Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
January-2016 Volume 48 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2016 Volume 48 Issue 1

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer

Corrigendum in: /10.3892/ijo.2024.5698
  • Authors:
    • Hong Tan
    • Qingnan He
    • Guanhui Gong
    • Yixuan Wang
    • Juanni Li
    • Junpu Wang
    • Ding Zhu
    • Xiaoying Wu
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, School of Basic Medical Science, Central South University, Changsha, Hunan 410013, P.R. China, Children's Medical Center, The Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, P.R. China, Department of Pathology, Xiangya Hospital, Central South University, Changsha, Hunan 410008, P.R. China
  • Pages: 181-190
    |
    Published online on: November 9, 2015
       https://doi.org/10.3892/ijo.2015.3241
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Increasing evidence suggests that microRNAs (miRNAs) play a critical role in tumorigenesis. Decreased expression of miR‑382 has been observed in various types of cancers. However, the biological function of miRNA-382 in ovarian cancer is still largely unknown. Here, we found miR‑382 was downregulated in human ovarian cancer tissues and cell lines. miR‑382 inhibited ovarian cancer cell proliferation, migration, invasion and the epithelial-mesenchymal transition (EMT). Furthermore, we identified receptor tyrosine kinase orphan receptor 1 (ROR1) as a target of miR‑382, and miR‑382 rescued the promotion effect of ROR1 on migration, invasion and EMT process in SKOV3 and COV434 cells. Collectively, these findings revealed that miR‑382 inhibits migration and invision by targeting ROR1 through regulating EMT in ovarian cancer, and might serve as a tumor suppressor in ovarian cancer.

Introduction

MicroRNAs (miRNAs) are short non-coding RNA molecules of 19–24 nucleotides (nt) involved in post-transcriptional regulation of genes expression (1). miRNAs participate in many significant biological processes including cell proliferation, apoptosis, migration, invasion, differentiation, initiation and progression of various cancers (2–4). In recent years, miRNAs were investigated in body fluids, such as plasma, serum, urine, and saliva, and in tissues, and used as biomarkers in diverse diseases including many cancers (5). It was reported that miR-382 was downregulated in stage III/IV epithelial ovarian carcinoma compared with the normal group (6,7). Recently, miR-382 was reported downregulated in human ovarian cancer tissues (8). Yet, limited research has been carried out on the function and mechanism of miR-382 in ovarian cancer.

ROR1 belongs to the RTKs, which are a large family of cell surface glycoproteins (9). It was reported that ovarian cancers patients with high expression levels of ROR1 had a higher rate of relapse and a shorter median survival than ovarian cancers patients who expressed low or negligible levels of ROR1, which indicated that ovarian CSCs express ROR1 that contributed to their abilities to form tumors, thus, making ROR1 a potential target for the treatment of ovarian cancer patients (10). Furthermore, others reported the expression of ROR1 was related to malignant characteristics of ovarian cancer, and ROR1 may act as a novel prognostic biomarker in ovarian cancer (11). These studies suggested ROR1 may function crucially in ovarian cancer. However, whether miR-382 targeted ROR1 or not in ovarian cancer cells remained unclear.

We studied the expression, functions and mechanism of miR-382 in ovarian cancer, and the biological functions including cellular proliferation, migration, invasion and epithelial-mesenchymal transition (EMT) process in vitro, as well as the involved molecular mechanisms including its target relationship with ROR1. Our aim was to provide novel insights to improve therapy and prevention of ovarian cancers.

Materials and methods

Cell culture and transfection

Ovarian cancer cell lines HO8910, A2780, SKOV3, and COV434 were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA), human ovarian surface epithelium HOSE cells were purchased from Pricells (Wuhan, China) and cultured in DMEM medium containing 10% fetal bovine serum (FBS). HO8910, A2780, SKOV3 cells were cultured in RPMI-1640 medium containing 10% FBS and 1% antibiotic-antimycotic solution (100 U/ml penicillin and 100 μg/ml streptomycin). COV434 cell were cultured in McCoys 5A culture media. Cells were maintained at 37°C in a humidified atmosphere containing 5% CO2. Transfection was carried out by Lipofectamine 2000 reagent (Invitrogen). The plasmids of miR-382 mimics (product no. HmiR-AN0480), miR-382 inhibitor (product no. HmiR-AN0480-SN-10), miRNA NC mimics (product no. CmiR-AN0001) and miRNA NC inhibitor (product no. CmiR-AN0001-SN) were purchased from Fulen Gen (Guangzhou, China). The plasmid of pCDNA3.1-ROR1 was constructed by AuraGene (Changsha, China).

miRNA target prediction

Prediction of miR-382 target sites was performed by the online software MicroRNA.org - Targets and Expression (http://www.microrna.org/microrna/home.do). The related function of the target was also considered.

Quantitative real-time PCR

Total RNA was extracted by TRIzol (Invitrogen Life Technologies, Carlsbad, CA, USA) methods, and was reverse transcribed as cDNA by using reverse transcription system (Fermentans, Canada). The primers were designed using Primer 5.0, and the forward and reverse primer sequences are showed in Table I. The quantitative real-time PCR (qRT-PCR) was performed using the SYBR Green qPCR (Toyobo, Japan) for studying the quantitative expression of various genes (ROR1, E-cadherin, vimentin, N-cadherin and Snail) according to the manufacturer's protocol. Three repetitions were tested for qRT-PCR. The relative expressions of miR-382 and mRNAs were normalized to those of internal reference U6 or β-actin, and were calculated by the 2−ΔΔCt method.

Table I

Forward and reverse primer sequences of genes.

Table I

Forward and reverse primer sequences of genes.

PrimerSequences (or product number)
miR-382HmiRQP0480 (product number)
U6HmiRQP9001 (product number)
ROR1F: AGATCACAGCTGCCTTCACTAT
R: GACATTCTCCAGGATTTCACAT
E-cadherinF: CTCGGCCTGAAGTGACTCGTAAC
R: CAGCAACGTGATTTCTGCATTTC
VimentinF: GACGCCATCAACACCGAGTT
R: CTTTGTCGTTGGTTAGCTGGT
N-cadherinF: CAGTATCCGGTCCGATCTGC
R: GTCCTGCTCACCACCACTAC
SnailF: GCCTTCAACTGCAAATACTGC
R: CCTCATGTTTGTGCAGGAGA
β-actinF: AGGGGCCGGACTCGTCATACT
R: GGCGGCACCACCATGTACCCT
MTT assay

Approximately 5×103 cells per well were plated into 96-well plates (Costar, USA). After culturing for 24, 48, or 72 h, the cells were treated with fresh serum-free medium and 10 μl/well MTT (Biosharp, Hefei, China) solution (10 mg/ml in PBS) according to the manufacturer's protocol. DMSO 100 μl was added to every well after the incubation for 4 h. Following incubation at 37°C for 10 min, the absorbance was measured by microplate reader (Thermo, USA) at 570 nm at room temperature.

Colony formation assay

Cells were trypsinized and suspended in medium including 0.3% agar and 10% serum, then were plated onto a bottom layer with 0.6% agar. The cells were plated at 300 cells/well into 6-well plates (Costar). The number of colonies were counted after 14 days by Giemsa staining (Solarbio, Beijing, China) via the equation colony forming efficiency = (number of colonies/number of inoculated cells) × 100%.

Scratch assay

Cells (closely 1×105 cells) were seeded into 12-well plates (Costar), and were incubated at 37°C until cells reached a confluence of ≥90%. A scratch was generated by use of a sterile 10-μl pipette tip, and this time was considered as 0 h for each experiment. Then, at 48 h, photographic images were acquired with an inverted microscope (Motic, Xiamen, China). Thus, migration distance = the gap of 0 h - the gap of 48 h the gaps of 0 h, so the migration distances are presented a reverse relationship with the gap of 48 h (Figs. 3 and 7).

Figure 3

miR-382 inhibits the migration and invasion of ovarian cancer cells. (A and B) miR-382 inhibited the migration in SKOV3 cells as evaluated by wound scratch assay. (C and D) miR-382 suppressed the migration in COV434 cells. (E and F) miR-382 inhibited the invasion in SKOV3 cells in Transwell chamber invasion assays. (G and H) miR-382 restrained the invasion in COV434 cells in the Transwell assays. n=3, *p<0.05.

Figure 7

miR-382 rescued the promotion effect of ROR1 on migration and invasion of ovarian cancer cells. (A and B) ROR1 promoted migration by targeting miR-382 in SKOV3 cells as shown in the wound scratch assay. (C and D) ROR1 promoted migration by targeting miR-382 in COV434 cells in the wound scratch assays, (E and F) and promoted the invasion by targeting to miR-382 in SKOV3 cells. (G and H) miR-382 accelerated the invasion effect of ROR1 by targeting miR-382 in COV434 cells in the Transwell assays. n=3, *p<0.05.

Invasion assay

Invasion assay were performed in 24-well plates with 8-μm pore size chamber inserts (BD, Frankin Lakes, NJ, USA). Approximately 1×105 cells/well were resuspended in 200 μl of medium without fetal bovine serum (FBS; Gibco), and seeded on the upper chamber with the Matrigel-coated membrane. In addition, 500 μl medium supplemented with 10% FBS was added into the lower chamber. After 24-h incubation at 37°C and 5% CO2, the membranes were stained with 0.1% crystal violet. The cell numbers were counted via an inverted microscope (Motic). Each assay was performed three independent times.

Western blotting

Protein extracts from SKOV3 and COV434 cells were prepared using RIPA lysis buffer (AuraGene) according to the manufacturer's protocol. The protein concentration was confirmed in accordance with the Bradford protein assay reagent (Beyotime Biotechnology, Suzhou, China), and bovine serum albumin was utilized as a standard. Western blot analysis was subsequently carried out to evaluate the levels of ROR1 (1:200, BM0049, ABZOOM), E-cadherin (1:200, YT1453, Immunoway, Changsha, China), vimentin (1:1,000, YT4881, Immunoway), N-cadherin (1:1,000, ab18203, Abcam, China) and Snail (1:200, ab180714, Abcam). Equal amounts of lysate were resolved via SDS-PAGE, and transferred to a PVDF membrane (Millipore, Bedford, MA, USA) through a semidry transfer method. The PVDF membrane was blocked with 5% non-fat milk in TBST buffer for 2 h at room temperature, and then was incubated overnight with primary antibodies, and then was incubated for 1 h using a suitable secondary antibody (1:2,000, Jackson, USA). Electrochemiluminescence was performed with a Gel Documentation and Analysis System.

Luciferase reporter assay

Luciferase assays were performed in SKOV3 and COV434 cells. SKOV3 and COV434 cells were transfected with each of the plasmids [empty vector (MOCK), ROR1 UTR wild-type (WT) and ROR1 UTR mutant (MUT), as a miR-382 binding site] together with miR-382 mimics, miR-382 inhibitor, and negative control RNA in 24-well plates. Two days after transfection, cells were harvested and lysed. Dual luciferase reporter gene assay kit (BioVision, Milpitas, CA, USA) was used to determine the luciferase activities on a luminometer (Roche, Basel, Switzerland). Renilla luciferase activity was normalized to firefly luciferase activity.

Statistical analysis

All statistical tests were conducted with SPSS 17.0 software. The variance between two groups and multiple groups were compared by Student's t-test and ANOVA, respectively. The data are expressed as mean ± standard deviation (SD). The p-values <0.05 were regarded as statistically significant.

Results

miR-382 is downregulated in human ovarian cancer tissues and cell lines

To investigate the role of miR-382 in ovarian cancer, the expression of miR-382 was examined in tissues and cell lines by qRT-PCR assays. We found the expression of miR-382 was significantly downregulated in human ovarian cancer tissues compared to adjacent non-cancerous tissues (n=20) (Fig. 1A). Moreover, the expression of miR-382 in ovarian cancer cell lines (H08019, A2780, SKOV3 and COV434) was markedly less than in ovarian epithelial cells HOSE (Fig. 1B). These results indicate that miR-382 is downregulated in both human ovarian cancer tissues and cancer cell lines.

Figure 1

The expression of miR-382 in tissues and cell lines of ovarian cancer. (A) qRT-PCR analysis of miR-382 expression in 20 pairs of ovarian cancer tissues and their corresponding adjacent normal ovarian tissues. The expression of miR-382 was normalized to U6. (B) The relative expression levels of miR-382 were determined by qRT-PCR in human ovarian epithelial cells (HOSE) and ovarian cancer cell lines (HO8910, A2780, SKOV3, COV434). n=20 or 3, *p<0.05.

Overexpression of miR-382 suppresses proliferation of ovarian cancer cells in vitro

To better understand the role of miR-382 in ovarian cancer, we used retroviral vectors to establish ovarian cancer cell lines stably overexpressing or silencing miR-382. The expression levels of miR-382 in the SKOV3 and COV434 cell lines were examined by qRT-PCR (Fig. 2A and B). We also measured the growth-promoting effect of miR-382 on ovarian cancer cells by MTT and colony formation assays. MTT assays revealed that overexpression of miR-382 significantly suppressed proliferation of ovarian cancer cells and silencing miR-382 in ovarian cancer cells dramatically promoted proliferation (Fig. 2C and D). In colony formation assay, overexpression of miR-382 significantly inhibited the viability of indicated cells which formed less and smaller clones in SKOV3 (Fig. 2E) and COV434 cells (Fig. 2F). These findings suggest that miR-382 suppresses proliferation of ovarian cancer cells in vitro.

Figure 2

miR-382 inhibits the proliferation of ovarian cancer cells. (A and B) The efficiency of overexpression and interference of miR-382 was validated by qRT-PCR in SKOV3 and COV434 cells. (C and D) miR-382 suppressed the cell proliferation in SKOV3 and COV434 cells by MTT assays. (E and F) miR-382 suppressed cell proliferation in SKOV3 and COV434 cells by colony formation assay for 14 days. n=3, *p<0.05.

Overexpression of miR-382 suppresses migration and invasion of ovarian cancer cells in vitro

To evaluate the function of miR-382 in the migration and invasion efficiency of ovarian cancer cells, the scratch test and Transwell assays were performed. In scratch assay, overexpression of miR-382 significantly promoted wound healing of SKOV3 (Fig. 3A and B) and COV434 cells (Fig. 3C and D). Moreover, Transwell assay was used to evaluate the invasive ability of ovarian cancer cells. The results indicated that ectopic expression of miR-382 significantly decreased the invasion rate of SKOV3 (Fig. 3E and F) and COV434 cells (Fig. 3G and H).

EMT is taken for a key mechanism by which cancer cells acquire their migratory and invasive capabilities. To further investigate whether the inhibitory effect of miR-382 on migration and invasion was mediated by epithelial to mesenchymal transition (EMT), we examined the expression of several EMT markers by qRT-PCR and western blot assays. Both in mRNA and protein level as expected, miR-382 overexpression increased the expression level of epithelial marker (E-cadherin) and decreased the levels of mesenchymal markers in SKOV3 (Fig. 4A, C and D) and COV434 cells (Fig. 4B, C and E). Taken together, these findings suggest that miR-382 was able to impede invasion mediated by EMT in vitro.

Figure 4

miR-382 suppresses the EMT process in ovarian cancer cells. (A and B) The mRNA expression levels of E-cadherin, vimentin, N-cadherin and Snail when miR-382 was overexpressed in SKOV3 and COV434 cells. (C-E) The protein expression levels of E-cadherin, vimentin, N-cadherin and Snail when miR-382 was overexpressed in SKOV3 and COV434 cells. n=3, *p<0.05.

ROR1 is a direct target of miR-382 in ovarian cancer cells

Many miRNAs have been reported to function by binding a specific target. To examine whether miR-382 has a similar mechanism, prediction of miRNA target sites was performed by the online software MicroRNA.org - Targets and Expression (http://www.microrna.org/microrna/home.do), showing the ROR1-3′-UTR regions contain the miR-382 complementary sequence (Fig. 5A). In addition, it has been reported that ROR1 function is crucial in ovarian cancer. Thus, we focused on ROR1 as the primary candidate target of miR-382, and examined firstly the direct binding between miR-382 and ROR1, we constructed the vectors ROR1-3′-UTR and mut-ROR1-3′-UTR to observe their binding activity with miR-382. miR-382 overexpression consistently and significantly reduced the luciferase reporter activity by the ROR1-3′-UTR. However, ROR1-3′-UTR luciferase reporter activity was unaffected by point mutations in the miR-382-binding seed region (Fig. 5B and C). Collectively, these data suggest that miR-382 may inhibit ROR1 expression by targeting its 3′-UTR. As predicted, qRT-PCR and western blot assays showed that, at 48 h after transfection, the enhanced miR-382 in SKOV3 and COV434 cells significantly repressed ROR1 RNA and protein expression compared to cells transfected with a scrambled control. By comparison, downregulation of miR-382 by inhibitors in SKOV3 (Fig. 5D and F) and COV434 (Fig. 5E and G) cells led to a moderate increase in the ROR1 RNA and protein level. Together, these data provide strong evidence that ROR1 is a specific target of miR-382 in ovarian cancer cells.

Figure 5

miR-382 targeting ROR1 in ovarian cancer cells. (A) The sequence of the predicted miR-382 binding site and the ROR1-3′-UTR regions containing the wild-type or mutant binding site are displayed. (B and C) Luciferase reporter assay was used to determine whether ROR1 was the direct target of miR-382 in SKOV3 and COV434 cells, respectively. A normal and a mutated 3′-UTR of ROR1 were subcloned into the pRNAT-U6.1/Neo reporter vector. PRNAT-U6.1/Neo-ROR1-3′-UTR (3′-UTR ROR1-) or PRNAT-U6.1/Neo-mut ROR1-3′-UTR (3′-UTR mut-ROR1) plus pre-miR-382 or anti-miR-382 were cotransfected. The fluorescence intensities were found to mirror the capacity of direct binding. (D and E) The mRNA expression of ROR1 in SKOV3 and COV434 cells with overexpression and interference of miR-382 (pre-miR-382 and anti-miR-382). (F and G) The protein level of ROR1 in SKOV3 and COV434 cells with added pre-miR-382 and anti-miR-382. n=3, *p<0.05.

miR-382 rescues the promotion effect of ROR1 on migration and invasion of ovarian cancer cells

To clarify the roles of ROR1 in ovarian cancer, the expression of ROR1 was investigated in tissues and cell lines. It was found that the mRNA level of ROR1 was upregulated in human ovarian cancer tissues (Fig. 6A), and was negatively correlated with the downregulation of miR-382 (Fig. 6B). The mRNA and protein levels of ROR1 in the human ovarian cancer cell lines HO8910, SKOV3 and COV434 were markedly higher than their expression in human ovarian epithelial HOSE cells (Fig. 6C). To evaluate the function of ROR1 that acted as a target of miR-382 in the migration and invasion efficiency of ovarian cancer cells, the scratch test and the Transwel assays were performed. The overexpression of ROR1 significantly increased cell migration, which was rescued by overexpression of miR-382 in both SKOV3 (Fig. 7A and B) and COV434 cells (Fig. 7C and D). Overexpression of ROR1 promoted the cell invasion, while this effect was reversed by overexpression of miR-382 in SKOV3 (Fig. 7E and F) and COV434 cells (Fig. 7G and H). Taken together, these findings suggested that miR-382 inhibited migration and invasion by directly targeting ROR1 in SKOV3 and COV434 cells.

Figure 6

ROR1 is overexpressed and correlated with miR-382 in ovarian cancer tissues and cells. (A) The expression of ROR1 was upregulated in human ovarian cancer tissues. (B) Correlation between expression level of ROR1 and that of miR-382 in 15 matched tissues. Linear regression coefficient and statistical significance is indicated. (C) The mRNA and protein levels of ROR1 were increased in ovarian cancer cell lines. n= 3 or 15, *p<0.05.

miR-382 is able to rescue the effect of ROR1 on EMT process of ovarian cancer cells

The above observations suggested that miR-382 could inhibit ovarian cancer cell migration and invasion and exerted its function by directly targeting ROR1; we further investigated the mechanism by which miR-382 and ROR1 regulate the cell malignant phenotype. To determine whether the typical molecular alternations of EMT occurred, the RNA and protein levels of epithelial (E-cadherin), mesenchymal (vimentin and N-cadherin) markers and EMT-related transcription factor Snail were measured by qRT-PCR and western blot assays. ROR1 overexpression reduced the mRNA expression of the epithelial maker E-cadherin and increased the mesenchymal makers N-cadherin, vimentin and EMT-related transcription factor Snail, while the effect was reversed by overexpression of miR-382 in SKOV3 (Fig. 8A) and COV434 cells (Fig. 8B). In line with mRNA expression, ROR1 overexpression lowered the protein amounts of the epithelial maker E-cadherin and increased the expression of the mesenchymal makers N-cadherin, vimentin and EMT-related transcription factor Snail, which was reversed markedly by overexpression of miR-382 in SKOV3 (Fig. 8C) and COV434 cells (Fig. 8D). The above findings suggested that miR-382 and its target gene ROR1, could affect ovarian cancer cell migration and invasion by regulating of the EMT process.

Figure 8

miR-382 affects ovarian cancer cell migration and invasion by ROR1 via regulating the EMT process. (A and B) QRT-PCR assays of the mRNA expression levels of E-cadherin, vimentin, N-cadherin and Snail when miR-382 was overexpressed in SKOV3 and COV434 cells with or without ROR1 restoration. (C and D) Western blot assays of the protein expression levels of E-cadherin, vimentin, N-cadherin and Snail in SKOV3 and COV434 cells when miR-382 was overexpressed with or without ROR1 restoration.n=3, *p<0.05.

Discussion

Ovarian cancer is the most deadly gynecological malignant tumor, and also the fifth most common cancer death of female in the world (12,13). It is commonly diagnosed at an advanced stage, and the overall survival rate of 5 years is ~20% (14). The incidence of ovarian cancer rises along with age, and is most universal at seventy to eighty years of life (15,16). The exact cause of ovarian cancer is still unknown. At present, the conventional therapy for ovarian cancer contains surgery, combining chemotherapy with a platinum-based (such as carboplatin) and a taxane-based (such as paclitaxel) treatment (17,18). Despite the advances in surgery and chemotherapy, the ovarian cancer patients suffer from serious side-effects caused by chemotherapy, and almost 70–80% of ovarian cancer may recur after first-line chemotherapy (19). Therefore, it is necessary and urgent to find new therapeutic targets that could contribute to the clinical treatment of ovarian cancer.

Increasing evidence exists that miRNAs play an important role in early diagnosis, prognosis, evaluation of therapy results and prevention of cancers (20–23). Each cancer has certain specific miRNA alterations that can be used as a cancer-specific ‘signature’ for potential clinical application to improve the precision of diagnosis, prognosis and treatment targets (24,25). Depending on the miRNA alterations in cancer of an individual patient, targeted therapies for personalized cancer treatment can be considered (20). Recently, it has been reported that miR-382 was downregulated in human ovarian cancer tissues (8). However, the functions of miR-382 have not previously been explored. Therefore, we studied miR-382 in ovarian cancer. We found that miR-382 was downregulated in human ovarian cancer cells and tissues, which was consistent with a previous study (8). Also, the expression of miR-382 and ROR1 was moderate in ovarian cancer cell lines SKOV3 and COV434, so we selected these cells for our study. Furthermore, we found that miR-382 could inhibit the proliferation, migration, invasion and the EMT process of ovarian cancer cells. These results demonstrated that miR-382 may act as a tumor suppressor ovarian cancer.

Many miRNAs have been reported to function by binding a specific target. We predicted that the miR-382 has potential to bind ROR1 by bioinformatics methods. Given this, we selected ROR1 as a candidate target of miR-382, and found that miR-382 could target ROR1 by luciferase reporter assay. Overexpression of miR-382 treatment declined the expression of ROR1 and silencing of miR-382 raised the expression of ROR1 in SKOV3 and COV434 cells. These results suggested that ROR1 could act as a target of miR-382. Furthermore, we showed miR-382 can rescue the acceleration effect of ROR1 on the proliferation, migration and invasion in SKOV3 and COV434 cells. These results indicated that miR-382 suppressed cancer progression by targeting ROR1 in ovarian cancer.

EMT is a vital step in the invasion and metastasis of cancers, in which epithelial cells lose their apical-basal polarity and cell-cell adhesion as well as gain migratory and invasive properties (26,27). A recent study has shown that the overexpression of miR-382 suppressed the EMT process, while inhibition of miR-382 stimulated EMT in osteosarcoma (28). Cui et al (29) reported breast adenocarcinomas expressing high levels of ROR1 were more likely to have gene expression signatures associated with the EMT and higher rates of metastasis than breast adenocarcinomas expressing low levels of ROR1, suggesting ROR1 may regulate EMT and metastasis. We speculated that both miR-382 and ROR1 were involved in the EMT process. Thus, we determined whether ROR1 that acted as a target of miR-382 was involved in the EMT process in ovarian cancer cells, and found that miR-382 rescued the promotion effect of ROR1 on EMT in SKOV3 and COV434 cells.

In conclusion, miR-382 inhibited the migration and invasion of ovarian cancer cells through targeting ROR1 via regulating EMT process in ovarian cancer cells. miR-382 functioned as a tumor suppressor, and might be useful in therapeutics of ovarian cancer.

Acknowledgements

This study was supported by grants from the National Natural Science Foundation of China (no. 81172469), Science and Technology Program of Hunan Provincial Science Technology Department (no. 2014FJ3090) and Science and Technology Program of Changsha City Science Technology Bureau (no. K1403050-31).

References

1 

Macha MA, Seshacharyulu P, Krishn SR, Pai P, Rachagani S, Jain M and Batra SK: MicroRNAs (miRNAs) as biomarker(s) for prognosis and diagnosis of gastrointestinal (GI) cancers. Curr Pharm Des. 20:5287–5297. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Ebert MS and Sharp PA: Roles for microRNAs in conferring robustness to biological processes. Cell. 149:515–524. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Ruepp A, Kowarsch A and Theis F: PhenomiR: microRNAs in human diseases and biological processes. Methods Mol Biol. 822:249–260. 2012. View Article : Google Scholar

4 

Tüfekci KU, Meuwissen RL and Genç S: The role of microRNAs in biological processes. Methods Mol Biol. 1107:15–31. 2014. View Article : Google Scholar

5 

Tricoli JV and Jacobson JW: MicroRNA: Potential for cancer detection, diagnosis, and prognosis. Cancer Res. 67:4553–4555. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Dahiya N and Morin PJ: MicroRNAs in ovarian carcinomas. Endocr Relat Cancer. 17:F77–F89. 2010. View Article : Google Scholar :

7 

Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS and Tewari M: Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries. PLoS One. 4:e53112009. View Article : Google Scholar : PubMed/NCBI

8 

Thériault BL, Basavarajappa HD, Lim H, Pajovic S, Gallie BL and Corson TW: Transcriptional and epigenetic regulation of KIF14 overexpression in ovarian cancer. PLoS One. 9:e915402014. View Article : Google Scholar : PubMed/NCBI

9 

Gschwind A, Fischer OM and Ullrich A: The discovery of receptor tyrosine kinases: Targets for cancer therapy. Nat Rev Cancer. 4:361–370. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Zhang S, Cui B, Lai H, Liu G, Ghia EM, Widhopf GF II, Zhang Z, Wu CC, Chen L, Wu R, et al: Ovarian cancer stem cells express ROR1, which can be targeted for anti-cancer-stem-cell therapy. Proc Natl Acad Sci USA. 111:17266–17271. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Zhang H, Qiu J, Ye C, Yang D, Gao L, Su Y, Tang X, Xu N, Zhang D, Xiong L, et al: ROR1 expression correlated with poor clinical outcome in human ovarian cancer. Sci Rep. 4:58112014.PubMed/NCBI

12 

Böcker W: WHO classification of breast tumors and tumors of the female genital organs: Pathology and genetics. Verh Dtsch Ges Pathol. 86:116–119. 2002.In German.

13 

Kan CW, Howell VM, Hahn MA and Marsh DJ: Genomic alterations as mediators of miRNA dysregulation in ovarian cancer. Genes Chromosomes Cancer. 54:1–19. 2015. View Article : Google Scholar

14 

Vargas-Hernández VM, Moreno-Eutimio MA, Acosta-Altamirano G and Vargas-Aguilar VM: Management of recurrent epithelial ovarian cancer. Gland Surg. 3:198–202. 2014.PubMed/NCBI

15 

Goff BA, Mandel L, Muntz HG and Melancon CH: Ovarian carcinoma diagnosis. Cancer. 89:2068–2075. 2000. View Article : Google Scholar : PubMed/NCBI

16 

Zhou XM, Zhang H and Han X: Role of epithelial to mesenchymal transition proteins in gynecological cancers: Pathological and therapeutic perspectives. Tumour Biol. 35:9523–9530. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Wang DH, Guo L and Wu XH: Checkpoint inhibitors in immunotherapy of ovarian cancer. Tumour Biol. 36:33–39. 2015. View Article : Google Scholar

18 

Muccioli M and Benencia F: Toll-like Receptors in ovarian cancer as targets for immunotherapies. Front Immunol. 5:3412014. View Article : Google Scholar : PubMed/NCBI

19 

Garces AH, Dias MS, Paulino E, Ferreira CG and de Melo AC: Treatment of ovarian cancer beyond chemotherapy: Are we hitting the target? Cancer Chemother Pharmacol. 75:221–234. 2015. View Article : Google Scholar

20 

Sethi S, Ali S, Sethi S and Sarkar FH: MicroRNAs in personalized cancer therapy. Clin Genet. 86:68–73. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Casanova-Salas I, Rubio-Briones J, Calatrava A, Mancarella C, Masiá E, Casanova J, Fernández-Serra A, Rubio L, Ramírez-Backhaus M, Armiñán A, et al: Identification of miR-187 and miR-182 as biomarkers of early diagnosis and prognosis in patients with prostate cancer treated with radical prostatectomy. J Urol. 192:252–259. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Jiang C, Chen X, Alattar M, Wei J and Liu H: MicroRNAs in tumorigenesis, metastasis, diagnosis and prognosis of gastric cancer. Cancer Gene Ther. 22:291–301. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Li SQ, Chen FJ and Cao XF: Distinctive microRNAs in esophageal tumor: Early diagnosis, prognosis judgment, and tumor treatment. Dis Esophagus. 26:288–298. 2013. View Article : Google Scholar

24 

Gounaris-Shannon S and Chevassut T: The role of miRNA in haematological malignancy. Bone Marrow Res. 2013:2691072013. View Article : Google Scholar

25 

Sethi S, Kong D, Land S, Dyson G, Sakr WA and Sarkar FH: Comprehensive molecular oncogenomic profiling and miRNA analysis of prostate cancer. Am J Transl Res. 5:200–211. 2013.PubMed/NCBI

26 

Koutsaki M, Spandidos DA and Zaravinos A: Epithelial-mesenchymal transition-associated miRNAs in ovarian carcinoma, with highlight on the miR-200 family: Prognostic value and prospective role in ovarian cancer therapeutics. Cancer Lett. 351:173–181. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Takai M, Terai Y, Kawaguchi H, Ashihara K, Fujiwara S, Tanaka T, Tsunetoh S, Tanaka Y, Sasaki H, Kanemura M, et al: The EMT (epithelial-mesenchymal-transition)-related protein expression indicates the metastatic status and prognosis in patients with ovarian cancer. J Ovarian Res. 7:762014. View Article : Google Scholar : PubMed/NCBI

28 

Xu M, Jin H, Xu CX, Sun B, Song ZG, Bi WZ and Wang Y: miR-382 inhibits osteosarcoma metastasis and relapse by targeting Y box-binding protein 1. Mol Ther. 23:89–98. 2015. View Article : Google Scholar

29 

Cui B, Zhang S, Chen L, Yu J, Widhopf GF II, Fecteau JF, Rassenti LZ and Kipps TJ: Targeting ROR1 inhibits epithelial-mesenchymal transition and metastasis. Cancer Res. 73:3649–3660. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Tan H, He Q, Gong G, Wang Y, Li J, Wang J, Zhu D and Wu X: miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer Corrigendum in /10.3892/ijo.2024.5698. Int J Oncol 48: 181-190, 2016.
APA
Tan, H., He, Q., Gong, G., Wang, Y., Li, J., Wang, J. ... Wu, X. (2016). miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer Corrigendum in /10.3892/ijo.2024.5698. International Journal of Oncology, 48, 181-190. https://doi.org/10.3892/ijo.2015.3241
MLA
Tan, H., He, Q., Gong, G., Wang, Y., Li, J., Wang, J., Zhu, D., Wu, X."miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer Corrigendum in /10.3892/ijo.2024.5698". International Journal of Oncology 48.1 (2016): 181-190.
Chicago
Tan, H., He, Q., Gong, G., Wang, Y., Li, J., Wang, J., Zhu, D., Wu, X."miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer Corrigendum in /10.3892/ijo.2024.5698". International Journal of Oncology 48, no. 1 (2016): 181-190. https://doi.org/10.3892/ijo.2015.3241
Copy and paste a formatted citation
x
Spandidos Publications style
Tan H, He Q, Gong G, Wang Y, Li J, Wang J, Zhu D and Wu X: miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer Corrigendum in /10.3892/ijo.2024.5698. Int J Oncol 48: 181-190, 2016.
APA
Tan, H., He, Q., Gong, G., Wang, Y., Li, J., Wang, J. ... Wu, X. (2016). miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer Corrigendum in /10.3892/ijo.2024.5698. International Journal of Oncology, 48, 181-190. https://doi.org/10.3892/ijo.2015.3241
MLA
Tan, H., He, Q., Gong, G., Wang, Y., Li, J., Wang, J., Zhu, D., Wu, X."miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer Corrigendum in /10.3892/ijo.2024.5698". International Journal of Oncology 48.1 (2016): 181-190.
Chicago
Tan, H., He, Q., Gong, G., Wang, Y., Li, J., Wang, J., Zhu, D., Wu, X."miR-382 inhibits migration and invasion by targeting ROR1 through regulating EMT in ovarian cancer Corrigendum in /10.3892/ijo.2024.5698". International Journal of Oncology 48, no. 1 (2016): 181-190. https://doi.org/10.3892/ijo.2015.3241
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team