III

Association of SNPs in HLA with SVR.

Table III

Association of SNPs in HLA with SVR.

GenotypeN-SVRSVRSVR rate (%)OR (95% CI)P-value
rs1135216
 AA44 (36.7)85 (36.6)65.91.00
 AG29 (24.1)69 (29.8)70.41.36 (0.74–2.50)0.328
 GG47 (39.2)78 (33.6)62.41.14 (0.65–2.01)0.654
 Dominant1.23 (0.74–2.04)0.427
 Additive1.06 (0.80–1.41)0.677
rs1800454
 GG78 (65.0)176 (75.9)69.31.00
 GA36 (30.0)52 (22.4)59.10.52 (0.30–0.90)0.020a
 AA6 (5.0)4 (1.7)40.00.27 (0.07–1.09)0.066
 Dominant0.49 (0.29–0.82)0.007a
 Additive0.52 (0.33–0.82)0.005a
rs9277972
 AA91 (75.8)169 (72.9)65.01.00
 AT21 (17.5)45 (19.4)68.21.10 (0.59–2.04)0.774
 TT8 (6.7)18 (7.8)69.21.67 (0.67–4.17)0.272
 Dominant1.25 (0.73–2.14)0.422
 Additive1.22 (0.83–1.80)0.302
rs1059288
 TT44 (36.7)82 (35.3)65.11.00
 TC58 (48.3)118 (50.9)67.01.26 (0.75–2.12)0.382
 CC18 (15.0)32 (13.8)64.01.02 (0.50–2.12)0.949
 Dominant1.20 (0.73–1.97)0.465
 Additive1.06 (0.75–1.51)0.732
rs2282851
 CC73 (60.8)134 (57.8)43.61.00
 CT41 (34.2)90 (38.8)68.71.27 (0.77–2.08)0.352
 TT6 (5.0)8 (3.5)57.10.57 (0.18–1.76)0.327
 Dominant1.16 (0.72–1.88)0.533
 Additive1.03 (0.68–1.55)0.891
rs2071543
 CC68 (56.7)154 (66.4)69.41.00
 CA43 (35.8)70 (30.2)61.90.77 (0.46–1.28)0.312
 AA9 (7.5)8 (3.5)47.10.32 (0.11–0.91)0.033a
 Dominant0.68 (0.42–1.09)0.112
 Additive0.66 (0.45–0.98)0.039a

a P<0.05. Logistic regression analyses adjusted for age, sex, GLU, AFP, ALB, platelets, baseline RNA. SVR, sustained virological response; N-SVR, non-sustained virological response; OR, odds ratio; CI, confidence interval; SNPs, single nucleotide polymorphisms; HLA, human leukocyte antigen.

In rs1800454 SNPs, the rate of SVR was significantly higher in patients with the GG genotype compared to those with the GA and AA allele. The additive model analyses indicated that the presence of each additional allele was indicated to reduce the decreased probability of achieving an SVR by ~48% (adjusted OR, 0.52; 95% CI, 0.33–0.82; P=0.005).

In rs2071543 SNPs, for patients with the CC genotype, a higher SVR rate was observed in comparison to the CA and AA genotypes. The additive model indicated that each additional allele contributed to a decreased likelihood of achieving an SVR by ~34% (adjusted OR, 0.66; 95% CI, 0.45–0.98; P=0.039).

Association of rs1800454 and rs2071543 with RVR/cEVR

The association between rs1800454 and rs2071543 with RVR/cEVR was also analyzed, as presented in Table IV. Carrying rs1800454-A allele was showed to be a risk factor of both achieving a RVR (dominant model: OR, 0.41; 95% CI, 0.25–0.70; P=0.001) and a cEVR (additive model: OR, 0.53; 95% CI, 0.34–0.83; P=0.006). Subjects with rs2071543-A allele were less prone to achieve a RVR (dominant model: OR, 0.59; 95% CI, 0.37–0.93; P=0.023). However, no significant correlation was observed between rs2071543-A allele and cEVR (all P>0.05).

Table IV

Association of rs1800454 and rs2071543 in HLA with RVR/cEVR.

Table IV

Association of rs1800454 and rs2071543 in HLA with RVR/cEVR.

GenotypeN-RVRRVROR (95% CI)P-valueN-cEVRcEVROR (95% CI)P-value
rs1800454
 GG111 (64.9)143 (79.0)1.0071 (65.1)183 (75.3)1.00
 GA54 (31.6)34 (18.8)0.41 (0.24–0.69)0.00131(28.4)57 (23.5)0.64 (0.37–1.10)0.107
 AA6 (3.5)4 (2.2)0.60 (0.15–2.37)0.4647 (6.4)3 (1.2)0.15 (0.03–0.65)0.011a
 Dominant0.42 (0.25–0.70)0.0010.55 (0.33–0.92)0.024a
 Additive0.50 (0.32–0.79)0.0030.53 (0.34–0.83)0.006a
rs2071543
 CC97 (56.7)124 (68.5)1.0062 (56.9)159 (65.4)1.00
 CA65 (38.0)48 (26.5)0.55 (0.34–0.89)0.01543 (39.5)70 (28.8)0.67 (0.40–1.11)0.117
 AA9 (5.3)9 (5.0)0.90 (0.33–2.47)0.8314 (3.7)14 (5.8)1.79 (0.55–5.90)0.335
 Dominant0.59 (0.37–0.93)0.0230.76 (0.47–1.23)0.262
 Additive0.71 (0.48–1.03)0.0730.92 (0.62–1.36)0.662

a P<0.05. Logistic regression analyses adjusted for age, sex, glucose, α-fetal protein, albumin, platelets, baseline RNA. RVR, rapid virological response; N-RVR, non-rapid virological response; cEVR, completed early virological response; N-cEVR, non-completed early virological response; OR, οdds ratio; CI, confidence interval; HLA, human leukocyte antigen.

Combined effect of rs1800454 and rs2071543

The evaluation of the combined effects of rs1800454-A and rs2071543-A was performed to test the association with SVR. The results showed that SVR rate was lower when patients carried more unfavorable rs1800454-A and rs2071543-A alleles, and the SVR rate of carrying 3–4 alleles was 20%. Carrying two unfavorable alleles appeared to have a negative dangerous effect on the SVR (OR, 0.30; 95% CI, 0.14–0.61; P=0.001), as showed in Fig. 1 and Table V.

Table V

Combined effects of rs1800454 and rs2071543 with SVR.

Table V

Combined effects of rs1800454 and rs2071543 with SVR.

VariableN-SVRSVRSVR rate (%)OR (95% CI)P-value
041 (34.2)112 (48.3)73.21
150 (41.7)97 (41.8)66.00.68 (0.40–1.15)0.148
225 (20.8)22 (9.5)46.80.30 (0.14–0.61)0.001a
3–44 (3.3)1 (0.4)20.00.17 (0.01–2.02)0.162
TrendP<0.001a

a P<0.05. Variables are numbers of combined favorable genotypes (rs1800454-A and rs2071543-A). Logistic regression analyses adjusted for age, sex, glucose, α-fetal protein, albumin, platelets, baseline RNA

a P-value was analyzed by Cochran-Armitage trend test. SVR, sustained virological response; N-SVR, non-sustained virological response; OR, odds ratio; CI, confidence interval.

Multivariate stepwise regression analysis

A stepwise regression model comprising all statistically significant variables was established. The final model included the rs1800454, rs2071543, baseline HCV RNA level, baseline platelet level, baseline GLU level and baseline AFP level as independent predictors of SVR in Table VI (all P<0.05). Subsequently, the receiver-operating characteristic analysis for SVR was performed to estimate the predicted value of the independent factors. The AUC based on this model, including the above factors, produced an AUC of 0.704 (95% CI, 0.647–0.761; P<0.001), as presented in Fig. 2. An approximately parallel AUC was yielded when adding up one SNP of rs1800454 or rs2071543, suggesting that the predicted value of rs1800454 and rs2071543 was at the similar level.

Table VI

Multivariate Stepwise regression analysis for independent factors of SVR.

Table VI

Multivariate Stepwise regression analysis for independent factors of SVR.

VariableCoef.SE95% CIP-value
rs1800454−0.150.05(−0.24, −0.05)0.002a
rs2071543−0.100.04(−0.18, −0.02)0.016a
GLU−0.120.05(−0.23, −0.02)0.021a
RNA level−0.070.02(−0.11, −0.02)0.002a
Platelets (109/l)−0.140.05(−0.24, −0.03)0.009a
AFP−0.110.05(−0.21, −0.005)0.041a

a P<0.05. SVR, sustained virological response; Coef, coefficient of variation; SE, standard error; GLU, glucose; AFP, α-fetoprotein.

Association of rs1800454 and rs2071543 with viral kinetics during treatment

Sample data on viral kinetics of rs1800454 and rs2071543 were collected and further analyzed by line charts. Baseline viral load of rs1800454 was higher in patients with the GG genotype than in those carrying the A allele (mean log10 HCV RNA: 6.03 for GG, 5.70 for GC/CC, P=0.015) (Fig. 3). However, the drop in viral load was significantly faster in GG patients than in GC/CC patients during the whole therapy, which was in accordance with the decline of viral load in rs2071543 (Fig. 4). The results highlighted that the mutation of rs1800454-G and rs2071543-C may reduce the chance to achieve an SVR.

Discussion

In the present study, the authors attempted to investigate the viral (HCV viral load) and host (HLA SNPs, HCV RNA, platelets, GLU and AFP) factors affecting the treatment response of pegIFN-α/RBV, and to evaluate whether the SNPs were associated with SVR, RVR and cEVR in Chinese patients with CHC genotype 1 infection.

MHC class I and II antigens are the central to the host immune response, which make them ideal candidate genes to investigate their association with HCV infection (18). HLA is a crucial genetic factor that initiates and regulates immune response through presenting endogenous and exogenous antigen to T lymphocytes (12). An increased and broadly multi-specific T-cell response is critical to get a favorable outcome. CD8+ T-cell response to HCV is important to the occurrence of successful immune response and spontaneous infection clearance. HLA class II presents viral peptides to CD8+ T-cells to permit detection of infected cells (19). TAP, LMP and tapasin located in the human MHC class II DNA-binding loci are playing a crucial role in the HLA class I-restricted endogenous antigen presenting system (20). A previous study identified some genomic variants of TAP and LMP which were associated with chronic hepatitis B and hepatitis C (21). A previous study of the authors also showed that TAP, LMP and tapasin affected HCV susceptibility and spontaneous clearance. However, the relationship between variants of these genes and treatment response of HCV infection has not been fully studied. Therefore, the present study was performed to elucidate whether these antigen-presenting gene polymorphisms could influence the response to pegIFN-α/RBV treatment in CHC patients.

The results demonstrated that two tagging SNPs of tapasin (rs1059288 T>C and rs2282851 C>T) had no relationship with the treatment response of HCV infection, which contradicted the results from the study in a European Caucasian population (22). Another study found that mutation of tapasin rs9277972 A>T increased the risk of HCV chronicity, which was not observed in the present study (23). In line with other studies, TAP2 rs1800454 was shown to be significantly associated with increased risk for progression of HCV infection (19,23). TAP2 rs1800454 G>A makes a missense mutation and may be an independent risk factor for failing to achieve SVR, RVR and cEVR. However, another two studies in European and Japan population respectively failed to delineate a strong association between TAP gene polymorphism and response to interferon treatment (19,24). Mutation may alter the activity of the encoding protein and have an impact on antigen presentation process. Studies around the world have suggested that LMP7 gene polymorphism had an influence on the outcomes of HCV infection, which was consistent with the finding of the authors' previous study (20,25,26). The present study indicated that LMP7 rs2071543 C>A also renders a missense mutation, influencing the treatment response in CHC patients (19,27). Of note, few studies have explored the role of TAP2, LMP7 gene in the treatment response of CHC patients, with inconsistent study designs, as well as participants of different physical conditions and genetic background, which led to a marked knowledge gap in this field (19,24,27).

In the analysis of rs1800454 and rs2071543 with those factors in model (baseline HCV RNA level, baseline platelets level, baseline GLU level and baseline AFP level), the interaction effect is not significant (data not shown), which illustrated that all factors above may be independent factors of hepatitis C treatment response. In addition, when including six factors of rs1800454, rs2071543, baseline HCV RNA level, baseline platelets level, baseline GLU level and baseline AFP level, the AUC was improved to 0.704. The similar rise in AUC could be found in an Egyptian research where an AUC of 0.68 including serum AFP and viral load was calculated (28). The results of the study have a potential implication that making full use of collected routine data can take effect in the determination of prognosis and the adjustment for treatment procedures.

There are several potential limitations that need to be considered and discussed. In the present study, only six SNPs of three genes were selected in the HLA class II region, whereas there are many genes involved in the MHC region. Some small molecular compounds known as DAAs, have been developed in recent years. The preliminary results have shown promising clinical application, however, this study only predicted the response to pegIFN-α/RBV therapy. PegIFN-α/RBV combination therapy is still the predominant treatment for hepatitis C in light of the economic burden in developing countries, such as China. However, the DAA will be a major direction for the future research. Finally, there are other well-known predictive factors that the authors did not adjust for in this study, such as HCV core amino acid 70 and IL28B, which may influence the results. Therefore, the authors' future research will focus on the following aspects. First of all, the types of hospital patients will be considered to test the validity and generalizability of results of the present study. Secondly, the authors intend to expand the sample size and include more known predictive factors, for example HCV core amino acid 70 and IL28B. Thirdly, the biological information of these genes will be utilized for further functional studies, exploring the mechanism of the association between these genes and hepatitis C virus. The benefits of conducting such research would be barely doubted given good representativeness, since all patients were remunerated blood donation population and from the same district. Furthermore, the patients were exposed during the same period and their infection outcomes were steady after decades. More importantly, earlier study of the authors suggested that genetic variants in HLA were relevant to HCV infection susceptibility and viral clearance, the present study thoroughly discussed and determined the association between LMP7, TAP2 gene and treatment response in CHC patients.

In conclusion, the present study demonstrated that LMP7 and TAP2 loci were candidate regions that had some novel SNPs for treatment response to pegIFN-α/RBV in the Chinese CHC patients.

Acknowledgments

The present study was supported in part by the National Natural Science Foundation of China (grant nos. 81473029, 81502853 and 81473028), the Science and Technology Development Fund Key Project of Nanjing Medical University (grant no. 2016NJMUZD012), the Natural Science Foundation of Jiangsu Province (grant no. BK20151026), Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

References

1 

Chen SR, Wang AQ, Lin LG, Qiu HC, Wang YT and Wang Y: In vitro study on anti-hepatitis C virus activity of Spatholobus suberectus Dunn. Molecules. 21:E13672016. View Article : Google Scholar : PubMed/NCBI

2 

Cui Y and Jia J: Update on epidemiology of hepatitis B and C in China. J Gastroenterol Hepatol. 28(Suppl 1): 7–10. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Cai L, Gao C, Tang S, Wang J, Xue X, Yue M, Deng X, Su J, Peng Z, Lu Y, et al: Sex-specific association of estrogen receptor 2 polymorphisms with hepatitis C virus infection outcomes in a high-risk Chinese Han population. Infect Genet Evol. 28:118–124. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Bandiera S, Billie Bian C, Hoshida Y, Baumert TF and Zeisel MB: Chronic hepatitis C virus infection and pathogenesis of hepatocellular carcinoma. Curr Opin Virol. 20:99–105. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Matsuura K and Tanaka Y: Natural history of hepatitis C virus infection. Nihon Rinsho. 73:195–200. 2015.In Japanese. PubMed/NCBI

6 

Falade-Nwulia O, Suarez-Cuervo C, Nelson DR, Fried MW, Segal JB and Sulkowski MS: Oral direct-acting agent therapy for hepatitis C virus infection: A systematic review. Ann Intern Med. 166:637–648. 2017. View Article : Google Scholar : PubMed/NCBI

7 

Fateh A, Aghasadeghi MR, Keyvani H, Mollaie HR, Yari S, Hadizade Tasbiti AR, Ghazanfari M and Monavari SH: High resolution melting curve assay for detecting rs12979860 IL28B polymorphisms involved in response of Iranian patients to chronic hepatitis C treatment. Asian Pac J Cancer Prev. 16:1873–1880. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Ragheb MM, Nemr NA, Kishk RM, Mandour MF, Abdou MM, Matsuura K, Watanabe T and Tanaka Y: Strong prediction of virological response to combination therapy by IL28B gene variants rs12979860 and rs8099917 in chronic hepatitis C genotype 4. Liver Int. 34:890–895. 2014. View Article : Google Scholar

9 

Aziz H, Raza A, Ali K, Khattak JZ, Irfan J and Gill ML: Polymorphism of the IL28B gene (rs8099917, rs12979860) and virological response of Pakistani hepatitis C virus genotype 3 patients to pegylated interferon therapy. Int J Infect Dis. 30:91–97. 2015. View Article : Google Scholar

10 

Garcia RF, Moreira S, de Araújo Ramos AL, Ferreira LE, de Mattos AA, Tovo CV, Nader LA, Ramos JA, Rondinelli E, de Jesus Dominici A, et al: Interleukin 28B-related polymorphisms: A pathway for understanding hepatitis C virus infection? World J Gastroenterol. 19:7399–7404. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Chowdhry M, Makroo RN, Singh M, Agrawal S, Kumar M and Thakur Y: Human leucocyte antigen class I and II alleles associated with anti-hepatitis C virus-positive patients of North India. Indian J Med Microbiol. 34:299–302. 2016. View Article : Google Scholar : PubMed/NCBI

12 

El-Bendary M, Neamatallah M, Esmat G, Kamel E, Elalfy H, Besheer T, Eldeib D, Eladl AH, El-Setouhy M, El-Gilany AH, et al: Associations of human leucocyte antigen class II-DQB1 alleles with hepatitis C virus infection in Egyptian population: A multicentre family-based study. J Viral Hepat. 23:961–970. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Huang J, Huang K, Xu R, Wang M, Liao Q, Xiong H, Li C, Tang X, Shan Z, Zhang M, et al: The associations of HLA-A*02:01 and DRB1*11:01 with hepatitis C virus spontaneous clearance are independent of IL28B in the chinese population. Sci Rep. 6:314852016. View Article : Google Scholar

14 

Waldron PR, Belitskaya-Lévy I, Chary A, Won J, Winters M, Monto A, Ryan J, Lazzeroni LC and Holodniy M: Genetic variation in the IL-6 and HLA-DQB1 genes is associated with spontaneous clearance of hepatitis C virus infection. J Immunol Res. 2016:65304362016. View Article : Google Scholar : PubMed/NCBI

15 

Sedighimehr P, Irani S, Sakhaee F, Vaziri F, Aghasadeghi M, Sadat SM, Jamnani FR, Fateh A and Siadat SD: IL28B rs12980275 and HLA rs4273729 genotypes as a powerful predictor factor for rapid, early, and sustained virologic response in patients with chronic hepatitis C. Arch Virol. 162:181–189. 2017. View Article : Google Scholar

16 

McKiernan SM, Hagan R, Curry M, McDonald GS, Kelly A, Nolan N, Walsh A, Hegarty J, Lawlor E and Kelleher D: Distinct MHC class I and II alleles are associated with hepatitis C viral clearance, originating from a single source. Hepatology. 40:108–114. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Huang P, Zhang Y, Lu X, Xu Y, Wang J, Zhang Y, Yu R and Su J: Association of polymorphisms in HLA antigen presentation-related genes with the outcomes of HCV infection. PLoS One. 10:e01235132015. View Article : Google Scholar : PubMed/NCBI

18 

Duggal P, Thio CL, Wojcik GL, Goedert JJ, Mangia A, Latanich R, Kim AY, Lauer GM, Chung RT, Peters MG, et al: Genome-wide association study of spontaneous resolution of hepatitis C virus infection: data from multiple cohorts. Ann Intern Med. 158:235–245. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Sugimoto Y, Kuzushita N, Takehara T, Kanto T, Tatsumi T, Miyagi T, Jinushi M, Ohkawa K, Horimoto M, Kasahara A, et al: A single nucleotide polymorphism of the low molecular mass polypeptide 7 gene influences the interferon response in patients with chronic hepatitis C. J Viral Hepat. 9:377–384. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Cui Q, Zhang Y, Su J, Shi C, Lei N, Ding K, Li J, Yu R, Wang L and Wang N: The association between the genetic polymorphisms of LMP2/LMP7 and the outcomes of HCV infection among drug users. J Biomed Res. 24:374–380. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Huang P, Dong L, Lu X, Zhang Y, Chen H, Wang J, Zhang Y, Su J and Yu R: Genetic variants in antigen presentation-related genes influence susceptibility to hepatitis C virus and viral clearance: A case control study. BMC Infect Dis. 14:7162014. View Article : Google Scholar : PubMed/NCBI

22 

Ashraf S, Nitschke K, Warshow UM, Brooks CR, Kim AY, Lauer GM, Hydes TJ, Cramp ME, Alexander G, Little AM, et al: Synergism of tapasin and human leukocyte antigens in resolving hepatitis C virus infection. Hepatology. 58:881–889. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Kuzushita N, Hayashi N, Kanto T, Takehara T, Tatsumi T, Katayama K, Ohkawa K, Ito A, Kasahara A, Moribe T, et al: Involvement of transporter associated with antigen processing 2 (TAP2) gene polymorphisms in hepatitis C virus infection. Gastroenterology. 116:1149–1154. 1999. View Article : Google Scholar : PubMed/NCBI

24 

Airoldi A, Zavaglia C, Silini E, Tinelli C, Martinetti M, Asti M, Rossini A, Vangeli M, Salvaneschi L and Pinzello G: Lack of a strong association between HLA class II, tumour necrosis factor and transporter associated with antigen processing gene polymorphisms and virological response to alpha-interferon treatment in patients with chronic hepatitis C. Eur J Immunogenet. 31:259–265. 2004. View Article : Google Scholar : PubMed/NCBI

25 

El Awady MK, Omran MH, Ibrahim MK, Moustafa AM, Dawood RM, Bader El Din NG, Elsharkawy A, Abdel Aziz MS, El Shenawy R, El Abd YS, et al: Low Molecular Mass Polypeptide 7 single nucleotide polymorphism is associated with the progression of liver fibrosis in patients infected with hepatitis C virus genotype 4. Clin Lab. 62:381–387. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Ibrahim MK, Salama H, Abd El Rahman M, Dawood RM, Bader El Din NG, Salem HF, Abdelrahim ME, Omran D, Omran MH, El-Wakeel KH, et al: Three gene signature for predicting the development of hepatocellular carcinoma in chronically infected hepatitis C virus patients. J Interferon Cytokine Res. 36:698–705. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Ibrahim MK, Salama H, Abd El Rahman M, Dawood RM, Bader El Din NG, Salem HF, Abdelrahim ME, Omran D, Omran MH, El-Wakeel KH, et al: Three gene signature for predicting the development of hepatocellular carcinoma in chronically infected hepatitis C virus patients. J Interferon Cytokine Res. 36:698–705. 2016. View Article : Google Scholar : PubMed/NCBI

28 

El Raziky M, Fathalah WF, Zakaria Z, Eldeen HG, Abul-Fotouh A, Salama A, Awad A, Esmat G and Mabrouk M: Predictors of virological response in 3,235 chronic HCV Egyptian patients treated with peginterferon alpha-2a compared with peginterferon alpha-2b using statistical methods and data mining techniques. J Interferon Cytokine Res. 36:338–346. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

December 2017
Volume 40 Issue 6

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Zang, F., Yao, Y., Liu, M., Fan, H., Yue, M., Chen, M. ... Huang, P. (2017). The association of LMP7 and TAP2 gene polymorphisms with treatment response to interferon/ribavirin in patients with genotype 1 chronic hepatitis C. International Journal of Molecular Medicine, 40, 1983-1990. https://doi.org/10.3892/ijmm.2017.3180
MLA
Zang, F., Yao, Y., Liu, M., Fan, H., Yue, M., Chen, M., Wang, J., Yu, R., Huang, P."The association of LMP7 and TAP2 gene polymorphisms with treatment response to interferon/ribavirin in patients with genotype 1 chronic hepatitis C". International Journal of Molecular Medicine 40.6 (2017): 1983-1990.
Chicago
Zang, F., Yao, Y., Liu, M., Fan, H., Yue, M., Chen, M., Wang, J., Yu, R., Huang, P."The association of LMP7 and TAP2 gene polymorphisms with treatment response to interferon/ribavirin in patients with genotype 1 chronic hepatitis C". International Journal of Molecular Medicine 40, no. 6 (2017): 1983-1990. https://doi.org/10.3892/ijmm.2017.3180