Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
February-2016 Volume 48 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2016 Volume 48 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Decreased expression of the plasminogen activator inhibitor type 1 is involved in degradation of extracellular matrix surrounding cervical cancer stem cells

  • Authors:
    • Masakazu Sato
    • Kei Kawana
    • Katsuyuki Adachi
    • Asaha Fujimoto
    • Mitsuyo Yoshida
    • Hiroe Nakamura
    • Haruka Nishida
    • Tomoko Inoue
    • Ayumi Taguchi
    • Juri Takahashi
    • Satoko Kojima
    • Aki Yamashita
    • Kensuke Tomio
    • Takeshi Nagamatsu
    • Osamu Wada-Hiraike
    • Katsutoshi Oda
    • Yutaka Osuga
    • Tomoyuki Fujii
  • View Affiliations / Copyright

    Affiliations: Department of Obstetrics and Gynecology, Graduate School of Medicine, The University of Tokyo, Hongo, Bunkyo-ku, Tokyo 113-8655, Japan
  • Pages: 829-835
    |
    Published online on: December 9, 2015
       https://doi.org/10.3892/ijo.2015.3283
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The plasminogen activator (PA) system consists of plasminogen activator inhibitor type 1 (PAI-1), urokinase-type plasminogen activator and its receptor (uPA and uPAR). PAI-1 inhibits the activation of uPA (which converts plasminogen to plasmin), and is involved in cancer invasion and metastasis, by remodeling the extracellular matrix (ECM) through regulating plasmin. Cancer stem cells (CSCs) are a small subset of cells within tumors, and are thought to be involved in tumor recurrence and metastasis. Considering these facts, we investigated the relationship between PAI-1 and cervical CSCs. We used ALDH1 as a marker of cervical CSCs. First, we demonstrated that culturing ALDH1-high cells and ALDH-low cells on collagen IV-coted plates increased their expression of active PAI-1 (ELISA), and these increases were suggested to be at mRNA expression levels (RT-qPCR). Secondly, we demonstrated PAI-1 was indeed involved in the ECM maintenance. With gelatin zymography assays, we found that ALDH1-high cells and ALDH-low cells expressed pro-matrix metalloproteinase-2 (pro-MMP-2) irrespective of their coatings. With gelatinase/collagenase assay kit, we confirmed that collagenase activity was increased when ALDH1-low cells were exposed to TM5275, a small molecule inhibitor of PAI-1. Putting the data together, we hypothesized that cancer cells adhered to basal membrane secrete abundant PAI-1, on the other hand, cancer cells (especially CSCs rather than non-CSCs) distant from basal membrane secrete less PAI-1, which makes the ECM surrounding CSCs more susceptible to degradation. Our study could be an explanation of conflicting reports, where some researchers found negative impacts of PAI-1 expression on clinical outcomes and others not, by considering the concept of CSCs.

Introduction

The plasminogen activator (PA) system consists of plasminogen activator inhibitor type 1 (PAI-1), urokinase-type plasminogen activator and its receptor (uPA and uPAR) (1). PAI-1 inhibits the activation of uPA (which converts plasminogen to plasmin), and the PA system is involved in proteolysis (1). Dysregulation of the PA system is related to disorders such as thrombosis, atherosclerosis and type 2 diabetes (2–5). In addition, it has been reported that PAI-1 is involved in cancer invasion and metastasis, by remodeling the extracellular matrix (ECM) through regulating plasmin (6–12). Some studies reported that overexpression of PAI-1 correlated with poor prognosis in cancer patients, however, it is controversial (13–16).

Cancer stem cells (CSCs) are a small subset of cells within tumors and possess abilities similar to normal stem cells; the ability to self-renew and differentiate (17,18). This concept was first demonstrated in leukemia and increasing evidence supports this model in various types of solid tumors including cervical cancer (19–24). CSCs are thought to be involved in tumor recurrence and metastasis; failure to treat CSCs by surgery or chemotherapy would result in relapse (17). Considering these facts, investigating the impact of PAI-1 on CSCs could give insight into CSC features in terms of metastasis.

In this study, we investigated the significance of PAI-1 in CSCs and non-CSCs. In cervical cancer, ALDH1-positive cells, like other solid tumors, are known to be more tumorigenic than negative ones, and we used ALDH1 as a marker of cervical CSCs (25–34). First, using the cervical cancer cell line CaSki we confirmed that the expression of PAI-1 was significantly increased by changing coatings of culture plates as described (35), especially collagen IV-coating, confirmed by enzyme-linked immunosorbent assay (ELISA). These results were also obtained after sorting CaSki cells into ALDH1-high cells and ALDH1-low cells, and in addition, the expression levels themselves in the supernatants from ALDH1-high cells and ALDH1-low cells were different.

Secondly, we investigated the significance of PAI-1 in degradation of the ECM, by investigating gelatin zymography assays and collagenase activity assays. We found that matrix metalloproteinase-2 (MMP-2) was involved, and confirmed that the activity to degrade the ECM was increased by exposing ALDH1-low cells to TM5275 (a small molecule inhibitor of PAI-1). This result was suggestive that PAI-1 was indeed involved in maintaining the ECM, especially around non-CSCs. In conclusion, we investigated the significance of PAI-1 in CSCs and non-CSCs. The expression levels of PAI-1 were different from ALDH1-high cells to ALDH1-low cells, and also different depending on culture plates. Our study could be an explanation of conflicting reports, where some researchers found the impacts of PAI-1 expression on poor clinical outcomes and others not, by considering the concept of CSCs.

Materials and methods

Cell culture

The cervical cancer cell lines CaSki and SiHa were obtained from American Type Culture Collection (ATCC, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM; Wako, Japan) supplemented with 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA) and sub-cultured by 0.25% trypsin/EDTA (Wako) detachment. The cells were grown in a humidified atmosphere at 37°C and 5% CO2.

Coatings

Fibronectin solution, vitronectin solution and laminin solution were purchased from Wako (Cat# 063–05591, 220–02041 and 120–05751, respectively), and were used according to manufacturer's instructions. Collagen I and collagen IV-coated plates were obtained from Corning (Acton, MA, USA).

Reagents

Human PAI-1 peptide was purchased from Abcam (Cambridge, MA, USA). TM5275 was purchased from Axon Medchem (USA).

RNA extraction and RT-quantitative PCR (RT-qPCR)

Total RNA was extracted with Tissue Total RNA kit (Favorgen Biotech Corp., Taiwan) according to manufacturer's protocols. First-strand cDNA was synthesized from 500 ng of total RNA using ReverTra Ace (Toyobo, Japan). qPCR was performed with SYBR Green PCR master mix (Roche) according to manufacturer's instructions. Denaturation was performed at 95°C for 2 min, followed by 35 cycles at 98°C for 10 sec, at 65°C for 10 sec and at 68°C for 10 sec. β-actin was used as a housekeeping gene and the results are presented as fold change relative to β-actin expression (2−ΔΔCt). Each experiment was performed in triplicate. The sequences of the primer pairs used in this study are shown in Table I.

Table I

Primer sequences used in this study.

Table I

Primer sequences used in this study.

Gene namePrimer sequenceSize (bp)
PAI-1 GCACCACAGACGCGATCTT
ACCTCTGAAAAGTCCACTTGC
112
uPA GCCATCCCGGACTATACAGA
AGGCCATTCTCTTCCTTGGT
417
uPAR CTGGAGCTGGTGGAGAAAAG
TGTTGCAGCATTTCAGGAAG
406
β-actin CATGTACGTTGCTATCCAGGC
CTCCTTAATGTCACGCACGAT
250

[i] Gene names and primer sequences (5′-3′) for RT-PCR and qPCR are shown. PAI-1, plasminogen activator inhibitor type 1; uPA, urokinase-type plasminogen activator; uPAR, urokinase-type plasminogen activator receptor.

Enzyme-linked immunosorbent assay (ELISA)

Culture supernatants were assayed for active PAI-1 and active uPA by ELISA kits (Innovation Research Inc., USA, Cat# IHPAIKT and IHUPAKT) according to manufacturer's protocol. Cells (2×105) were seeded into 6-well plates and were cultured for 24 h. After that, medium was switched to DMEM without FBS for 24 h, and then the supernatants were collected. Immediately after collection, these supernatants were centrifuged for 10 min at 300 × g to remove cell debris and were stored at −80°C. For detection of intracellular active PAI-1, cells were permeabilized with 1 ml of 0.5% Triton X-100 for 20 min. Plates were read on an ELISA reader, EPOCH (BioTek, Winooski, VT, USA).

Flow cytometry

The ALDH enzymatic activity of the cells was measured as described previously (34), using the Aldefluor kit (StemCell Technologies, Vancouver, BC, Canada). CaSki cells (5×106 cells) were suspended in Aldefluor assay buffer containing ALDH substrate. The brightly fluorescent ALDH-positive cells were detected using MoFlo XDP (Beckman Coulter, Inc., Brea, CA, USA). As a negative control, cells were stained under identical conditions after treatment with the specific ALDH inhibitor N,N-diethylaminobenzaldehyde (DEAB). After sorting, 1×105 cells were seeded into 6-well plates and were cultured for 24 h. Then medium was changed under each experimental condition. Experiment was repeated at least three times.

Gelatin zymograhpy assays

Gelatin zymography assays (Cosmobio, Japan, Cat# AK45) were performed as previously described (36). Collected supernatants (10 μl) were mixed with 2X sample buffer and electrophoresed according to manufacturer's instructions. Subsequent enzymatic reactions were performed at 37°C for 40 h.

Collagenase activity assays

Collagenase activity was detected with EnzChek Gelatinase/Collagenase Assay kit (Molecular Probes, USA, Cat# E-12055) according to manufacturer's instructions. The supernatant (100 μl) was used, and incubated with DQ gelatin solution for 24 h at room temperature. The fluorescence intensity was measured in a fluorescence microplate reader, Fluoroskan Ascent FL (Thermo Fisher Scientific, Waltham, MA, USA), set for excitation at 485 nm and emission detection at 538 nm. The fluorescence intensity was corrected for background fluorescence by subtracting the value derived from the no-enzyme control. Clostridium collagenase (provided with the kit) was used as a positive control. Experiment was repeated three times.

Statistical analysis

ANOVA test was used for comparing the influence of the ECM. Student t-test was used to compare the means of expression levels of PAI-1. Wilcoxon rank-sum test was used to investigate the effects of TM5275. p-values <0.05 were considered statistically significant. JMP/SAS Institute software was used for statistical analysis.

Results

Expression levels of PAI-1 are significantly different depending on the coating

In advance, we confirmed the expression of PAI-1, uPA and uPAR of CaSki and SiHa by RT-PCR (data not shown). The concentration of active PAI-1 in the supernatants from CaSki and SiHa is shown in Fig. 1A. The expression levels of active PAI-1 in the supernatants from CaSki cells were significantly different depending on the coating, and we selected CaSki cells for further experiment. Besides, we decided to investigate the relationship between collagen IV and PAI-1, because i) We detected high levels of PAI-1 when culturing CaSki cells on collagen IV-coated plates as shown in Fig. 1A. ii) Few studies have investigated the relationship between PAI-1 and collagen IV, while most studies investigated the relationship between PAI-1 and fibronectin, vitronectin and laminin (1,8,11,35). iii) Collagen IV is known to be rich in basal membrane (where cervical cancer occurs) (37), and collagen IV could be important for CSCs. As shown in Fig. 1B, culturing CaSki cells on collagen IV-coated plates increased the expression of PAI-1 at mRNA levels.

Figure 1

Influence of types of coatings on PAI-1 expression. (A) Influence of types of coatings on active PAI-1 expression in the supernatants from CaSki and SiHa. Active PAI-1 levels in the supernatants from CaSki were significantly increased (ELISA). Experiments were performed in duplicate and repeated three times (n=3). The values shown represent the mean ± SE. (B) Influence of collagen IV on PAI-1 mRNA expression of CaSki. Culturing CaSki cells on collagen IV-coted plates increased their expression levels of PAI-1 mRNA (RT-qPCR). Experiments were performed in triplicate and repeated three times (n=3). The values shown represent the mean ± SE. **p<0.01, *p<0.05; n.s., not significant. n.d., not detected. (A) X-axis, non-coating, fibronectin, vitronectin, laminin, collagen I or collagen IV. Y-axis, ng/ml/106 cells. (B) X-axis, non-coating or collagen IV. Y-axis, relative gene expression.

Expression levels of PAI-1 are different from ALDH1-high cells to ALDH1-low cells

We performed the same procedures after sorting CaSki cells into ALDH1-high cells and ALDH1-low cells. As shown in Fig. 2A, culturing ALDH1-high cells and ALDH1-low cells on collagen IV-coated plates increased the expression levels of PAI-1 mRNA. The increase of ALDH1-high cells was statistically significant, and it was suggestive that ALDH1-high cells contributed to the increase of PAI-1 mRNA expression levels (Fig. 1A).

Figure 2

Influence of collagen IV on PAI-1 expression of ALDH1-high cells and ALDH1-low cells. (A) Influence of collagen IV on PAI-1 mRNA expression of ALDH1-high cells and ALDH1-low cells. Culturing ALDH1-high cells on collagen IV-coted plates significantly increased their expression levels of PAI-1 mRNA (RT-qPCR). Experiments were performed in triplicate and repeated four times (n=4). The values shown represent the mean ± SE. (B) Influence of collagen IV on active uPA and active PAI-1 levels in the supernatants from ALDH1-high cells and ALDH1-low cells. Culturing ALDH1-high cells and ALDH1-low cells on collagen IV-coted plates increased their expression of active PAI-1 (ELISA). The expression levels of PAI-1 in the supernatants from ALDH1-low cells cultured on collagen IV-coted plates were significantly higher than those from ALDH1-high cells cultured on both non-coating and collagen IV-coated plates. Experiments were performed in duplicate and repeated six times (n=6). The values shown represent the mean ± SE. (C) Influence of collagen IV on intracellular active PAI-1 levels in ALDH1-high cells and ALDH1-low cells. The patterns of intracellular active PAI-1 levels (ELISA) were similar to the patterns of PAI-1 mRNA expression levels (A). Experiments were performed in duplicate and repeated three times (n=3). The values shown represent the mean ± SE. *p<0.05, n.s.; not significant. n.d.; not detected, N; non-coating, IV; collagen IV. (A) X-axis: ALDH1-high or ALDH1-low and N or IV. Y-axis, relative gene expression. (B) X-axis, ALDH1-high or ALDH1-low, N or IV and uPA or PAI-1. Y-axis: ng/ml/106 cells. (C) X-axis, ALDH1-high or ALDH1-low and N or IV. Y-axis, ng/ml.

PAI-1 plays a role in maintaining the ECM when secreted (1), and we detected secreted active PAI-1 in the supernatants of cultured cells using ELISA. In addition, since the balance of uPA and PAI-1 is important rather than the concentration of PAI-1 itself (1,2,15), we investigated secreted active uPA as well (Fig. 2B). We found that the expression of PAI-1 is higher when cells were cultured on collagen IV-coated plates than when cultured on non-coating plates, and that the expression of PAI-1 of ALDH1-low cells was higher than that of ALDH1-high cells.

Of note, the patterns of secreted PAI-1 and PAI-1 mRNA expression levels were apparently different. In the context of maintaining the ECM, not only active PAI-1 but also many factors, such as non-active PAI-1, uPA, tPA and uPAR, and their combination are important (1,7,10,15,38–40). Considering these facts, the expression levels of PAI-1 mRNA do not have to accord with the concentration of secreted active PAI-1, however, we further detected intracellular active PAI-1 in order to obtain insights into the inconsistency. Of interest, the concentration of intracellular active PAI-1 was similar to the expression patterns of PAI-1 mRNA (Fig. 2A and C). These results can be interpreted as follows: The amount of active PAI-1 is consistent with the expression of PAI-1 mRNA, however, PAI-1 from ALDH1-high cells is more difficult to be secreted than PAI-1 from ALDH1-low cells [due to transportation system or membrane permiability, for instance (41)].

ALDH1-high cells and ALDH1-low cells express pro-MMP-2

We then speculated on the impact of PAI-1 in maintenance of the ECM. With gelatin zymography assays, we investing the ability of each collected supernatant to degrade the general ECM, gelatin. As shown in Fig. 3, each supernatant expressed only pro-MMP2. This result was acceptable since pro-MMP-2 is the substrate of plasmin (1,42), although we could not find significant difference of pro-MMP-2 expression among these conditions.

Figure 3

Results of gelatin zymography assays. Each supernatant expressed only pro-MMP-2. Representative data are shown. Experiments were performed three times. MMP, matrix metalloproteinase; N, non-coating; IV, collagen IV. X-axis, ALDH1-high or ALDH1-low and N or IV. Y-axis, MMP-2, pro-MMP-2 or pro-MMP-9.

Exposing ALDH1-low cells to TM5275, a small molecule inhibitor of PAI-1, increases collagenase activity of the supernatants

In order to quantify the activity of degrading the ECM, we proceeded to perform collagenase activity assays. After sorting, 1×105 cells were seeded and cultured for 24 h. Then, medium was changed to DMEM with or without 10 nM TM5275 for 24 h, and the supernatants were collected (43). As shown in Fig. 4, collagenase activity was increased only when ALDH1-low cells were exposed to TM5275. The intensities ranged from the intensity of 0.02 U/ ml of clostridium collagenase to that of 0.2 U/ml of clostridium collagenase.

Figure 4

Effects of TM5275, a small molecule inhibitor of PAI-1, on collagenase activity. Collagenase activity was significantly increased only when ALDH1-low cells were exposed to 10 nM TM5275 (Wilcoxon rank-sum test). These intensities were ranged from the intensity of 0.02 U/ml of clostridium collagenase to that of 0.2 U/ml of clostridium collagenase (positive control). Experiments were performed in duplicate and repeated three times (n=3). The values shown represent the mean ± SE. *p<0.05; n.s., not significant; N, non-coating; IV, collagen IV. X-axis, ALDH1-high or ALDH1-low, N or IV and TM5275 − or +, Y-axis, arbitrary units.

Discussion

In the present study, we investigated the significance of PAI-1 in cervical CSCs and non-CSCs, and its impact on the ECM maintenance. PAI-1 inhibits the activation of uPA (which converts plasminogen to plasmin), and it is involved in cancer invasion and metastasis, by remodeling the ECM through regulating plasmin (1,6–12). The studies investigating CSCs are now increasing in various types of solid tumors including cervical cancer, and CSCs are thought to be involved in tumor recurrence and metastasis (17,18). Putting these facts together, we aimed to investigate the relationship between PAI-1 and cervical CSCs.

First, using the cervical cancer cell line CaSki we confirmed that the expression levels of PAI-1 were significantly increased when the cells were cultured on collagen IV-coated plates compared to when cultured on non-coated plates, employing ELISA and RT-qPCR. When we use collagen IV as the representative of the ECM, we can put a focus on proteolytic activity of PAI-1 unlike using fibronectin and vitrinectin (non-proteolytic, or direct interaction between PAI-1 and the ECM is known) (1). At the same time, we have to consider the protein downstream of uPA and plasmin such as MMP-2, because the substrate of uPA itself is not collagen IV but fibronectin (44). This is why we performed gelatin zymography assays. With gelatin zymography assays, we found the involvement of pro-MMP-2.

Secondly, we investigated the significance of PAI-1 in maintenance of the ECM, by investigating collagenase activity. We confirmed that the activity to degrade the ECM was increased by exposing ALDH1-low cells to TM5275 (a small molecule inhibitor of PAI-1). On the contrary, adding recombinant PAI-1 (the final concentration of 1 μg/ml), to the supernatants from ALDH1-high cells cultured on non-coating plates, reduced its fluorescence intensity by 7% (data not shown). These results were suggestive that PAI-1 was indeed involved in maintaining the ECM in CSCs and non-CSCs.

The limitation of our experiment is that we could not assess to what extent PAI-1 was involved in maintaining the ECM. The question remains from that we could not show a clear inverse correlation between concentration of PAI-1 and fluorescence intensity (Figs. 2B and 3). This is due to the complexity of the PA system, and considering only PAI-1 would not be enough in the context of degradation of the ECM (10). However, we may say that we shed light on the necessity to consider the concept of CSCs when investigating the PA system.

ALDH1-low cells expressed PAI-1 more highly than ALDH1-high cells (Fig. 2A). PAI-1 is known to be related to senescence, and it is more highly expressed in ‘old cells’ than in ‘young cells’, and ‘more passaged cell line’ than ‘less passaged cell line’ (45–47). Considering the direction of differentiation from ALDH1-high cells to ALDH1-low cells, it is reasonable to think that ALDH1-low cells express PAI-1 more highly than ALDH1-high cells.

Although the increase of PAI-1 expression in the supernatants from SiHa cells when cultured on laminin-coated plates was not statistically significant (Fig. 1A), it is suggestive that PAI-1 is important for the interaction between cancer cells and basal membrane, considering that laminin is a major component of basal membrane of uterine cervix as well as collagen IV (37).

In conclusion, we investigated the significance of PAI-1 in CSCs and non-CSCs. The expression levels of PAI-1 of ALDH1-high and ALDH1-low cells were both increased when cultured on collagen IV-coated plates, however, the basic expression levels of PAI-1 of ALDH1-high were lower than those in ALDH1-low cells. This result was suggestive that the ECM surrounding CSCs (especially distant from basal membrane) is more susceptible to degrade due to its low expression levels of PAI-1 (hypothetic schema from the data we obtained is shown in Fig. 5). Although verification to other kinds of CSC markers, and other types of cancers are needed, our study could be an explanation of conflicting reports, where some researchers found negative impacts of PAI-1 expression on clinical outcomes and others not, by considering the concept of CSCs.

Figure 5

Hypothetic schema from the data we obtained. Cancer cells adhered to basal membrane secrete abundant PAI-1, whereas, cancer cells distant from basal membrane secrete less PAI-1. The concentration of active PAI-1 around CSCs is lower than that around non-CSCs, and the ECM surrounding CSCs is more susceptible to degradation.

Acknowledgements

We are grateful to Stem Cell Laboratory of Medical Research Institute in Tokyo Medical and Dental University, for kind assistance in flow cytometric sorting.

References

1 

Czekay RP, Wilkins-Port CE, Higgins SP, Freytag J, Overstreet JM, Klein RM, Higgins CE, Samarakoon R and Higgins PJ: PAI-1: An integrator of cell signaling and migration. Int J Cell Biol. 2011:5624812011. View Article : Google Scholar : PubMed/NCBI

2 

Jankun J: Plasminogen activator inhibitor-1 in kidney pathology (Review). Int J Mol Med. 31:503–510. 2013.PubMed/NCBI

3 

Klinger KW, Winqvist R, Riccio A, Andreasen PA, Sartorio R, Nielsen LS, Stuart N, Stanislovitis P, Watkins P, Douglas R, et al: Plasminogen activator inhibitor type 1 gene is located at region q21.3-q22 of chromosome 7 and genetically linked with cysticfibrosis. Proc Natl Acad Sci USA. 84:8548–8552. 1987. View Article : Google Scholar

4 

Krause MP, Moradi J, Nissar AA, Riddell MC and Hawke TJ: Inhibition of plasminogen activator inhibitor-1 restores skeletal muscle regeneration in untreated type 1 diabetic mice. Diabetes. 60:1964–1972. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Ricart JM, Ramón LA, Vayá A, España F, Santaolaria ML, Todolí J, Castelló R, Fontcuberta J and Estellés A: Fibrinolytic inhibitor levels and polymorphisms in Behcet disease and their association with thrombosis. Br J Haematol. 141:716–719. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Bajou K, Noël A, Gerard RD, Masson V, Brunner N, Holst-Hansen C, Skobe M, Fusenig NE, Carmeliet P, Collen D, et al: Absence of host plasminogen activator inhibitor 1 prevents cancer invasion and vascularization. Nat Med. 4:923–928. 1998. View Article : Google Scholar : PubMed/NCBI

7 

Fabre-Guillevin E, Malo M, Cartier-Michaud A, Peinado H, Moreno-Bueno G, Vallée B, Lawrence DA, Palacios J, Cano A, Barlovatz-Meimon G, et al: PAI-1 and functional blockade of SNAI1 in breast cancer cell migration. Breast Cancer Res. 10:R1002008. View Article : Google Scholar : PubMed/NCBI

8 

Smit JW, van der Pluijm G, Romijn HA, Löwik CW, Morreau H and Goslings BM: Degradation of extracellular matrix by metastatic follicular thyroid carcinoma cell lines: role of the plasmin activation system. Thyroid. 9:913–919. 1999. View Article : Google Scholar : PubMed/NCBI

9 

Maillard C, Jost M, Rømer MU, Brunner N, Houard X, Lejeune A, Munaut C, Bajou K, Melen L, Dano K, et al: Host plasminogen activator inhibitor-1 promotes human skin carcinoma progression in a stage-dependent manner. Neoplasia. 7:57–66. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Riddick AC, Shukla CJ, Pennington CJ, Bass R, Nuttall RK, Hogan A, Sethia KK, Ellis V, Collins AT, Maitland NJ, et al: Identification of degradome components associated with prostate cancer progression by expression analysis of human prostatic tissues. Br J Cancer. 92:2171–2180. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Vial D and McKeown-Longo PJ: PAI1 stimulates assembly of the fibronectin matrix in osteosarcoma cells through crosstalk between the alphavbeta5 and alpha5beta1 integrins. J Cell Sci. 121:1661–1670. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Woo M, Park K, Nam J and Kim JC: Clinical implications of matrix metalloproteinase-1, -3, -7, -9, -12, and plasminogen activator inhibitor-1 gene polymorphisms in colorectal cancer. J Gastroenterol Hepatol. 22:1064–1070. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Hanekom GS, Stubbings HM and Kidson SH: The active fraction of plasmatic plasminogen activator inhibitor type 1 as a possible indicator of increased risk for metastatic melanoma. Cancer Detect Prev. 26:50–59. 2002. View Article : Google Scholar : PubMed/NCBI

14 

Lara PC, Lloret M, Valenciano A, Clavo B, Pinar B, Rey A and Henríquez-Hernández LA: Plasminogen activator inhibitor-1 (PAI-1) expression in relation to hypoxia and oncoproteins in clinical cervical tumors. Strahlenther Onkol. 188:1139–1145. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Malinowsky K, Wolff C, Berg D, Schuster T, Walch A, Bronger H, Mannsperger H, Schmidt C, Korf U, Höfler H, et al: uPA and PAI-1-related signaling pathways differ between primary breast cancers and lymph node metastases. Transl Oncol. 5:98–104. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Sternlicht MD, Dunning AM, Moore DH, Pharoah PD, Ginzinger DG, Chin K, Gray JW, Waldman FM, Ponder BA and Werb Z: Prognostic value of PAI1 in invasive breast cancer: evidence that tumor-specific factors are more important than genetic variation in regulating PAI1 expression. Cancer Epidemiol Biomarkers Prev. 15:2107–2114. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Meacham CE and Morrison SJ: Tumour heterogeneity and cancer cell plasticity. Nature. 501:328–337. 2013. View Article : Google Scholar : PubMed/NCBI

18 

Reya T, Morrison SJ, Clarke MF and Weissman IL: Stem cells, cancer, and cancer stem cells. Nature. 414:105–111. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Chen X, Rycaj K, Liu X and Tang DG: New insights into prostate cancer stem cells. Cell Cycle. 12:579–586. 2013. View Article : Google Scholar : PubMed/NCBI

20 

Dick JE: Stem cell concepts renew cancer research. Blood. 112:4793–4807. 2008. View Article : Google Scholar : PubMed/NCBI

21 

López J, Valdez-Morales FJ, Benítez-Bribiesca L, Cerbón M and Carrancá AG: Normal and cancer stem cells of the human female reproductive system. Reprod Biol Endocrinol. 11:532013. View Article : Google Scholar : PubMed/NCBI

22 

Skibinski A and Kuperwasser C: The origin of breast tumor heterogeneity. Oncogene. 34:5309–5316. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Triscott J, Rose Pambid M and Dunn SE: Concise review: bullseye: targeting cancer stem cells to improve the treatment of gliomas by repurposing disulfiram. Stem Cells. 33:1042–1046. 2015. View Article : Google Scholar : PubMed/NCBI

24 

Zeki SS, Graham TA and Wright NA: Stem cells and their implications for colorectal cancer. Nat Rev Gastroenterol Hepatol. 8:90–100. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Hirata N, Yamada S, Shoda T, Kurihara M, Sekino Y and Kanda Y: Sphingosine-1-phosphate promotes expansion of cancer stem cells via S1PR3 by a ligand-independent Notch activation. Nat Commun. 5:48062014. View Article : Google Scholar : PubMed/NCBI

26 

Alonso-Alconada L, Muinelo-Romay L, Madissoo K, Diaz-Lopez A, Krakstad C, Trovik J, Wik E, Hapangama D, Coenegrachts L, Cano A, et al: Molecular profiling of circulating tumor cells links plasticity to the metastatic process in endometrial cancer. Mol Cancer. 13:2232014. View Article : Google Scholar : PubMed/NCBI

27 

Ma I and Allan AL: The role of human aldehyde dehydrogenase in normal and cancer stem cells. Stem Cell Rev. 7:292–306. 2011. View Article : Google Scholar

28 

Penumatsa K, Edassery SL, Barua A, Bradaric MJ and Luborsky JL: Differential expression of aldehyde dehydrogenase 1a1 (ALDH1) in normal ovary and serous ovarian tumors. J Ovarian Res. 3:282010. View Article : Google Scholar : PubMed/NCBI

29 

Pisanu ME, Noto A, De Vitis C, Masiello MG, Coluccia P, Proietti S, Giovagnoli MR, Ricci A, Giarnieri E, Cucina A, et al: Lung cancer stem cell lose their stemness default state after exposure to microgravity. Biomed Res Int. 2014:4702532014. View Article : Google Scholar : PubMed/NCBI

30 

Pors K and Moreb JS: Aldehyde dehydrogenases in cancer: An opportunity for biomarker and drug development? Drug Discov Today. 19:1953–1963. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Raha D, Wilson TR, Peng J, Peterson D, Yue P, Evangelista M, Wilson C, Merchant M and Settleman J: The cancer stem cell marker aldehyde dehydrogenase is required to maintain a drug-tolerant tumor cell subpopulation. Cancer Res. 74:3579–3590. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Warrier S, Bhuvanalakshmi G, Arfuso F, Rajan G, Millward M and Dharmarajan A: Cancer stem-like cells from head and neck cancers are chemosensitized by the Wnt antagonist, sFRP4, by inducing apoptosis, decreasing stemness, drug resistance and epithelial to mesenchymal transition. Cancer Gene Ther. 21:381–388. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Watanabe Y, Yoshimura K, Yoshikawa K, Tsunedomi R, Shindo Y, Matsukuma S, Maeda N, Kanekiyo S, Suzuki N, Kuramasu A, et al: A stem cell medium containing neural stimulating factor induces a pancreatic cancer stem-like cell-enriched population. Int J Oncol. 45:1857–1866. 2014.PubMed/NCBI

34 

Liu SY and Zheng PS: High aldehyde dehydrogenase activity identifies cancer stem cells in human cervical cancer. Oncotarget. 4:2462–2475. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Isogai C, Laug WE, Shimada H, Declerck PJ, Stins MF, Durden DL, Erdreich-Epstein A and DeClerck YA: Plasminogen activator inhibitor-1 promotes angiogenesis by stimulating endothelial cell migration toward fibronectin. Cancer Res. 61:5587–5594. 2001.PubMed/NCBI

36 

Taguchi A, Kawana K, Tomio K, Yamashita A, Isobe Y, Nagasaka K, Koga K, Inoue T, Nishida H, Kojima S, et al: Matrix metalloproteinase (MMP)-9 in cancer-associated fibroblasts (CAFs) is suppressed by omega-3 polyunsaturated fatty acids in vitro and in vivo. PLoS One. 9:e896052014. View Article : Google Scholar : PubMed/NCBI

37 

Goldberg I, Davidson B, Lerner-Geva L, Gotlieb WH, Ben-Baruch G, Novikov I and Kopolovic J: Expression of extracellular matrix proteins in cervical squamous cell carcinoma - a clinicopathological study. J Clin Pathol. 51:781–785. 1998. View Article : Google Scholar

38 

Han B, Nakamura M, Zhou G, Ishii A, Nakamura A, Bai Y, Mori I and Kakudo K: Calcitonin inhibits invasion of breast cancer cells: Involvement of urokinase-type plasminogen activator (uPA) and uPA receptor. Int J Oncol. 28:807–814. 2006.PubMed/NCBI

39 

Hildenbrand R and Schaaf A: The urokinase-system in tumor tissue stroma of the breast and breast cancer cell invasion. Int J Oncol. 34:15–23. 2009.

40 

Roomi MW, Kalinovsky T, Niedzwiecki A and Rath M: Modulation of uPA, MMPs and their inhibitors by a novel nutrient mixture in human glioblastoma cell lines. Int J Oncol. 45:887–894. 2014.PubMed/NCBI

41 

Chung CL, Sheu JR, Liu HE, Chang SC, Chou YC, Chen WL, Chou DS and Hsiao G: Dynasore, a dynamin inhibitor, induces PAI-1 expression in MeT-5A human pleural mesothelial cells. Am J Respir Cell Mol Biol. 40:692–700. 2009. View Article : Google Scholar

42 

Baramova EN, Bajou K, Remacle A, L'Hoir C, Krell HW, Weidle UH, Noel A and Foidart JM: Involvement of PA/plasmin system in the processing of pro-MMP-9 and in the second step of pro-MMP-2 activation. FEBS Lett. 405:157–162. 1997. View Article : Google Scholar : PubMed/NCBI

43 

Izuhara Y, Yamaoka N, Kodama H, Dan T, Takizawa S, Hirayama N, Meguro K, van Ypersele de Strihou C and Miyata T: A novel inhibitor of plasminogen activator inhibitor-1 provides antithrombotic benefits devoid of bleeding effect in nonhuman primates. J Cereb Blood Flow Metab. 30:904–912. 2010. View Article : Google Scholar : PubMed/NCBI

44 

Marchina E and Barlati S: Degradation of human plasma and extracellular matrix fibronectin by tissue type plasminogen activator and urokinase. Int J Biochem Cell Biol. 28:1141–1150. 1996. View Article : Google Scholar : PubMed/NCBI

45 

Ota H, Akishita M, Eto M, Iijima K, Kaneki M and Ouchi Y: Sirt1 modulates premature senescence-like phenotype in human endothelial cells. J Mol Cell Cardiol. 43:571–579. 2007. View Article : Google Scholar : PubMed/NCBI

46 

Calvanese V, Lara E, Suárez-Alvarez B, Abu Dawud R, Vázquez-Chantada M, Martínez-Chantar ML, Embade N, López-Nieva P, Horrillo A, Hmadcha A, et al: Sirtuin 1 regulation of developmental genes during differentiation of stem cells. Proc Natl Acad Sci USA. 107:13736–13741. 2010. View Article : Google Scholar : PubMed/NCBI

47 

Wan YZ, Gao P, Zhou S, Zhang ZQ, Hao DL, Lian LS, Li YJ, Chen HZ and Liu DP: SIRT1-mediated epigenetic downregulation of plasminogen activator inhibitor-1 prevents vascular endothelial replicative senescence. Aging Cell. 13:890–899. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Sato M, Kawana K, Adachi K, Fujimoto A, Yoshida M, Nakamura H, Nishida H, Inoue T, Taguchi A, Takahashi J, Takahashi J, et al: Decreased expression of the plasminogen activator inhibitor type 1 is involved in degradation of extracellular matrix surrounding cervical cancer stem cells. Int J Oncol 48: 829-835, 2016.
APA
Sato, M., Kawana, K., Adachi, K., Fujimoto, A., Yoshida, M., Nakamura, H. ... Fujii, T. (2016). Decreased expression of the plasminogen activator inhibitor type 1 is involved in degradation of extracellular matrix surrounding cervical cancer stem cells. International Journal of Oncology, 48, 829-835. https://doi.org/10.3892/ijo.2015.3283
MLA
Sato, M., Kawana, K., Adachi, K., Fujimoto, A., Yoshida, M., Nakamura, H., Nishida, H., Inoue, T., Taguchi, A., Takahashi, J., Kojima, S., Yamashita, A., Tomio, K., Nagamatsu, T., Wada-Hiraike, O., Oda, K., Osuga, Y., Fujii, T."Decreased expression of the plasminogen activator inhibitor type 1 is involved in degradation of extracellular matrix surrounding cervical cancer stem cells". International Journal of Oncology 48.2 (2016): 829-835.
Chicago
Sato, M., Kawana, K., Adachi, K., Fujimoto, A., Yoshida, M., Nakamura, H., Nishida, H., Inoue, T., Taguchi, A., Takahashi, J., Kojima, S., Yamashita, A., Tomio, K., Nagamatsu, T., Wada-Hiraike, O., Oda, K., Osuga, Y., Fujii, T."Decreased expression of the plasminogen activator inhibitor type 1 is involved in degradation of extracellular matrix surrounding cervical cancer stem cells". International Journal of Oncology 48, no. 2 (2016): 829-835. https://doi.org/10.3892/ijo.2015.3283
Copy and paste a formatted citation
x
Spandidos Publications style
Sato M, Kawana K, Adachi K, Fujimoto A, Yoshida M, Nakamura H, Nishida H, Inoue T, Taguchi A, Takahashi J, Takahashi J, et al: Decreased expression of the plasminogen activator inhibitor type 1 is involved in degradation of extracellular matrix surrounding cervical cancer stem cells. Int J Oncol 48: 829-835, 2016.
APA
Sato, M., Kawana, K., Adachi, K., Fujimoto, A., Yoshida, M., Nakamura, H. ... Fujii, T. (2016). Decreased expression of the plasminogen activator inhibitor type 1 is involved in degradation of extracellular matrix surrounding cervical cancer stem cells. International Journal of Oncology, 48, 829-835. https://doi.org/10.3892/ijo.2015.3283
MLA
Sato, M., Kawana, K., Adachi, K., Fujimoto, A., Yoshida, M., Nakamura, H., Nishida, H., Inoue, T., Taguchi, A., Takahashi, J., Kojima, S., Yamashita, A., Tomio, K., Nagamatsu, T., Wada-Hiraike, O., Oda, K., Osuga, Y., Fujii, T."Decreased expression of the plasminogen activator inhibitor type 1 is involved in degradation of extracellular matrix surrounding cervical cancer stem cells". International Journal of Oncology 48.2 (2016): 829-835.
Chicago
Sato, M., Kawana, K., Adachi, K., Fujimoto, A., Yoshida, M., Nakamura, H., Nishida, H., Inoue, T., Taguchi, A., Takahashi, J., Kojima, S., Yamashita, A., Tomio, K., Nagamatsu, T., Wada-Hiraike, O., Oda, K., Osuga, Y., Fujii, T."Decreased expression of the plasminogen activator inhibitor type 1 is involved in degradation of extracellular matrix surrounding cervical cancer stem cells". International Journal of Oncology 48, no. 2 (2016): 829-835. https://doi.org/10.3892/ijo.2015.3283
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team