Madecassoside activates anti‑neuroinflammatory mechanisms by inhibiting lipopolysaccharide‑induced microglial inflammation

  • Authors:
    • Andrew Octavian Sasmita
    • Anna Pick Kiong Ling
    • Kenny Gah Leong Voon
    • Rhun Yian Koh
    • Ying Pei Wong
  • View Affiliations

  • Published online on: February 9, 2018     https://doi.org/10.3892/ijmm.2018.3479
  • Pages: 3033-3040
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Neurodegeneration is typically preceded by neuroinflammation generated by the nervous system to protect itself from tissue damage, however, excess neuroinflammation may inadvertently cause more harm to the surrounding tissues. Attenuating neuroinflammation with non‑steroidal anti‑inflammatory drugs can inhibit neurodegeneration. However, such treatments induce chronic side effects, including stomach ulcers. Madecassoside, a triterpene derived from Centella asiatica, is considered to be an alternative treatment of inflammation. In the present study, the anti‑neuroinflammatory properties of madecassoside were assessed in BV2 microglia cells, which were pre‑treated with madecassoside at a maximum non‑toxic dose (MNTD) of 9.50 µg/ml and a ½ MNTD of 4.75 µg/ml for 3 h and stimulated with 0.1 µg/ml lipopolysaccharide (LPS). The effect of madecassoside was assessed by determining reactive oxygen species (ROS) levels in all groups. Furthermore, the expression of pro‑ and anti‑neuroinflammatory genes and proteins were analyzed using reverse transcription‑quantitative polymerase chain reaction and western blotting, respectively. The results demonstrated that ROS levels in cells treated with the MNTD of madecassoside were significantly reduced compared with cells treated with LPS alone (P<0.05). The expression of pro‑neuroinflammatory genes, including inducible nitric oxide synthase, cyclooxygenase‑2, signal transducer and activator of transcription 1 and nuclear factor‑κB, were significantly downregulated in a dose‑independent manner following treatment with madecassoside. Conversely, the anti‑neuroinflammatory component heme oxygenase 1 was significantly upregulated by 175.22% in the MNTD‑treated group, compared with cells treated with LPS alone (P<0.05). The gene expression profiles of pro‑ and anti‑inflammatory genes were also consistent with the results of western blotting. The results of the present study suggest that madecassoside may be a potent anti‑neuroinflammatory agent. The antioxidative properties of madecassoside, which serve a major role in anti‑neuroinflammation, indicate that this compound may be a functional natural anti‑neuroinflammatory agent, therefore, further in vivo or molecular studies are required.

Introduction

Neurodegeneration consists of various cellular processes whereby neuronal cells progressively deteriorate, lose function and ultimately die. In 2014, Alzheimer's disease (AD) and Parkinson's disease (PD), were the seventh and 14th leading causes of mortality, respectively, in the US (1). Therefore, more research is required to understand the intricate molecular components of these diseases and their risk factors, including neuroinflammation. This may enable the development of novel therapeutic strategies to treat neurodegenerative diseases. Unlike associated genetic risk factors, including polyglutamine (2) and glucocerebrocidase (3), neuroinflammation is a major risk factor of neurodegeneration as it progressively develops throughout life (4). Coupled with increasing age, a build-up of reactive oxygen species (ROS) levels (5) and protein misfolding (6), neuroinflammation may act as one of the various triggers of neurodegeneration. Previous studies have suggested that excessive neuroinflammation worsens the symptoms of AD and PD by promoting the excessive generation of amyloid β plaques and destruction of dopaminergic neurons (4). Although the nervous system is known to be an immunologically privileged site, it still hosts astrocytes and glial cells that express major histocompatibility complexes, which propagate neuroinflammation (7). Despite the ability of immune cells associated with the nervous system, such as microglia, to subdue imminent infections and damages, this process typically causes excessive neuroinflammation that harms the surrounding tissue (7).

To produce a model of neuroinflammation, the present study utilized lipopolysaccharide (LPS), which triggers the activation of toll-like receptor 4 that is ubiquitously present on the surface of microglia, subsequently triggering neuroinflammation (8). LPS also elicits prolonged responses in vivo by upregulating the expression of the following pro-inflammatory components: Tumor necrosis factor α; cyclooxygenase 2 (COX)-2, which is coded by the gene prostaglandin-endoperoxide synthase 2 (PTGS)-2; inducible nitric oxide synthase (iNOS), which is coded by the gene nitric oxide synthase 2 (NOS2); and nuclear factor (NF)-κB, which is coded by the NF-κB subunit 1 gene (9). These pro-inflammatory components form a negative feedback system with superoxide dismutase (SOD) and heme oxygenase 1 (HO-1) (10) to produce anti-neuroinflammatory components, including interleukin (IL)-10 (11). However, in the majority of biological systems, pro-neuroinflammatory signaling pathways typically outweigh anti-neuroinflammatory signaling pathways (10).

Various compounds that trigger anti-neuroinflammatory signaling pathways may therefore help to treat neuroinflammation. Out of the several natural compounds that have been screened, madecassoside, a triterpenoid saponin extractable from Centella asiatica, known locally as Pegaga (12), may be considered as a potential method of treating excessive neuroinflammation. Various studies have suggested that this compound may exhibit anti-inflammatory, antioxidant and anti-cancer effects (12,13). Furthermore, madecassoside induces the modulation of inflammatory cytokines, translocation of NF-κB and regulation of COX-2 and iNOS (14,15). This compound, which is commonly used in cosmetology, has also been assessed in neuronal settings (10,16). Our preliminary study profiled the production of pro- and anti-neuroinflammatory cytokines in LPS-stimulated BV2 microglia (data not published), however, the molecular activity of madecassoside has yet to be fully elucidated. Subsequently, the objective of the present study was to analyze the effects of madecassoside on ROS generation and to determine the molecular effects of madecassoside at the genomic and proteomic levels.

Materials and methods

Preparation of madecassoside and indomethacin stock solution

Madecassoside powder (≥95% purity) was purchased from Sigma-Aldrich; Merck KGaA (Darmstadt, Germany). A stock solution of 50 μg/μl was prepared in molecular grade dimethyl sulfoxide (DMSO; Sigma-Aldrich; Merck KGaA). To obtain the maximum non-toxic dose (MNTD) of 9.50 μg/ml and ½ MNTD of 4.75 μg/ml, as determined by Mohan (17), the stock solution was diluted with Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The positive control indomethacin (Sigma-Aldrich; Merck KGaA), a type of non-steroidal anti-inflammatory drug known to elicit anti-inflammatory effects (18), was dissolved in DMSO to a concentration of 10 mM, which was further diluted to 25 μM working solution with fresh DMEM.

Cell culture

BV2 microglia cells were provided by Dr Sharmili Vidyadaran from Universiti Putra Malaysia (Selangor, Malaysia) and subsequently cultured in DMEM supplemented with 10% fetal bovine serum, 1% penicillin and streptomycin, 0.1% fungizone and 0.1% gentamycin (all Gibco; Thermo Fisher Scientific, Inc.). Cells were maintained in a humidified incubator containing 5% CO2 at 37°C. To determine the intracellular ROS levels, cells were seeded at a desired concentration of 5×105 cells/well in 24-well tissue culture plates (Corning Incorporated, Corning, NY, USA) and the trypan blue exclusion method (19) was then performed using 0.4% trypan blue staining (Gibco; Thermo Fisher Scientific, Inc.) to calculate the number of trypsinized cells, while for RNA and protein extraction, 1×106 cells/well were seeded in 60-mm tissue culture dishes (Corning Incorporated).

Treatment with madecassoside and LPS stimulation

Culture medium was aspirated from the culture vessel and BV2 cells were treated with madecassoside at the MNTD (9.50 μg/ml) and ½ MNTD (4.75 μg/ml), or they were treated with indomethacin (25 μM). Untreated cells were used as the control. Cells were subsequently incubated in a humidified incubator containing 5% CO2 at 37°C for 3 h and were thoroughly mixed at 30 min intervals. Following 3 h incubation, 0.1 μg/ml LPS (Sigma-Aldrich; Merck KGaA) (20,21) was introduced into treatment groups as indicated (Table I). Cells were then further incubated for 24 h within a humidified incubator containing 5% CO2 at 37°C.

Table I

Treatment groups used in the present study.

Table I

Treatment groups used in the present study.

Treatment groupsComponents
ControlUntreated BV2 cells
LPSLPS (0.1 μg/ml)
MNTD + LPSMNTD (9.5 μg/ml) + LPS (0.1 μg/ml)
½ MNTD + LPS½ MNTD (4.75 μg/ml) + LPS (0.1 μg/ml)
Indo + LPSIndomethacin (25 μM) + LPS (0.1 μg/ml)

[i] LPS, lipopolysaccharide; MNTD, maximum non-toxic dose; Indo, Indomethacin; Control, untreated BV2 cells.

Determination of intracellular ROS levels

DMEM was removed, cells were subjected to trypsinization and the pellet was resuspended in phosphate-buffered saline (PBS). Cell suspension (cell density, 1×105/well) and non-sterile PBS were transferred into 96-well plates (Corning Incorporated). Subsequently, 40 μM 2′,7′-dichlorofluorescin diacetate (Sigma-Aldrich; Merck KGaA) was added. Following 30 min incubation at 37°C, fluorescence was measured using SpectraMax M Series Multi-Mode Microplate Reader (Molecular Devices, LLC, Sunnyvale, CA, USA) at excitation and emissions wavelengths of 485 and 538 nm, respectively. The number of cells in each treatment group was determined using the trypan blue exclusion method and values were used to calculate the relative fluorescence unit of each treatment group.

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RNA extraction and purification of BV2 cells was performed using a PureLink RNA Mini kit (Ambion; Thermo Fisher Scientific, Inc.) following the manufacturer's protocol. Lysis buffer solution was prepared by adding 50 μl mercaptoethanol to 5 ml lysis buffer from the kit. Subsequently, cell dislodgment was performed using a cell scraper (Techno Plastic Products AG, Trasadingen, Switzerland). Scraped off cells were transferred into a sterile 1.5-ml microcentrifuge tube on ice. The contents of the microcentrifuge tubes were passed through an 18-gauge syringe needle 5-10 times. Subsequently, the lysate was subjected to the PureLink RNA Mini kit protocol and extracted RNA was stored in volumes of 35 μl at −30°C. To analyse RNA purity, a Tecan Infinite 200 PRO microplate reader was utilized at 260/280 nm on a NanoQuant plate (both Tecan Group Ltd., Mannedorf, Switzerland).

RNA samples were normalized to 2 mg/ml and converted to cDNA using the qPCRBIO cDNA Synthesis kit (PCR Biosystems Ltd., London, UK) following the manufacturer's protocol and an MJ Research PTC-100 Thermal Cycler (GMI, Ramsey, MN, USA). qPCR was performed in a 15-μl reaction mixture containing 2X qPCRBIO SyGreen Mix (qPCRBIO SyGreen Mix with Fluorescein kit; PCR Biosystems Ltd.) and primers (First Base Laboratories Sdn Bhd, Selangor, Malaysia), the sequences of which are listed in Table II. qPCR results were analyzed using iQ5 Optical System Software version 2.0 (Bio-Rad Laboratories, Inc., Hercules, CA, USA) for 1 initial denaturation cycle at 95°C for 2 min, followed by 40 cycles of denaturation 95°C for 5 sec, annealing at 60°C for 30 sec and final elongation at 72°C for 30 sec. Relative gene expression values were normalized to β-actin and fold changes of each gene were calculated using the 2−ΔΔCq method (22), whereby the baseline of PCR efficiencies were set at 90%.

Table II

Forward and reverse sequences of the primers utilized for reverse transcription-quantitative polymerase chain reaction.

Table II

Forward and reverse sequences of the primers utilized for reverse transcription-quantitative polymerase chain reaction.

GeneForward sequence (5′-3′)Reverse sequence (5′-3′)Amplicon size (bps)
iNOS TTGCCACGGACGAGACGGATAGG GGGCACATGCAAGGAAGGGAACTC131
COX-2 TGGGTGTGAAAGGAAATAAGGA GAAGTGCTGGGCAAAGAATG128
HO-1 AGAGTTTCCGCCTCCAACCA CGGGACTGGGCTAGTTCAGG107
STAT1 C TGAATATTTCCCTCCTGGG TCCCGTACAGATGTCCATGAT103
NF-κB CTGGTGGACACATACAGGAAGAC ATAGGCACTGTCTTCTTTCACCTC198
β-actin TCCTCCTGAGCGCAAGTACTCT GCTCAGTAACAGTCCGCCTA153

[i] iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase 2; STAT1, signal transducer and activator of transcription 1; NF-κB, nuclear factor-κB; HO-1, heme oxygenase 1.

Western blotting

Proteins were extracted using radioimmunoprecipiation lysis buffer consisting of 23.145 mg dithioethreitol (Bio-Rad Laboratories, Inc.), 30 μl proteinase inhibitor and 1.5 ml lysis buffer (Ambion; Thermo Fisher Scientific, Inc.) with the aid of a cell scraper (Techno Plastic Products AG, Switzerland). Lysates were centrifuged at 20,000 × g for 20 min in 4°C. Protein concentration was determined using the Bradford assay standard curve of bovine serum albumin (BSA; Nacalai Tesque, Inc., Kyoto, Japan) analyzed using a 96-well plate (Corning Incorporated) administered with Bradford Reagent (Bio-Rad Laboratories, Inc.).

Protein samples at 100 mg/ml were loaded and separated using 12% SDS-PAGE and a PowerPac Basic Machine (Bio-Rad Laboratories, Inc.). Samples were transferred to 0.45-μm poly-vinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA) and membranes were blocked with 5% BSA in Tris-buffered saline with Tween-20 (TBS-T) at room temperature for 1 h. Membranes were subsequently washed three times with TBS-T, incubated overnight with primary antibodies against iNOS (cat. no., sc-8310), COX-2 (cat. no., sc-23984), HO-1 (cat no., sc-10789), signal transducer and activator of transcription 1 (STAT1; cat. no., sc-271661), NF-κB (cat. no., sc-372) and β-actin (cat., no. sc-130656; all 1:1,000 dilution; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) at 4°C. Following this, membranes were washed three times with TBS-T and incubated with secondary antibodies (1:5,000 dilution; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) against rabbit (cat. no., sc-2004), goat (cat. no., sc-2020) and mouse (cat. no., sc-358914) primary antibodies conjugated with horseradish peroxidase at room temperature for 1 h. Proteins were visualized using SuperSignal West Femto Chemiluminescent Substrate (Thermo Fisher Scientific, Inc.) on a ChemiDoc XRS+ imaging system (Bio-Rad Laboratories, Inc.).

Statistical analysis

Data were generated in triplicate from three independent repeats and presented as the mean ± standard deviation. SPSS 11.0 software (SPSS, Inc., Chicago, IL, USA) was used to assess differences between groups using one way analysis of variance followed by Tukey's multiple comparison test. P<0.05 was considered to indicate a statistically significant difference.

Results and discussion

Determination of intracellular ROS levels

ROS production is associated with inflammation, including neuroinflammation (23). The production of various ROS, including superoxide anions and its derivatives, such as hydroxyl radicals, is required in normal physiological conditions, including during the modulation of synaptic and non-synaptic communication, and conditions whereby antimicrobial defence is required (23). Notably, exogenous ROS attained from pollutants or xenobiotics (24), coupled with excess endogenous ROS production, which occurs primarily via NADPH oxidase (25), may cause excessive neuroinflammation.

In the present study, madecassoside significantly reduced ROS levels in BV2 cells by 56.84% in the MNTD + LPS group compared with the group stimulated with LPS alone (P<0.05; Fig. 1). These results were in accordance with the results of a previous study (26). The MNTD + LPS treatment group also exhibited superior ROS reduction compared with the Indo + LPS group, which only caused a 34.62% reduction in ROS levels compared with LPS-treated cells. It has been demonstrated that trypsinization at high concentrations (U/ml) within cell culture produces a certain level of ROS (27); therefore, for more accurate measurement, the results from the treatment groups were all normalized to those of the control group, which consisted of untreated BV2 cells.

Nurlaily et al (14) indicated that madecassoside has anti-oxidative effects. Notably, madecassoside has been studied within the neuronal and other bodily systems, and similar trends have been indicated regarding the reduction of ROS levels. Al Mamun et al (26) utilized madecassoside to observe its neuroprotective effects against amyloid β plaques within in vivo and in vitro models of AD. It has been demonstrated that the plaques propagate excess oxidative stress in the form of ROS and reactive nitrogen species (RNS) (2), which may react with each other to form the toxic product peroxynitrite (10,28). Following exposure to madecassoside there was a significant reduction in lipid peroxidation (LPO), which is indicative of oxidative stress, and ROS levels, in vivo and in vitro, amongst other pro-neuroinflammatory components (26,28). This suggests that madecassoside may mitigate the worsening symptoms of neurodegenerative diseases, including AD. In addition, Li et al (15) indicated that madecassoside may regulate ROS levels by generating SOD and increasing catalase activity to inhibit the production of destructive free radicals and superoxide anions.

In the present study, although this difference was not significant, the reduction of ROS in the ½ MNTD + LPS group was 32.96% compared with the LPS-treated group; similar to what was observed in the Indo + LPS group (Fig. 1). Despite the well-known anti-inflammatory properties of NSAIDs, including ibuprofen and indomethacin, the results of certain studies have suggested that NSAIDs may cause more harm than good following chronic use and may result in nephrotoxicity (29) or gastric ulcers (30). This suggests that the identification of alternative compounds capable of effectively reducing ROS levels produced by neuroinflammation that also induce minimal side effects may be beneficial.

Determination of pro-inflammatory iNOS gene expression

The expression of the inducible form of NOS is heavily upregulated following inflammation (10). As a widely-acknowledged downstream process of transcription factors, including NF-κB and STAT1 (10,31), the expression of iNOS is commonly upregulated in response to various stimuli, including infection, ischemia or mechanical injury (32). During NO production, the iNOS enzyme will behave as a RNS and may react with ROS to form harmful intermediates (7,29). NO also causes endothelial vasculature damage by upregulating interferon regulatory transcription factor 1, which mediates cellular apoptosis and pro-neuroinflammation (33). Notably, Olivera et al (34) indicated that iNOS-deficient mice had a higher degree of Trypanosoma infection; this suggests that, despite having a negative effect with respect to inflammation, the balanced presence of iNOS is required to maintain the integrity of the blood brain barrier and blood vessels.

Within the present study, the expression of iNOS was significantly downregulated at the MNTD and ½ MNTD of madecassoside (79.81 and 74.21%, respectively) compared with the LPS group (both P<0.05; Fig. 2A). These results suggest that madecassoside may modulate anti-neuroinflammatory signalling pathways and their subsequent downstream activities, as iNOS expression was significantly reduced compared the control group (P<0.05). The results of the present study are in accordance with those of previous studies that identified the anti-inflammatory effects of other triterpenoid saponins, including tormentic acid (35) and madecassic acid (36). Madecassoside alone is also able to downregulate iNOS amongst various other pro-inflammatory components in a nephrotoxic in vivo setting (13). The results of the present study demonstrated the potent effect of madecassoside in reducing NO expression by downregulating iNOS expression in a neuronal setting.

Determination of COX-2 expression

The PTGS2 gene codes for the COX-2 enzyme, which is involved in the production of prostanoids and has been identified at high quantities during inflammation, resulting in subsequent tissue damage (37). The conversion of prostaglandin H2 to the active PGE2 yields pro-inflammatory ROS by-products (38). As indicated in Fig. 2B, significant downregulation of COX-2 expression following treatment with madecassoside and in the Indo + LPS group was observed compared with the LPS group (P<0.05). The MNTD and ½ MNTD groups exhibited a reduction of 70.85 and 66.65% in COX-2 expression, respectively, which was similar to the results obtained regarding iNOS expression. These results indicated that the downregulation of COX-2 and iNOS expression was not particularly dose-dependent. Although various studies have not clarified whether changes in the expression of pro-inflammatory factors including iNOS and COX-2 are dose-dependent or -independent, a number of studies using RAW 264.7 macrophages yielded downregulatory trends, similar to the results of the present study. Furthermore, the results of previous studies indicated that, although iNOS is a signaling pathway activated by NF-κB and STAT1, COX-2 expression is downstream of NF-κB but is inhibited by the activation of the STAT1 pro-inflammatory component (39,40). Notably, in the present study, madecassoside treatment significantly downregulated NF-κB and STAT1 gene expression, compared with the LPS group (P<0.05; Fig. 2B and C).

Determination of pro-inflammatory STAT1 expression

STAT1 upregulation has been indicated to promote interferon-γ expression during inflammation and STAT1 induces inflammation-induced apoptosis by activating apoptosis-stimulating of p53 protein 2 (ASPP2) (41). Under normal physiological conditions, ASPP2 monitors and keeps neuroinflammation in check; however, following the upregulation of STAT1, ASPP2 mediates cell death (41). Other functions of STAT1 in mediating tissue damage during inflammation include modulating the expression of receptor-interacting serine/threonine-protein kinase 3, which stimulates macrophages during inflammation to increase cell death (42). In the present study, a significant reduction of STAT1 gene expression within LPS-stimulated BV2 cells was observed in MNTD and ½ MNTD treated groups, but only the latter group exhibited downregulated STAT1 expression to the same extent as in the Indo + LPS group (P<0.05; Fig. 2C). These results suggest that the utilization of madecassoside may potentially mitigate the 'cytokine storm' by downregulating the JAK/STAT signaling pathway. Triterpenes, including avicin D (43) and betulinic acid (44) are also able to downregulate the JAK/STAT1 signaling pathway, which is in accordance with the results of the present study.

Determination of pro-inflammatory NF-κB expression

Considered to be the 'master transcription factor', particularly with regards to inflammation, it has been demonstrated that NF-κB is upregulated during inflammation and specifically following stimulation with LPS (45). Following its localization to the nucleus, NF-κB activates downstream pro-neuroinflammatory components, including iNOS, COX-2 and NADPH oxidase, which elevates ROS levels (10) and the mediator of arachidonic acid, lipoxygenase (46). As well as its pro-inflammatory properties, NF-κB activation also regulates the anti-inflammatory components during inflammation, including HO-1 expression, which is coded by HMOX1 and thioredoxin-1 (TRX1) (10). However, during neuroinflammation, there is an imbalance between the pro- and anti-inflammatory components, which may cause excessive neuroinflammation (10).

As indicated in Fig. 2D, NF-κB expression was significantly downregulated in the MNTD and ½ MNTD-treated groups compared with the LPS group (84.78 and 89.73%, respectively; P<0.05). Notably, this effect was greater in MNTD and ½ MNTD-treated groups compared with the Indo + LPS group. NF-κB expression did not decrease significantly in the Indo + LPS group compared with the LPS group. This may be due to the fact that NSAIDs such as indomethacin commonly block the downstream processes involved in inflammation, including COX-2 and its subsequent prostanoid production, but may not affect NF-κB expression (47). Previous studies investigating indomethacin have unveiled that its mechanism differs from aspirin, as it was demonstrated that indomethacin-induced COX-2 inhibition did not downregulate upstream NF-κB processes (48,49). The effects of madecassoside on NF-κB expression were previously reported by Su et al (13) and Patil et al (50). These results suggest that the downregulation of NF-κB may be caused by the inhibitory properties of madecassoside on essential complexes within the cascade, including the various subunits of inhibitory κB kinase.

Determination of anti-neuroinflammatory HO-1 gene expression

The gene HMOX1 codes for the antioxidative enzyme HO-1, a key enzyme associated with various antioxidative signaling pathways (51). NF-κB activates many downstream transcription factors (10); a few of which being HO-1 and few other antioxidative enzymes, including SOD and TRX1. In the context of neuroinflammation during multiple sclerosis, the results of a previous study provided an interesting outlook as to how the HMOX1 gene behaves and its effects on excessive neuroinflammation (52). Activation of HO-1, which is associated with upstream antioxidative signalling pathways, including nuclear factor like 2 (Nrf2), produces components including biliverdin, carbon monoxide, iron and IL-10, all of which are antioxidants and function to prevent inflammation at varying stages. These antioxidative elements are potent enough to protect cells against apoptosis during oxidative stress (53).

As indicated in Fig. 2E, HO-1 gene expression in the MNTD + LPS group were significantly upregulated (by 175.22%) compared with BV2 cells treated with LPS alone (P<0.05). This response was significantly greater in the MNTD + LPS group (P<0.05) compared with the positive control (P<0.05). These results suggest that madecassoside has the potential to upregulate antioxidative signaling pathways. Unlike the downregulation of the pro-neuroinflammatory components discussed previously, the upregulation of HO-1 seems to be dose-dependent (Fig. 2E). Compared with the gene expression profile of upstream NF-κB presented in Fig. 2D, the upregulation of HO-1 activity seems to be independent from the transcription factors previously assessed in the current study, further strengthening the hypothesis that HO-1 activity may be mediated by the Nrf2 signaling pathway.

Nrf2 signaling pathways may mediate gain-of-function mutations in squamous cell carcinomas, which provide cancer cells with the necessary protection against treatments and thus may confer a pro-tumorigenic property (54). Similar to results obtained regarding STAT1, a limited number of studies have analyzed the HMOX1 and HO-1 molecular profile of triterpenoid saponins, including madecassoside, asiatic acid and boswellic acid. The results of these studies indicate that HO-1 expression is increased due to upregulation of the Nrf2 pathway and therefore protects cells from apoptosis and oxidative damage (55,56).

Modulation of neuroinflammatory pathway-associated protein expression

The expression of neuroinflammation-associated proteins was determined using western blotting to confirm the gene expression profiles. As indicated in Fig. 3, the immunoblots of these proteins from the cell lysates of LPS-induced BV2 microglial cells following pre-treatment with madecassoside were assessed. The results indicated that the protein expression of the pro-neuroinflammatory components iNOS, COX-2, STAT1 and NF-κB was markedly increased in cells treated with LPS alone compared with the control group, whereas in madecassoside-treated groups, the expression of pro-inflammatory proteins was decreased in the MTND and ½ MNTD groups. Furthermore, the expression pattern of NF-κB protein in the Indo + LPS group was consistent with its gene expression. Furthermore, the protein expression of the anti-neuroinflammatory component HO-1 was notably increased in the MNTD + LPS group, which was also in accordance with its gene expression profile. In addition, indomethacin treatment also had similar effects to madecassoside on the protein expression of iNOS, COX-2, STAT1 and HO-1. The increase in NF-kB protein expression in the Indo + LPS group increased, which is consistent with the changes in its gene expression. Notably, the results of a previous study demonstrated the effects of madecassoside on inflammatory-associated signaling pathways, including iNOS and NF-κB, in murine kidneys, which indicated similar results to those demonstrated in a previous study (13). Furthermore, the anti-inflammatory effects of other triterpenoids extracted from Centella asiatica, including asiatic acid, have been demonstrated in a study utilizing murine liver samples (57), which further support the anti-neuroinflammatory abilities of madecassoside.

In conclusion, the present study indicated that madecassoside, a triterpenoid saponin, is a potent anti-neuroinflammatory agent, as it is able to reduce intracellular ROS levels and influence genomic and proteomic components that have been implicated in neuroinflammation. The results of the present study suggest that madecassoside successfully and significantly downregulated the gene and protein expression of iNOS, COX-2, STAT1 and NF-κB, all of which are pro-neuroinflammatory components. Furthermore, madecassoside at the MNTD significantly increased the gene expression of the anti-inflammatory component HO-1 by 175.22% compared with the LPS group. The primary results and the likely anti-neuroinflammatory mechanisms of madecassoside are presented in Fig. 4, whereby protein expression of pro-neuroinflammatory components were reduced while the anti-neuroinflammatory HO-1 was increased following madecassoside treatment. The antioxidative nature of madecassoside, which has been suggested to activate the Nrf2/HO-1 signaling pathways at the gene and protein levels, suggests that this compound may be an ideal treatment for neuroinflammation. The results of the present study warrant further in vivo studies investigating the effects of madecassoside to treat neuroinflammation, as it may be developed as a novel anti-neuroinflammatory agent.

Acknowledgments

The authors would like to thank Dr Sharmili Vidyadaran (Universiti Putra Malaysia Selangor, Malaysia) for generously providing the BV2 microglial cells. The present study was supported by the International Medical University [grant no. MBT I-2016(02)]. The authors also wish to thank Henry Ling of Columbia University (New York, USA) for his editorial input.

Notes

[1] Competing interests

The authors declare that they have no competing interests.

References

1 

Kochanek KD, Murphy SL, Xu J and Tejada-Vera B: Deaths: Final data for 2014. Natl Vital Stat Rep. 65:1–122. 2016.PubMed/NCBI

2 

Zoghbi HY and Orr HT: Pathogenic mechanisms of a polyglutamine-mediated neurodegenerative disease, spinocerebellar ataxia type 1. J Biol Chem. 284:7425–7429. 2009. View Article : Google Scholar :

3 

Tsuji S: Genetics of neurodegenerative diseases: Insights from high-throughput resequencing. Hum Mol Genet. 19:R65–R70. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Chen WW, Zhang X and Huang WJ: Role of neuroinflammation in neurodegenerative diseases (Review). Mol Med Rep. 13:3391–3396. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Uttara B, Singh AV, Zamboni P and Mahajan RT: Oxidative stress and neurodegenerative diseases: A review of upstream and downstream antioxidant therapeutic options. Curr Neuropharmacol. 7:65–74. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Soto C and Estrada LD: Protein misfolding and neurodegeneration. Arch Neurol. 65:184–189. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Cherry JD, Olschowka JA and O'Banion MK: Neuroinflammation and M2 microglia: the good, the bad, and the inflamed. J Neuroinflammation. 11:982014. View Article : Google Scholar : PubMed/NCBI

8 

Yao L, Kan EM, Lu J, Hao A, Dheen ST, Kaur C and Ling EA: Toll-like receptor 4 mediates microglial activation and production of inflammatory mediators in neonatal rat brain following hypoxia: Role of TLR4 in hypoxic microglia. J Neuroinflammation. 10:232013. View Article : Google Scholar : PubMed/NCBI

9 

Banks WA, Gray AM, Erickson MA, Salameh TS, Damodarasamy M, Sheibani N, Meabon JS, Wing EE, Morofuji Y, Cook DG and Reed MJ: Lipopolysaccharide-induced blood-brain barrier disruption: Roles of cyclooxygenase, oxidative stress, neuroinflammation, and elements of the neurovascular unit. J Neuroinflammation. 12:2232015. View Article : Google Scholar : PubMed/NCBI

10 

Morgan MJ and Liu ZG: Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res. 21:103–115. 2011. View Article : Google Scholar

11 

Hutchins AP, Diez D and Miranda-Saavedra D: The IL-10/STAT3-mediated anti-inflammatory response: Recent developments and future challenges. Brief Funct Genomics. 12:489–498. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Hashim P: Centella asiatica in food and beverage applications and its potential antioxidant and neuroprotective effect. Int Food Res J. 18:1215–1222. 2011.

13 

Su Z, Ye J, Qin Z and Ding X: Protective effects of madecassoside against doxorubicin induced nephrotoxicity in vivo and in vitro. Sci Rep. 5:183142015. View Article : Google Scholar : PubMed/NCBI

14 

Nurlaily A, Noor BA and Musalmah M: Comparative antioxidant and anti-inflammatory activity of different extracts of Centella asiatica (L.) Urban and its active compounds, asiaticoside and madecassoside. Med Health. 7:62–72. 2012.

15 

Li SQ, Xie YS, Meng QW, Zhang J and Zhang T: Neuroprotective properties of Madecassoside from Centella asiatica after hypoxic-ischemic injury. Pak J Pharm Sci. 29:2047–2051. 2016.

16 

Kumar H, More SV, Han SD, Choi JY and Choi DK: Promising therapeutics with natural bioactive compounds for improving learning and memory-a review of randomized trials. Molecules. 17:10503–10539. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Mohan JRJ: Investigating anti-neuroinflammatory responses in lipopolysaccharide-stimulated BV2 microglia cells upon treatment with madecassoside (Dissertation). Kuala Lumpur (MY): International Medical University; 2016

18 

Ajmone-Cat MA, Bernardo A, Greco A and Minghetti L: Non-steroidal anti-inflammatory drugs and brain inflammation: Effects on microglial functions. Pharmaceuticals. 3:1949–1964. 2010. View Article : Google Scholar : PubMed/NCBI

19 

Strober W: Trypan blue exclusion test of cell viability. Curr Protoc Immunol Appendix. 3:Appendix3B2001.

20 

Park E, Kim DK and Chun HS: Resveratrol inhibits lipopolysaccharide-induced phagocytotic activity in BV2 cells. J Korean Soc App Biolo Chemistry. 55:803–807. 2012. View Article : Google Scholar

21 

Zhang T, Gong X, Hu G and Wang X: EP2-PKA signaling is suppressed by triptolide in lipopolysaccharide-induced microglia activation. J Neuroinflammation. 12:502015. View Article : Google Scholar : PubMed/NCBI

22 

Schmittgen TD and Livak KJ: Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3:1101–1108. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Popa-Wagner A, Mitran S, Sivanesan S, Chang E and Buga AM: ROS and brain diseases: The good, the bad, and the ugly. Oxid Med Cell Longev. 2013:9635202013. View Article : Google Scholar

24 

Phanjedra A, Jestadi DB and Periyasamy L: Free radicals: Properties, sources, targets, and their implication in various diseases. Indian J Clin Biochem. 30:11–26. 2015. View Article : Google Scholar

25 

Ma MW, Wang J, Zhang Q, Wang R, Dhandapani KM, Vadlamudi RK and Brann DW: NADPH oxidase in brain injury and neurodegenerative disorders. Mol Neurodegener. 12:72017. View Article : Google Scholar : PubMed/NCBI

26 

Al Mamun A, Hashimoto M, Katakura M, Matsuzaki K, Hossain S, Arai H and Shido O: Neuroprotective effect of madecassoside evaluated using amyloid B1-42-mediated in vitro and in vivo Alzheimer's Disease models. Int J Indigenous Med Plants. 47:2051–4263. 2014.

27 

Aoshiba K, Yasuda K, Yasui S, Tamaoki J and Nagai A: Serine proteases increase oxidative stress in lung cells. Am J Physiol Lung Cell Mol Physiol. 281:L556–L564. 2001. View Article : Google Scholar : PubMed/NCBI

28 

Luo Y, Yang YP, Liu J, Li WH, Yang J, Sui X, Yuan X, Nie ZY, Liu YQ, Chen D, et al: Neuroprotective effects of madecassoside against focal cerebral ischemia reperfusion injury in rats. Brain Res. 1565:37–47. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Hörl WH: Nonsteroidal anti-inflammatory drugs and the kidney. Pharmaceuticals. 3:2291–2321. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Maity P, Bindu S, Dey S, Goyal M, Alam A, Pal C, Mitra K and Bandyopadhyay U: Indomethacin, a non-steroidal anti-inflammatory drug, develops gastropathy by inducing reactive oxygen species-mediated mitochondrial pathology and associated apoptosis in gastric mucosa. J Biol Chem. 284:3058–3068. 2009. View Article : Google Scholar

31 

Wang X, Zhao Q, Matta R, Meng X, Liu X, Liu CG, Nelin LD and Liu Y: Inducible Nitric-oxide synthase expression is regulated by mitogen-activated protein kinase phosphatase-1. J Biol Chem. 284:27123–27134. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Garry PS, Ezra M, Rowland MJ, Westbrook J and Pattinson KT: The role of the nitric oxide pathway in brain injury and its treatment-From bench to bedside. Exp Neurol. 263:235–243. 2015. View Article : Google Scholar

33 

Nascimento FR, Gomes EA, Russo M and Lepique AP: Interferon regulatory factor (IRF)-1 is a master regulator of the cross talk between macrophages and L929 fibrosarcoma cells for nitric oxide dependent tumoricidal activity. PLoS One. 10:e01177822015. View Article : Google Scholar : PubMed/NCBI

34 

Olivera GC, Ren X, Vodnala SK, Lu J, Coppo L, Leepiyasakulchai C, Holmgren A, Kristensson K and Rottenberg ME: Nitric oxide protects against infection-induced neuroinflammation by preserving the stability of the blood brain barrier. PLoS Pathog. 12:e10054422016. View Article : Google Scholar

35 

An HJ, Kim IT, Park HJ, Kim HM, Choi JH and Lee KT: Tormentic acid, a triterpenoid saponin, isolated from Rosa rugosa, inhibited LPS-induced iNOS, COX-2, and TNF-α expression through inactivation of the nuclear factor-κb pathway in RAW 264.7 macrophages. Int Immunopharmacol. 11:504–510. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Won JH, Shin JS, Park HJ, Jung HJ, Koh DJ, Jo BG, Lee JY, Yun K and Lee KT: Anti-inflammatory effects of madecassic acid via the suppression of NF-kappaB pathway in LPS-induced RAW 264.7 macrophage cells. Planta Med. 76:251–257. 2010. View Article : Google Scholar

37 

Ricciotti E and FitzGerald GA: Prostaglandins and inflammation. Arterioscler Thromb Vasc Biol. 31:986–1000. 2011. View Article : Google Scholar : PubMed/NCBI

38 

Wang G, Sarkar P, Peterson JR, Anrather J, Pierce JP, Moore JM, Feng J, Zhou P, Milner TA, Pickel VM, et al: COX-1-derived PGE2 and PGE2 type 1 receptors are vital for angiotensin II-induced formation of reactive oxygen species and Ca2+ influx in the subfornical organ. Am J Physiol Heart Circ Physiol. 305:H1451–H1461. 2013. View Article : Google Scholar : PubMed/NCBI

39 

Hanna N, Bonifacio L, Reddy P, Hanna I, Weinberger B, Murphy S, Laskin D and Sharma S: IFN-gamma-mediated inhibition of COX-2 expression in the placenta from term and preterm labor pregnancies. Am J Reprod Immunol. 51:311–318. 2004. View Article : Google Scholar : PubMed/NCBI

40 

Klampfer L, Huang J, Kaler P, Sasazuki T, Shirasawa S and Augenlicht L: STAT1-independent inhibition of cyclo-oxygenase-2 expression by IFNgamma; a common pathway of IFNgamma-mediated gene repression but not gene activation. Oncogene. 26:2071–2081. 2007. View Article : Google Scholar

41 

Turnquist C, Wang Y, Severson DT, Zhong S, Sun B, Ma J, Constaninescu SN, Ansorge O, Stolp HB, Molnár Z, et al: STAT1-induced ASPP2 transcription identifies a link between neuroinflammation, cell polarity, and tumor suppression. Proc Natl Acad Sci USA. 111:9834–9839. 2014. View Article : Google Scholar : PubMed/NCBI

42 

Stockinger S and Decker T: Novel functions of type I interferons revealed by infection studies with Listeria monocytogenes. Immunobiology. 213:889–897. 2008. View Article : Google Scholar : PubMed/NCBI

43 

Zhang C, Li B, Gaikwad AS, Haridas V, Xu Z, Gutterman JU and Duvic M: Avicin D selectively induces apoptosis and downregulates p-STAT-3, bcl-2, and survivin in cutaneous T-cell lymphoma cells. J Invest Dermatol. 128:2728–2735. 2008. View Article : Google Scholar : PubMed/NCBI

44 

Pandey MK, Sung B and Aggarwal BB: Betulinic acid suppresses STAT3 activation pathway through induction of protein tyrosine phosphatase SHP-1 in human multiple myeloma cells. Int J Cancer. 127:282–292. 2010.

45 

Lawrence T: The nuclear factor NF-κappaB pathway in inflammation. Cold Spring Harb Perspect Biol. 1:a0016512009. View Article : Google Scholar

46 

Jatana M, Giri S, Ansari MA, Elango C, Singh AK, Singh I and Khan M: Inhibition of NF-kappaB activation by 5-lipoxygenase inhibitors protects brain against injury in a rat model of focal cerebral ischemia. J Neuroinflammation. 3:122006. View Article : Google Scholar : PubMed/NCBI

47 

Yamamoto Y and Gaynor RB: Therapeutic potential of inhibition of the NF-kappaB pathway in the treatment of inflammation and cancer. J Clin Invest. 107:135–142. 2001. View Article : Google Scholar : PubMed/NCBI

48 

Yin MJ, Yamamoto Y and Gaynor RB: The anti-inflammatory agents aspirin and salicylate inhibit the activity of I(kappa)B kinase-beta. Nature. 396:77–80. 1998. View Article : Google Scholar : PubMed/NCBI

49 

Pierce JW, Read MA, Ding H, Luscinskas FW and Collins T: Salicylates inhibit I kappa B-alpha phosphorylation, endothelial-leukocyte adhesion molecule expression, and neutrophil transmigration. J Immunol. 156:3961–3969. 1996.PubMed/NCBI

50 

Patil KR, Mohapatra P, Patel HM, Goyal SN, Ojha S, Kundu CN and Patil CR: Pentacyclic Triterpenoids Inhibit IKKβ mediated activation of NF-κB Pathway: In Silico and in vitro evidences. PLoS One. 10:e01257092015. View Article : Google Scholar

51 

Rotblat B, Grunewald TG, Leprivier G, Melino G and Knight RA: Anti-oxidative stress response genes: Bioinformatic analysis of their expression and relevance in multiple cancers. Oncotarget. 4:2577–2590. 2013. View Article : Google Scholar : PubMed/NCBI

52 

Chora AA, Fontoura P, Cunha A, Pais TF, Cardoso S, Ho PP, Lee LY, Sobel RA, Steinman L and Soares MP: Heme oxygenase-1 and carbon monoxide suppress autoimmune neuroinflammation. J Clin Invest. 117:438–447. 2007. View Article : Google Scholar : PubMed/NCBI

53 

Gozzelino R, Jeney V and Soares MP: Mechanisms of cell protection by heme oxygenase-1. Annu Rev Pharmacol Toxicol. 50:323–354. 2010. View Article : Google Scholar : PubMed/NCBI

54 

Kim YR, Oh JE, Kim MS, Kang MR, Park SW, Han JY, Eom HS, Yoo NJ and Lee SH: Oncogenic NRF2 mutations in squamous cell carcinomas of oesophagus and skin. J Pathol. 220:446–451. 2010. View Article : Google Scholar

55 

Qi Z, Ci X, Huang J, Liu Q, Yu Q, Zhou J and Deng X: Asiatic acid enhances Nrf2 signaling to protect HepG2 cells from oxidative damage through Akt and ERK activation. Biomed Pharmacother. 88:252–259. 2017. View Article : Google Scholar : PubMed/NCBI

56 

Ding Y, Chen M, Wang M, Wang M, Zhang T, Park J, Zhu Y, Guo C, Jia Y, Li Y and Wen A: Neuroprotection by acetyl-11-Keto-β-Boswellic acid, in ischemic brain injury involves the Nrf2/HO-1 defense pathway. Sci Rep. 4:70022014. View Article : Google Scholar

57 

Yan SL, Yang HT, Lee YJ, Lin CC, Chang MH and Yin MC: Asiatic acid ameliorates hepatic lipid accumulation and insulin resistance in mice consuming a high fat diet. J Agric Food Chem. 62:4625–4631. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May 2018
Volume 41 Issue 5

Print ISSN: 1107-3756
Online ISSN:1791-244X

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Sasmita, A., Ling, A., Voon, K., Koh, R., & Wong, Y. (2018). Madecassoside activates anti‑neuroinflammatory mechanisms by inhibiting lipopolysaccharide‑induced microglial inflammation. International Journal of Molecular Medicine, 41, 3033-3040. https://doi.org/10.3892/ijmm.2018.3479
MLA
Sasmita, A., Ling, A., Voon, K., Koh, R., Wong, Y."Madecassoside activates anti‑neuroinflammatory mechanisms by inhibiting lipopolysaccharide‑induced microglial inflammation". International Journal of Molecular Medicine 41.5 (2018): 3033-3040.
Chicago
Sasmita, A., Ling, A., Voon, K., Koh, R., Wong, Y."Madecassoside activates anti‑neuroinflammatory mechanisms by inhibiting lipopolysaccharide‑induced microglial inflammation". International Journal of Molecular Medicine 41, no. 5 (2018): 3033-3040. https://doi.org/10.3892/ijmm.2018.3479