Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular and Clinical Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9450 Online ISSN: 2049-9469
Journal Cover
December-2017 Volume 7 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2017 Volume 7 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association between genetic polymorphisms of long non‑coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population

  • Authors:
    • Hedieh Sattarifard
    • Mohammad Hashemi
    • Shekoofeh Hassanzarei
    • Behzad Narouie
    • Gholamreza Bahari
  • View Affiliations / Copyright

    Affiliations: Cellular and Molecular Research Center, School of Medicine, Zahedan University of Medical Sciences, Zahedan 98167‑43181, Iran, Department of Clinical Biochemistry, School of Medicine, Zahedan University of Medical Sciences, Zahedan 98167‑43181, Iran, Urology and Nephrology Research Center, Department of Urology, Shahid Labbafinejad Medical Center, Shahid Beheshti University of Medical Sciences, Tehran 198396‑3113, Iran
  • Pages: 1152-1158
    |
    Published online on: October 18, 2017
       https://doi.org/10.3892/mco.2017.1462
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to determine whether there is an association between the long non‑coding RNA (lncRNA) prostate cancer‑associated non‑coding RNA 1 (PRNCR1) polymorphisms and prostate cancer (PCa) risk in a sample of the Iranian population. This case‑control study was performed on 178 patients with PCa and 180 subjects with benign prostatic hyperplasia (BPH). Genotyping assay was performed by polymerase chain reaction‑restriction fragment length polymorphism. The findings indicated that the GG genotype of the rs13252298 A>G variant significantly increased the risk of PCa (odds ratio=3.49, 95% confidence interval: 1.79‑6.81, P=0.0001) compared with AA+AG. As regards the rs1456315 G>A polymorphism, the AG genotype and G allele significantly increased the risk of PCa. As regards the rs7841060 T>G variant, the findings demonstrated that this TG genotype and the G allele significantly increased the risk of PCa. The rs7007694 T>C variant was not found to be associated with the risk of PCa. Haplotype analysis indicated that GTGA and GTGG significantly increased the risk of PCa compared with rs1456315A/rs7007694T/rs7841060T/rs13252298G (ATTG). The PRNCR1 variants were not found to be significantly associated with the clinicopathological characteristics of PCa patients. In conclusion, our findings support an association between PRNCR1 variants and the risk of PCa in a sample of the Iranian population.

Introduction

Prostate cancer (PCa) is one of the most frequently diagnosed cancers in men and the sixth leading cause of cancer-related mortality among men worldwide (1). The prevalence of PCa differs significantly among populations, indicating that the host's genetic background may play an important role in susceptibility to PCa (2). Single-nucleotide polymorphisms (SNPs) are the most common type of genetic variations in human genome, and they have been found to be associated with the risk of PCa (3–6). Genome tiling arrays have indicated that 1% of the human genome is composed of protein-coding sequences and ~4–9% of the sequences of the human genome are transcribed to non-coding RNAs (ncRNAs) (7).

NcRNAs are documented to be the main regulators of a number of biological processes, such as transcription, splicing, translation, epigenetic gene expression, cell cycle (8–12), stem cell pluripotency and reprogramming (12,13), embryogenesis (14), and regulation of the immune response (15). They are divided into small ncRNAs (<200 nt) and long ncRNAs (lncRNAs; >200 nt) (16,17). LncRNAs are classified according to the correlation between their location and the location of the corresponding protein-coding gene, such as sense, antisense, intergenic, intronic and bidirectional lncRNAs (18,19). Aberrant expression of lncRNAs may contribute to the development and progression of various cancers (20–25).

The lncRNA prostate cancer-associated non-coding RNA 1 (PRNCR1), also referred to as PCAT8 and CARLo3, is mapped to 8q24.21 (26). It has been stated that PRNCR1 is upregulated in PCa and is involved in PCa development by modulating androgen receptor (AR) activity (27). Binding of PRNCR1 to the acetylated AR and its association with DOT1L recruit a second lncRNA, PCGEM1, to the DOT1L-mediated methylated N-terminus of the AR (27). The interactions of these overexpressed lncRNAs may serve as important regulators in PCa.

To date, certain studies have investigated the impact of PRNCR1 polymorphisms on the risk of various cancers, including prostate (26,28–30), gastric (31,32) and colorectal cancer (33).

PRNCR1 variants that were identified as potential risk factors for cancer were selected (26,28–30,34,35). Genetic risk factors for cancer may vary among diverse populations. Consequently, repeating previously reported genetic associations in other populations is necessary to determine the genetic risk in each population. To the best of our knowledge, there has yet been no study investigating the effect of PRNCR1 variants on cancer risk in the Iranian population. Therefore, the aim of the present study was to determine whether there is an association between the PRNCR1 rs13252298, rs1456315, rs7841060 and rs7007694 polymorphisms and the risk of PCa in a sample of the Iranian population.

Patients and methods

Patients

In total, 358 subjects participated in this hospital-based case-control study, including 178 unrelated men with histopathologically confirmed prostate cancer and 180 age-matched unrelated men with benign prostatic hyperplasia (BPH), with no history of any type of cancer, as the control group (36–39). All cases and controls were selected from a university-affiliated referral center (Shahid Labbafinejad Medical Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran). The local Ethics Committee of Zahedan University of Medical Sciences approved the project (IR.ZAUMS.REc.1395.102), and written informed consent was obtained from all the participants. Genomic DNA was extracted by the salting out method and stored at −20°C until use. Peripheral blood samples were collected in tubes containing EDTA and genomic DNA was extracted by the salting out method.

Genotyping

The polymerase chain reaction (PCR)-restriction fragment length polymorphism assay was used for genotyping of the PRNCR1 rs13252298, rs1456315, rs7841060, and rs7007694 polymorphisms. The primer sequences, restriction enzymes and the length of the PCR products are listed in Table I. PCR was performed with the commercially available prime Taq Premix (Genet Bio, Daejeon, Korea) according to the manufacturer's recommended protocol. Into each 0.20-ml PCR reaction tube, 1 µl of genomic DNA (100 ng/ml), 1 µl of each primer (10 µM), 7 µl of 2X master mix and 6 µl of ddH2O were added. Amplification was performed with an initial denaturation at 95°C for 30 sec, followed by 30 cycles of 30 sec at 95°C, 30 sec at 62°C for rs13252298, 60°C for rs1456315, 56°C for rs7841060, and 64°C for rs7007694, 72°C for 30 sec, with a final extension step at 72°C for 10 min. Subsequently, 10 µl of the PCR products were digested with the appropriate restriction enzymes (Table I). The digested products were separated by agarose gel electrophoresis, visualized by a UV transilluminator and photographed (Fig. 1).

Figure 1.

Electrophoresis pattern of the mismatch polymerase chain reaction-restriction fragment length polymorphism method for the detection of PRNCR1 polymorphisms (A) rs13252298 A>G and (B) rs1456315 G>A, (C) rs7841060 T>G and (D) rs7007694 T>C. (A) For rs13252298 A>G, M: DNA marker; lanes 1 and 4: AG; lanes 2 and 5: AA; lanes 3 and 6: GG. (B) For rs1456315 G>A, M: DNA marker; lanes 1, 3, 5, and 7: GA; lanes 2, 4, 6, and 8: AA. (C) For rs7841060 T>G, M: DNA marker; lanes 1, and 3: TT; lanes 2, and 4: TG. (D) For rs7007694 T>C, M: DNA marker; lanes 1, and 4: TC; lanes 2, 3, and 5: TC. PRNCR1, prostate cancer-associated non-coding RNA 1.

Table I.

Primer sequences for detection of PRNCR1 by PCR-RFLP.

Table I.

Primer sequences for detection of PRNCR1 by PCR-RFLP.

PRNCR1 SNPsPCR primers (5′→3′)Restriction enzymeFragment length (bp)
rs13252298 A>GF: CAGCACTTGCTGTCTTCTCAGATACgATEcoRVAA:196+28
R: TACTCCCCAATCTCTGGTCTTACCT AG:224+196+28
GG:224
rs1456315 G>AF: TTGCATTACCTCAACTAAGCCAAGAccIGG:213+30
R: GGATGAAGAACTGAGGTTGCTAATAAGTC GA:243+213+30
AA:243
rs7841060 T>GF: CACCAATCCCAGAGCCATTTTGTRsaITT:225
R: CATTTCTCAGGTAGACCATGAACCTCGTA TG:225+197+28
GG:197+28
rs7007694 T>CF: GCGAATGCCATTTGTTTGGACGBstuITT:222
R: CCTCCAAAGAGAAGAACGGCT TC:222+200+22
CC:200+22

[i] PRNCR1, prostate cancer-associated non-coding RNA 1; PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism; SNP, single-nucleotide polymorphism; F, forward; R, reverse.

Statistical analysis

All data were analyzed using the statistical package SPSS 22.0 software (IBM Corp., Armonk, NY, USA). The continuous and categorical data were analyzed by the independent samples t-test and χ2 test, respectively. The association among polymorphisms and PCa was calculated by computing the odds ratio (OR) and 95% confidence interval (95% CI) from unconditional logistic regression analyses. Haplotype analysis was performed using SNPStats software (40). The level of statistical significance was set at P<0.05.

Results

Genotypes and allele frequencies of PRNCR1 polymorphisms

The present study included 178 PCa patients with a mean age ± standard deviation of 61.53±6.91 years, and 180 patients with BPH with a mean age of 62.40±7.64 years. No significant difference was found between the groups in terms of age (P=0.258). The genotypes and allele frequencies of PRNCR1 polymorphisms in cases and controls are presented in Table II. As regards the rs13252298 A>G variant, our findings demonstrated that this variant significantly increased the risk of PCa in the recessive (OR=3.49, 95% CI: 1.79–6.81, P=0.0001, GG vs. AA+AG) inheritance model. As regards the rs1456315 A>G polymorphism, the AG genotype as well as the G allele significantly increased the risk of PCa (OR=5.16, 95% CI: 3.16–8.41, P<0.0001 and OR=2.20, 95% CI: 1.60–3.03, P<0.0001, respectively). The TG genotype as well as the G allele of the rs7841060 variant significantly increased the risk of PCa (OR=5.14, 95% CI: 3.15–8.37, P<0.0001 and OR=2.37, 95% CI: 1.71–3.26, P<0.0001, respectively). Our findings demonstrated that the rs7007694 T>C polymorphism was not significantly associated with the risk of PCa. A haplotype analysis was performed, and the findings indicated that GTGA and GTGG significantly increased the risk of PCa compared with rs1456315A/rs7007694T/rs7841060T/rs13252298G (ATTG) (Table III).

Table II.

The genotype and allele frequencies of PRNCR1 polymorphisms in PCa patients and controls with benign prostatic hyperplasia.

Table II.

The genotype and allele frequencies of PRNCR1 polymorphisms in PCa patients and controls with benign prostatic hyperplasia.

PolymorphismsPCa, n (%)Controls, n (%)OR (95% CI)P-value
rs13252298 A>G
  Codominant
  AA33 (18.6)25 (14.0)1.00–
  AG107 (60.1)141 (78.8)0.57 (0.32–1.04)0.078
  GG38 (21.3)13 (7.2)2.21 (0.98–5.01)0.070
  Dominant
  AA33 (18.5)25 (14.0)1.00–
  AG+GG145 (81.4)154 (86.0)0.71 (0.40–1.26)0.254
  Recessive
  AA+AG140 (78.7)167 (92.8)1.00–
  GG38 (21.3)13 (7.2)3.49 (1.79–6.81)0.0001
  Allele
  A173 (48.6)191 (53.4)1.00–
  G183 (51.4)167 (46.6)1.21 (0.90–1.62)0.231
rs1456315 A>G
  AA30 (16.9)92 (51.1)1.00–
  AG148 (83.1)88 (48.9)5.16 (3.16–8.41)<0.0001
  GG0 (0.0)0 (0.0)––
  A208 (58.4)272 (75.6)1.00–
  G148 (41.6)88 (24.4)2.20 (1.60–3.03)<0.0001
rs7841060 T>G
  TT29 (16.3)96 (53.3)1.00–
  TG149 (83.7)84 (46.7)5.14 (3.15–8.37)<0.0001
  GG0 (0.0)0 (0.0)––
  T207 (58.1)276 (76.6)1.00–
  G149 (41.9)84 (23.4)2.37 (1.71–3.26)<0.0001
rs7007694 T>C
  TT150 (84.3)139 (77.2)1.00–
  TC28 (15.7)41 (22.8)0.63 (0.37–1.08)0.108
  CC0 (0.0)0 (0.0)––
  T328 (92.1)319 (88.6)1.00–
  C28 (7.9)41 (11.4)0.66 (0.40–1.10)0.128

[i] PCa, prostate cancer; PRNCR1, prostate cancer-associated non-coding RNA 1; OR, odds ratio; CI, confidence interval.

Table III.

Haplotype association of PRNCR1 polymorphisms with PCa risk.

Table III.

Haplotype association of PRNCR1 polymorphisms with PCa risk.

rs1456315rs7007694rs7841060rs13252298Controls (frequency)PCa (frequency)OR (95% CI)P-value
ATTG0.38280.33671.00–
ATTA0.2270.19871.29 (0.60–2.79)0.52
GTGA0.1460.22935.09 (2.45–10.59)<0.0001
GTGG0.03030.147318.85 (4.93–72.00)<0.0001
ACTG0.04920.02930.82 (0.16–4.17)0.81
ACTA0.04960.0110.85 (0.21–3.37)0.81
GTTA0.0530.00310.21 (0.02–1.74)0.15
ATGA0.0470.00620.61 (0.15–2.52)0.49

[i] PRNCR1, prostate cancer-associated non-coding RNA 1; PCa, prostate cancer; OR, odds ratio; CI, confidence interval.

Association between clinicopathological characteristics and PRNCR1 polymorphisms

The associations between clinicopathological characteristics, including age, stage, prostate-specific antigen (PSA) levels, Gleason score, perineural invasion and surgical margin, and PRNCR1 polymorphisms are shown in Table IV. The findings did not support an association between PRNCR1 polymorphisms and the clinicopathological characteristics of PCa patients.

Table IV.

Association of PRNCR1 polymorphisms with clinicopathological characteristics of PCa patients.

Table IV.

Association of PRNCR1 polymorphisms with clinicopathological characteristics of PCa patients.

rs13252298 rs1456315 rs7841060 rs7007694




CharacteristicsAAAGGGP-valueAAAGP-valueTTTGP-valueTTTCP-value
Age at diagnosis (years), n 0.276 0.275 0.373 0.935
  ≤65277227 24102 23103 10620
  >65  63511   6  46   6  46   44  8
Stage 0.770 0.107 0.144 0.361
  pT1  2  3  3   3  5   3  5   8  0
  pT2a  717  3   6  21   6  21   23  4
  pT2b  1  7  3   0  11   0  11   10  1
  pT2c164819 13  70 14  69   6518
  pT3a  3  9  2   0  14   0  14   12  2
  pT3b  423  8   8  27   6  29   32  3
PSA at diagnosis (ng/ml), n 0.279 0.571 0.797 0.769
  ≤4  1  0  1   0  2   0  2   2  0
  4–10174922 13  75 14  74   7315
  >10155715 17  70 15  72   7413
Gleason score, n 0.462 0.150 0.483 0.806
  ≤7267932 20117 21116 11621
  >7  726  6 10  30   8  32   33  7
Perineural invasion, n 0.576 0.838 0.680 0.836
  Positive226721 18  92 17  93   9218
  Negative113917 12  55 12  55   5710
Surgical margin, n 0.690 0.839 0.679 0.292
  Positive124413 11  58 10  59   61  8
  Negative216225 19  89 19  89   8820

[i] PRNCR1, prostate cancer-associated non-coding RNA 1; PCa, prostate cancer; PSA, prostate-specific antigen.

The Hardy-Weinberg equilibrium (HWE) was calculated and the findings revealed that the genotype distribution in controls was not in HWE.

Discussion

LncRNAs are involved in tumorigenesis through their function as proto-oncogenes (41) or tumor-suppressor genes (42). Androgen receptor, a member of the nuclear receptor family, is a ligand-activated transcription factor (43). It has been suggested that lncRNA PRNCR1 promotes prostate carcinogenesis via activating AR (26). SNPs, a class of genetic variations, are commonly used in the prediction of cancer risk (38,44,45), prognosis (46) and clinical outcome (47). Cumulative evidence indicates that non-coding genes may be involved in gene expression complexity in humans (48,49). Abnormal expression of lncRNAs has been found to be associated with the development of numerous cancers (50–52). Genome-wide association studies suggested significant and consistent associations of multiple genetic polymorphisms on chromosome 8q24 with PCa susceptibility (53–58). To date, several studies investigated the effect of PRNCR1 polymorphisms on the risk of PCa (26,28–30). However, to the best of our knowledge, no study investigating the impact of PRNCR1 variants on cancer risk in an Iranian population has been conducted to date. The present study aimed to evaluate the possible association between rs13252298, rs1456315, rs7841060 and rs7007694 polymorphisms of PRNCR1 and the risk of PCa in a sample of Iranian population.

Our findings suggested that the PRNCR1 rs13252298, rs1456315 and rs7841060 polymorphisms are significantly associated with increased risk of PCa in our population.

In a meta-analysis performed by Chu et al (34), the rs1016343 and rs16901946 variants of PRNCR1 were found to significantly increase the risk of cancer; however, their findings did not support a significant association of the rs13252298, rs7007694 and rs1456315 polymorphisms with cancer risk. Another meta-analysis conducted by Lv et al (35) also revealed that two polymorphisms (rs1016343 and rs16901946) of PRNCR1 were associated with increased cancer risk.

LncRNAs, a new class of functional ncRNAs, are composed of >200 nucleotides and lack protein-coding ability (19). LncRNAs potentially interact with DNA, RNA, as well as protein molecules, to perform diverse regulatory functions, including chromatin remodelling (59), RNA splicing and editing (60), translational inhibition (61), mRNA destruction (62) and epigenetic regulation of gene expression (63–65). The most important function of lncRNAs is involvement in the transcriptional or post-transcriptional regulation of gene expression (66). Abnormal expression of lncRNAs may facilitate tumor cell proliferation, invasion and metastasis (67–70).

There were certain limitations to the present study, including the number of SNPs that were investigated for the PRNCR1 gene, as well as lack of the information regarding survival outcomes and the patients' response to treatment. The reason for the deviation from HWE in our population was not clear; it may be attributed to genetic drift.

In conclusion, our findings indicated that the PRNCR1 rs13252298, rs1456315 and rs7841060 polymorphisms may be a biomarker for PCa development in a sample of the Iranian population. However, further studies should be performed on PCa and other cancers in different ethnicities with larger sample sizes to fully elucidate the association between PRNCR1 polymorphisms and cancer risk. In addition, the impact of genetic variants on the expression profile of PRNCR1 should be considered in future studies.

Acknowledgements

The authors would like to thank all the subjects who willingly participated in the study. This project was funded by a dissertation grant (MSc thesis of HS no. 7832) from Zahedan University of Medical Sciences, Zahedan, Iran.

References

1 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Hsing AW and Devesa SS: Trends and patterns of prostate cancer: What do they suggest? Epidemiol Rev. 23:3–13. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Huang Q, Whitington T, Gao P, Lindberg JF, Yang Y, Sun J, Väisänen MR, Szulkin R, Annala M, Yan J, et al: A prostate cancer susceptibility allele at 6q22 increases RFX6 expression by modulating HOXB13 chromatin binding. Nat Genet. 46:126–135. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Hazelett DJ, Rhie SK, Gaddis M, Yan C, Lakeland DL and Coetzee SG: Ellipse/GAME-ON consortium; Practical consortium, Henderson BE, Noushmehr H, et al: Comprehensive functional annotation of 77 prostate cancer risk loci. PLoS Genet. 10:e10041022014. View Article : Google Scholar : PubMed/NCBI

5 

Spisák S, Lawrenson K, Fu Y, Csabai I, Cottman RT, Seo JH, Haiman C, Han Y, Lenci R, Li Q, et al: CAUSEL: An epigenome- and genome-editing pipeline for establishing function of noncoding GWAS variants. Nat Med. 21:1357–1363. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Chen H, Yu H, Wang J, Zhang Z, Gao Z, Chen Z, Lu Y, Liu W, Jiang D, Zheng SL, et al: Systematic enrichment analysis of potentially functional regions for 103 prostate cancer risk-associated loci. Prostate. 75:1264–1276. 2015. View Article : Google Scholar : PubMed/NCBI

7 

ENCODE Project Consortium, . Birney E, Stamatoyannopoulos JA, Dutta A, Guigó R, Gingeras TR, Margulies EH, Weng Z, Snyder M, Dermitzakis ET, et al: Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature. 447:799–816. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Groß S, Immel UD, Klintschar M and Bartel F: Germline genetics of the p53 pathway affect longevity in a gender specific manner. Curr Aging Sci. 7:91–100. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Kino T, Hurt DE, Ichijo T, Nader N and Chrousos GP: Noncoding RNA gas5 is a growth arrest- and starvation-associated repressor of the glucocorticoid receptor. Sci Signal. 3:ra82010. View Article : Google Scholar : PubMed/NCBI

10 

Brannan CI, Dees EC, Ingram RS and Tilghman SM: The product of the H19 gene may function as an RNA. Mol Cell Biol. 10:28–36. 1990. View Article : Google Scholar : PubMed/NCBI

11 

Chen B, Yu M, Chang Q, Lu Y, Thakur C, Ma D, Yi Z and Chen F: Mdig de-represses H19 large intergenic non-coding RNA (lincRNA) by down-regulating H3K9me3 and heterochromatin. Oncotarget. 4:1427–1437. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Ma L, Bajic VB and Zhang Z: On the classification of long non-coding RNAs. RNA Biol. 10:925–933. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Fatica A and Bozzoni I: Long non-coding RNAs: New players in cell differentiation and development. Nat Rev Genet. 15:7–21. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Grote P and Herrmann BG: The long non-coding RNA Fendrr links epigenetic control mechanisms to gene regulatory networks in mammalian embryogenesis. RNA Biol. 10:1579–1585. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Li Z and Rana TM: Decoding the noncoding: Prospective of lncRNA-mediated innate immune regulation. RNA Biol. 11:979–985. 2014. View Article : Google Scholar : PubMed/NCBI

16 

Bartel DP: MicroRNAs: Target recognition and regulatory functions. Cell. 136:215–233. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Mattick JS: RNA regulation: A new genetics? Nat Rev Genet. 5:316–323. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H, Guernec G, Martin D, Merkel A, Knowles DG, et al: The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression. Genome Res. 22:1775–1789. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Ponting CP, Oliver PL and Reik W: Evolution and functions of long noncoding RNAs. Cell. 136:629–641. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Lin R, Maeda S, Liu C, Karin M and Edgington TS: A large noncoding RNA is a marker for murine hepatocellular carcinomas and a spectrum of human carcinomas. Oncogene. 26:851–858. 2007. View Article : Google Scholar : PubMed/NCBI

21 

Pei Z, Du X, Song Y, Fan L, Li F, Gao Y, Wu R, Chen Y, Li W, Zhou H, et al: Down-regulation of lncRNA CASC2 promotes cell proliferation and metastasis of bladder cancer by activation of the Wnt/β-catenin signaling pathway. Oncotarget. 8:18145–18153. 2017.PubMed/NCBI

22 

Li T, Xu C, Cai B, Zhang M, Gao F and Gan J: Expression and clinicopathological significance of the lncRNA HOXA11-AS in colorectal cancer. Oncol Lett. 12:4155–4160. 2016.PubMed/NCBI

23 

He A, Chen Z, Mei H and Liu Y: Decreased expression of LncRNA MIR31HG in human bladder cancer. Cancer Biomark. 17:231–236. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Pibouin L, Villaudy J, Ferbus D, Muleris M, Prospéri MT, Remvikos Y and Goubin G: Cloning of the mRNA of overexpression in colon carcinoma-1: A sequence overexpressed in a subset of colon carcinomas. Cancer Genet Cytogenet. 133:55–60. 2002. View Article : Google Scholar : PubMed/NCBI

25 

Calin GA, Liu CG, Ferracin M, Hyslop T, Spizzo R, Sevignani C, Fabbri M, Cimmino A, Lee EJ, Wojcik SE, et al: Ultraconserved regions encoding ncRNAs are altered in human leukemias and carcinomas. Cancer Cell. 12:215–229. 2007. View Article : Google Scholar : PubMed/NCBI

26 

Chung S, Nakagawa H, Uemura M, Piao L, Ashikawa K, Hosono N, Takata R, Akamatsu S, Kawaguchi T, Morizono T, et al: Association of a novel long non-coding RNA in 8q24 with prostate cancer susceptibility. Cancer Sci. 102:245–252. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Yang L, Lin C, Jin C, Yang JC, Tanasa B, Li W, Merkurjev D, Ohgi KA, Meng D, Zhang J, et al: lncRNA-dependent mechanisms of androgen-receptor-regulated gene activation programs. Nature. 500:598–602. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Hui J, Xu Y, Yang K, Liu M, Wei D, Wei D, Zhang Y, Shi XH, Yang F, Wang N, et al: Study of genetic variants of 8q21 and 8q24 associated with prostate cancer in Jing-Jin residents in northern China. Clin Lab. 60:645–652. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Zheng SL, Hsing AW, Sun J, Chu LW, Yu K, Li G, Gao Z, Kim ST, Isaacs WB, Shen MC, et al: Association of 17 prostate cancer susceptibility loci with prostate cancer risk in Chinese men. Prostate. 70:425–432. 2010.PubMed/NCBI

30 

Salinas CA, Kwon E, Carlson CS, Koopmeiners JS, Feng Z, Karyadi DM, Ostrander EA and Stanford JL: Multiple independent genetic variants in the 8q24 region are associated with prostate cancer risk. Cancer Epidemiol Biomarkers Prev. 17:1203–1213. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Li L, Jia F, Bai P, Liang Y, Sun R, Yuan F, Zhang L and Gao L: Association between polymorphisms in long non-coding RNA PRNCR1 in 8q24 and risk of gastric cancer. Tumour Biol. 37:299–303. 2016. View Article : Google Scholar : PubMed/NCBI

32 

He BS, Sun HL, Xu T, Pan YQ, Lin K, Gao TY, Zhang ZY and Wang SK: Association of genetic polymorphisms in the LncRNAs with gastric cancer risk in a Chinese population. J Cancer. 8:531–536. 2017. View Article : Google Scholar : PubMed/NCBI

33 

Li L, Sun R, Liang Y, Pan X, Li Z, Bai P, Zeng X, Zhang D, Zhang L and Gao L: Association between polymorphisms in long non-coding RNA PRNCR1 in 8q24 and risk of colorectal cancer. J Exp Clin Cancer Res. 32:1042013. View Article : Google Scholar : PubMed/NCBI

34 

Chu H, Chen Y, Yuan Q, Hua Q, Zhang X, Wang M, Tong N, Zhang W, Chen J and Zhang Z: The HOTAIR, PRNCR1 and POLR2E polymorphisms are associated with cancer risk: A meta-analysis. Oncotarget. 8:43271–43283. 2017.PubMed/NCBI

35 

Lv Z, Xu Q and Yuan Y: A systematic review and meta-analysis of the association between long non-coding RNA polymorphisms and cancer risk. Mutat Res. 771:1–14. 2017. View Article : Google Scholar : PubMed/NCBI

36 

Hashemi M, Shahkar G, Simforoosh N, Basiri A, Ziaee SA, Narouie B and Taheri M: Association of polymorphisms in PRKCI gene and risk of prostate cancer in a sample of Iranian Population. Cell Mol Biol (Noisy-le-grand). 61:16–21. 2015.PubMed/NCBI

37 

Hashemi M, Moradi N, Ziaee SA, Narouie B, Soltani MH, Rezaei M, Shahkar G and Taheri M: Association between single nucleotide polymorphism in miR-499, miR-196a2, miR-146a and miR-149 and prostate cancer risk in a sample of Iranian population. J Adv Res. 7:491–498. 2016. View Article : Google Scholar : PubMed/NCBI

38 

Hashemi M, Danesh H, Bizhani F, Narouie B, Sotoudeh M, Nouralizadeh A, Sharifiaghdas F, Bahari G and Taheri M: Pri-miR-34b/c rs4938723 polymorphism increased the risk of prostate cancer. Cancer Biomark. 18:155–159. 2017. View Article : Google Scholar : PubMed/NCBI

39 

Hashemi M, Bahari G, Sattarifard H and Narouie B: Evaluation of a 3-base pair indel polymorphism within pre-microRNA-3131 in patients with prostate cancer using mismatch polymerase chain reaction-restriction fragment length polymorphism. Mol Clin Oncol. 7:696–700. 2017.PubMed/NCBI

40 

Solé X, Guinó E, Valls J, Iniesta R and Moreno V: SNPStats: A web tool for the analysis of association studies. Bioinformatics. 22:1928–1929. 2006. View Article : Google Scholar : PubMed/NCBI

41 

Li L, Feng T, Lian Y, Zhang G, Garen A and Song X: Role of human noncoding RNAs in the control of tumorigenesis. Proc Natl Acad Sci USA. 106:pp. 12956–12961. 2009, View Article : Google Scholar : PubMed/NCBI

42 

Zhang X, Rice K, Wang Y, Chen W, Zhong Y, Nakayama Y, Zhou Y and Klibanski A: Maternally expressed gene 3 (MEG3) noncoding ribonucleic acid: Isoform structure, expression, and functions. Endocrinology. 151:939–947. 2010. View Article : Google Scholar : PubMed/NCBI

43 

Heemers HV and Tindall DJ: Androgen receptor (AR) coregulators: A diversity of functions converging on and regulating the AR transcriptional complex. Endocr Rev. 28:778–808. 2007. View Article : Google Scholar : PubMed/NCBI

44 

Bahari G, Hashemi M, Naderi M and Taheri M: IKZF1 gene polymorphisms increased the risk of childhood acute lymphoblastic leukemia in an Iranian population. Tumour Biol. 37:9579–9586. 2016. View Article : Google Scholar : PubMed/NCBI

45 

Hashemi M, Amininia S, Ebrahimi M, Simforoosh N, Basiri A, Ziaee SAM, Narouie B, Sotoudeh M, Mollakouchekian MJ, Rezghi Maleki E, et al: Association between polymorphisms in TP53 and MDM2 genes and susceptibility to prostate cancer. Oncol Lett. 13:2483–2489. 2017.PubMed/NCBI

46 

Bao BY, Lin VC, Yu CC, Yin HL, Chang TY, Lu TL, Lee HZ, Pao JB, Huang CY, Huang SP, et al: Genetic variants in ultraconserved regions associate with prostate cancer recurrence and survival. Sci Rep. 6:221242016. View Article : Google Scholar : PubMed/NCBI

47 

Murali A, Varghese BT, Kumar RR and Kannan S: Combination of genetic variants in cyclin D1 and retinoblastoma genes predict clinical outcome in oral cancer patients. Tumour Biol. 37:3609–3617. 2016. View Article : Google Scholar : PubMed/NCBI

48 

Kapranov P, Willingham AT and Gingeras TR: Genome-wide transcription and the implications for genomic organization. Nat Rev Genet. 8:413–423. 2007. View Article : Google Scholar : PubMed/NCBI

49 

Kapranov P, Cheng J, Dike S, Nix DA, Duttagupta R, Willingham AT, Stadler PF, Hertel J, Hackermüller J, Hofacker IL, et al: RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science. 316:1484–1488. 2007. View Article : Google Scholar : PubMed/NCBI

50 

Wu SW, Hao YP, Qiu JH, Zhang DB, Yu CG and Li WH: High expression of long non-coding RNA CCAT2 indicates poor prognosis of gastric cancer and promotes cell proliferation and invasion. Minerva Med. 108:317–323. 2017.PubMed/NCBI

51 

Guo J, Ma J, Zhao G, Li G, Fu Y, Luo Y and Gui R: Long noncoding RNA LINC0086 functions as a tumor suppressor in nasopharyngeal carcinoma by targeting miR-214. Oncol Res. 25:1189–1197. 2017. View Article : Google Scholar : PubMed/NCBI

52 

Liu JN and Shangguan YM: Long non-coding RNA CARLo-5 upregulation associates with poor prognosis in patients suffering gastric cancer. Eur Rev Med Pharmacol Sci. 21:530–534. 2017. View Article : Google Scholar : PubMed/NCBI

53 

Yeager M, Chatterjee N, Ciampa J, Jacobs KB, Gonzalez-Bosquet J, Hayes RB, Kraft P, Wacholder S, Orr N, Berndt S, et al: Identification of a new prostate cancer susceptibility locus on chromosome 8q24. Nat Genet. 41:1055–1057. 2009. View Article : Google Scholar : PubMed/NCBI

54 

Amundadottir LT, Sulem P, Gudmundsson J, Helgason A, Baker A, Agnarsson BA, Sigurdsson A, Benediktsdottir KR, Cazier JB, Sainz J, et al: A common variant associated with prostate cancer in European and African populations. Nat Genet. 38:652–658. 2006. View Article : Google Scholar : PubMed/NCBI

55 

Gudmundsson J, Sulem P, Manolescu A, Amundadottir LT, Gudbjartsson D, Helgason A, Rafnar T, Bergthorsson JT, Agnarsson BA, Baker A, et al: Genome-wide association study identifies a second prostate cancer susceptibility variant at 8q24. Nat Genet. 39:631–637. 2007. View Article : Google Scholar : PubMed/NCBI

56 

Haiman CA, Patterson N, Freedman ML, Myers SR, Pike MC, Waliszewska A, Neubauer J, Tandon A, Schirmer C, McDonald GJ, et al: Multiple regions within 8q24 independently affect risk for prostate cancer. Nat Genet. 39:638–644. 2007. View Article : Google Scholar : PubMed/NCBI

57 

Eeles RA, Kote-Jarai Z, Giles GG, Olama AA, Guy M, Jugurnauth SK, Mulholland S, Leongamornlert DA, Edwards SM, Morrison J, et al: Multiple newly identified loci associated with prostate cancer susceptibility. Nat Genet. 40:316–321. 2008. View Article : Google Scholar : PubMed/NCBI

58 

Al Olama AA, Kote-Jarai Z, Giles GG, Guy M, Morrison J, Severi G, Leongamornlert DA, Tymrakiewicz M, Jhavar S, Saunders E, et al: Multiple loci on 8q24 associated with prostate cancer susceptibility. Nat Genet. 41:1058–1060. 2009. View Article : Google Scholar : PubMed/NCBI

59 

Keller C and Bühler M: Chromatin-associated ncRNA activities. Chromosome Res. 21:627–641. 2013. View Article : Google Scholar : PubMed/NCBI

60 

Luco RF and Misteli T: More than a splicing code: Integrating the role of RNA, chromatin and non-coding RNA in alternative splicing regulation. Curr Opin Genet Dev. 21:366–372. 2011. View Article : Google Scholar : PubMed/NCBI

61 

Pircher A, Gebetsberger J and Polacek N: Ribosome-associated ncRNAs: An emerging class of translation regulators. RNA Biol. 11:1335–1339. 2014. View Article : Google Scholar : PubMed/NCBI

62 

Hannon GJ: RNA interference. Nature. 418:244–251. 2002. View Article : Google Scholar : PubMed/NCBI

63 

Lee JT: Epigenetic regulation by long noncoding RNAs. Science. 338:1435–1439. 2012. View Article : Google Scholar : PubMed/NCBI

64 

Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, Thomas K, Presser A, Bernstein BE, van Oudenaarden A, et al: Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci USA. 106:pp. 11667–11672. 2009, View Article : Google Scholar : PubMed/NCBI

65 

Mercer TR, Dinger ME, Sunkin SM, Mehler MF and Mattick JS: Specific expression of long noncoding RNAs in the mouse brain. Proc Natl Acad Sci USA. 105:pp. 716–721. 2008, View Article : Google Scholar : PubMed/NCBI

66 

Geisler S and Coller J: RNA in unexpected places: Long non-coding RNA functions in diverse cellular contexts. Nat Rev Mol Cell Biol. 14:699–712. 2013. View Article : Google Scholar : PubMed/NCBI

67 

Spizzo R, Almeida MI, Colombatti A and Calin GA: Long non-coding RNAs and cancer: A new frontier of translational research? Oncogene. 31:4577–4587. 2012. View Article : Google Scholar : PubMed/NCBI

68 

Tsai MC, Spitale RC and Chang HY: Long intergenic noncoding RNAs: New links in cancer progression. Cancer Res. 71:3–7. 2011. View Article : Google Scholar : PubMed/NCBI

69 

Heemers H, Maes B, Foufelle F, Heyns W, Verhoeven G and Swinnen JV: Androgens stimulate lipogenic gene expression in prostate cancer cells by activation of the sterol regulatory element-binding protein cleavage activating protein/sterol regulatory element-binding protein pathway. Mol Endocrinol. 15:1817–1828. 2001. View Article : Google Scholar : PubMed/NCBI

70 

Yang L, Qiu M, Xu Y, Wang J, Zheng Y, Li M, Xu L and Yin R: Upregulation of long non-coding RNA PRNCR1 in colorectal cancer promotes cell proliferation and cell cycle progression. Oncol Rep. 35:318–324. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Sattarifard H, Hashemi M, Hassanzarei S, Narouie B and Bahari G: Association between genetic polymorphisms of long non‑coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population. Mol Clin Oncol 7: 1152-1158, 2017.
APA
Sattarifard, H., Hashemi, M., Hassanzarei, S., Narouie, B., & Bahari, G. (2017). Association between genetic polymorphisms of long non‑coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population. Molecular and Clinical Oncology, 7, 1152-1158. https://doi.org/10.3892/mco.2017.1462
MLA
Sattarifard, H., Hashemi, M., Hassanzarei, S., Narouie, B., Bahari, G."Association between genetic polymorphisms of long non‑coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population". Molecular and Clinical Oncology 7.6 (2017): 1152-1158.
Chicago
Sattarifard, H., Hashemi, M., Hassanzarei, S., Narouie, B., Bahari, G."Association between genetic polymorphisms of long non‑coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population". Molecular and Clinical Oncology 7, no. 6 (2017): 1152-1158. https://doi.org/10.3892/mco.2017.1462
Copy and paste a formatted citation
x
Spandidos Publications style
Sattarifard H, Hashemi M, Hassanzarei S, Narouie B and Bahari G: Association between genetic polymorphisms of long non‑coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population. Mol Clin Oncol 7: 1152-1158, 2017.
APA
Sattarifard, H., Hashemi, M., Hassanzarei, S., Narouie, B., & Bahari, G. (2017). Association between genetic polymorphisms of long non‑coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population. Molecular and Clinical Oncology, 7, 1152-1158. https://doi.org/10.3892/mco.2017.1462
MLA
Sattarifard, H., Hashemi, M., Hassanzarei, S., Narouie, B., Bahari, G."Association between genetic polymorphisms of long non‑coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population". Molecular and Clinical Oncology 7.6 (2017): 1152-1158.
Chicago
Sattarifard, H., Hashemi, M., Hassanzarei, S., Narouie, B., Bahari, G."Association between genetic polymorphisms of long non‑coding RNA PRNCR1 and prostate cancer risk in a sample of the Iranian population". Molecular and Clinical Oncology 7, no. 6 (2017): 1152-1158. https://doi.org/10.3892/mco.2017.1462
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team