Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
January-2015 Volume 11 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2015 Volume 11 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Function of interleukin‑17 and ‑35 in the blood of patients with hepatitis B‑related liver cirrhosis

  • Authors:
    • Min Shi
    • Jue Wei
    • Jinbin Dong
    • Wenying Meng
    • Jiali Ma
    • Ting Wang
    • Na Wang
    • Yugang Wang
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, Shanghai Changning Central Hospital, Shanghai 200336, P.R. China
    Copyright: © Shi et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].
  • Pages: 121-126
    |
    Published online on: October 16, 2014
       https://doi.org/10.3892/mmr.2014.2681
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Intrahepatic T helper (Th)17 cytokine and serum interleukin (IL)‑17 levels in patients with hepatitis B are positively correlated with the progression of liver cirrhosis (LC). IL‑35 can significantly inhibit the differentiation of Th17 cells and the synthesis of IL‑17. The present study aimed to investigate the function and expression of IL‑17 and IL‑35 in the blood of patients with hepatitis B‑related LC. The levels of IL‑17 and IL‑35 in the peripheral blood of 30 patients with chronic hepatitis B (CHB), 79 with LC, 14 with chronic severe hepatitis B (CSHB), and 20 normal controls were detected by ELISA. Quantitative polymerase chain reaction was used to evaluate Epstein‑Barr virus‑induced gene 3 (EBI3), forkhead box (FOX)P3 and IL‑17 mRNA expression levels in peripheral blood mononuclear cells (PBMCs). Western blotting was used to determine protein expression. The liver function of patients and normal controls was measured. EBI3, IL‑17 and FOXP3 mRNA expression levels in PBMCs from patients with LC, CHB and CSHB were higher than those in cells from the controls. IL‑17 mRNA levels differed significantly according to the Child‑Pugh classification and exhibited an upward trend over time in contrast to a downward trend for EBI3 and FOXP3 mRNA. The changes in protein expression in the peripheral blood were consistent with the changes in mRNA expression. Serum IL‑17 levels were positively correlated with total bilirubin (TBIL), alanine aminotransferase (ALT) and Child‑Pugh grade, and were negatively correlated with albumin. These observed differences were significant. Serum IL‑35 levels were negatively correlated with albumin, but not with Child‑Pugh grade, ALT and TBIL. IL‑17 and IL‑35 may be critically involved in the pathogenesis of hepatitis B‑related LC.

Introduction

Hepatitis B virus (HBV) infection remains a global public health problem. More than 350 million people worldwide are suffering from persistent HBV infection (1). Chronic HBV infection is a serious clinical problem due to the potentially adverse sequelae, such as hepatic decompensation and the development of cirrhosis or hepatocellular carcinoma (2). The Child-Pugh classification is the common liver reserve function classification standard of cirrhosis, guides treatment and prognosis, and has very important reference value (3,4). The determination of Child-Pugh score, which may range from 5 to 15, is based on the presence and severity of ascites and hepatic encephalopathy, the prolongation of prothrombin time, and the levels of serum bilirubin and albumin. According to their Child-Pugh scores, patients are classified into three classes; A, B and C, with Child-Pugh scores 5–6, 7–9 and 10–15, respectively (5). The complication rate of chronic HBV is associated with the degree of viral replication, inflammation and fibrosis (6,7,8).

Cytokines are important chemical mediators synthesized and secreted from immune cells, which act on their corresponding receptors and regulate immune cell differentiation and proliferation, thus coordinating the immune and inflammatory responses and progression of fibrosis. In previous years, studies have demonstrated that intrahepatic T helper (Th)17 cytokines and serum interleukin (IL)-17 levels in patients with hepatitis B are positively correlated with the progression of liver cirrhosis (LC) (1,9). Cytokines do not act in isolation and are synthesized and secreted through mutual adjustment. They can regulate receptor expression and influence the biological effects of the cytokine network to achieve synergistic, antagonistic or functional expansion. IL-35 can significantly inhibit the differentiation of Th17 cells in addition to the synthesis of IL-17 (10). Thus far, few studies have investigated IL-17 and IL-35 in patients with LC. In the current study, the expression levels of IL-17 and −35 in the blood of patients with hepatitis B-related LC was investigated.

Patients and methods

Study objective

The present study included out- or inpatients treated at the Department of Gastroenterology and Infectious Diseases (Changning District Central Hospital, Shanghai, China), between December 2010 and June 2013. The patients included 30 with chronic hepatitis B (CHB), 79 with LC (27, 30 and 22 with Child-Pugh class A, B and C, respectively), 14 with chronic severe hepatitis B (CSHB), and 20 healthy controls. Peripheral blood was collected from each patient. All cases were diagnosed in accordance with the 2000 National Viral Hepatitis Prevention and Treatment Programs (11) and the 2005 Chronic Hepatitis B Prevention Guide (12). Patients with solid tumors, autoimmune diseases, other types of hepatitis virus infection or human immunodeficiency virus co-infection were excluded. The included patients had not received immunomodulatory and antiviral agents prior to treatment. The clinical characteristics of the patients are exhibited in Table I. The normal control (NC) group comprised 12 males and eight females, aged 22–64 years (mean, 32.5±9.0 years), from whom hepatitis B virus infection had been eliminated; exclusion criteria were the same as for the patients. The present study was approved by the Ethics Committee of Changning District Central Hospital, and all patients or their authorized family members gave signed informed consent.

Table I

Clinical characteristics of patients.

Table I

Clinical characteristics of patients.

Liver cirrhosis Child-Pugh class

Clinical featureNCABCCHBCSHB
Case (n)202730223014
Gender
 Male (n)122125192212
 Female (n)865382
Age (years)a39.5±9.045.4±7.252.9±8.956.9±9.838.1±6.747.0±8.2

a Data are presented as the mean ± standard deviation.

{ label (or @symbol) needed for fn[@id='tfn2-mmr-11-01-0121'] } NC, normal control; CHB, chronic hepatitis B; CSHB, chronic severe hepatitis B.

Materials and reagents

The FTC-3000 quantitative polymerase chain reaction (qPCR) instrument was obtained from Funglyn Biotech, Inc. (Scarborough, ON, Canada); the SYBR Green Real-Time PCR Master Mix was from Toyobo Co. (Osaka, Japan); primers for L-35 (Epstein-Barr virus-induced gene 3; EBI3), IL-17 and forkhead box P3 (FOXP3) were designed by the authors and synthesized by Generay Biotech Co., Ltd (Shanghai, China) (Table II); rabbit anti-IL-17 polyclonal antibodies were from Abcam (Cambridge, MA, USA); mouse anti-IL-35 monoclonal antibodies were from R&D Systems, Inc. (Minneapolis, MN, USA); rabbit anti-FOXP3 (D25D4) monoclonal antibodies were from Cell Signaling Technology, Inc. (Danvers, MA, USA); mouse anti-β-actin monoclonal antibodies, goat anti-rabbit immunoglobulin G (IgG) (whole molecule)-peroxidase antibodies and goat anti-mouse IgG (Fc specific)-peroxidase antibodies were from Sigma-Aldrich (St. Louis, MO, USA); the Bicinchoninic Acid (BCA) Protein Assay kit was from Thermo Fisher Scientific (Rockford, IL, USA); the Amersham ECL plus Western Blotting Detection System was from GE Healthcare Bio-Sciences (Pittsburgh, PA, USA); and the ELISA kit was from Uscn Life Science, Inc. (Wuhan, China).

Table II

Sequences for reverse transcription quantitative polymerase chain reaction.

Table II

Sequences for reverse transcription quantitative polymerase chain reaction.

mRNASequence (5′-3′)Amplicon size (bp)
IL-35 (EBI3)F: TCATTGCCACGTACAGGCTC
R: GGGTCGGGCTTGATGATGTG
208
IL-17F: AGATTACTACAACCGATCCACCT
R: GGGGACAGAGTTCATGTGGTA
151
Forkhead box P3F: GTGGCCCGGATGTGAGAAG
R: GGAGCCCTTGTCGGATGATG
238
β-actinF: TGGAGAAAATCTGGCACCA
R: CAGGCGTACAGGGATAGCAC
189

[i] IL, interleukin; EBI3, Epstein-Barr virus-induced gene 3; F, forward; R, reverse.

Isolation, cryopreservation and resuscitation of peripheral blood mononuclear cells (PBMCs)

Fresh blood (5 ml) was collected prior to surgery and at follow-up (1, 4 and 6 months), put into an EDTA anticoagulant tube, and sent to the laboratory within 2 h. The samples were centrifuged at 1,500 × g for 5 min to obtain the plasma, which was stored at −70°C. The remaining cell pellets were mixed with 3 ml phosphate-buffered saline (PBS) solution, added slowly to 3 ml prepared ficoll lymphocyte separation medium along the pipette wall and transferred to a horizontal rotor at 800 × g for 15 min. PBMCs in the intermediate layer were removed and added to a Falcon tube containing 3 ml PBS solution. The cells were washed at 200 × g for 10 min, added to 5 ml PBS solution following supernatant removal, washed once at 200 × g for 10 min, counted under a fluorescent microscope (Olympus IX51; Olympus, Tokyo, Japan) and then stored subsequent to supernatant removal. The cells in the three tubes were frozen with 500 μl RPMI-1640 medium containing 10% dimethyl sulfoxide and 10% fetal bovine serum, placed in a −80°C freezer overnight and transferred to liquid nitrogen for storage on the next day.

qPCR

Total RNA was extracted by TRIzol® reagent, and detected with ultraviolet spectrophotometry to determine RNA purity and concentration. Total RNA (2 μg) was reverse transcribed into cDNA. qPCR was performed with the ReverTra Ace qPCR RT kit (Toyobo Co.). Reverse transcription (RT) products were amplified for β-actin, IL-35 (EBI3), FOXP3 and IL-17 genes. The mRNA expression and gradation of each group were compared with a fully automated gel imaging analysis system (Gel Doc 2000; Bio-Rad, Hercules, CA, USA), subsequent to the amplified products undergoing gel electrophoresis. All results were corrected with reference to β-actin. The sequences and fragment lengths of the PCR primers are illustrated in Table II. qPCR was conducted under the following conditions: 40 cycles including initial denaturation at 94°C for 30 sec, denaturation at 94°C for 20 sec, annealing at 61°C for 30 sec, extension at 72°C for 30 sec and a final extension at 72°C for 1 min followed by termination at 4°C.

Western blotting

PBMCs were added to sodium dodecyl sulfate (SDS) lysis solution (100–400 μl; mainly containing 50 mM Tris (pH 8.1), 1% SDS and inhibitors including sodium pyrophosphate, β-glycerophosphate, sodium orthovanadate, sodium fluoride, EDTA and leupeptin). Cells were subjected to high-speed homogenization with ice for 1 min, ultrasonic cracking three times within 20 sec, and centrifugation at 12,000 × g at 4°C for 20 min. The supernatant following centrifugation was transferred to a 0.5-ml centrifuge tube and stored at −80°C. The BCA protein assay method was used for the SDS-PAGE, transmembrane, immune response, development and gel image analysis of EBI3, FOXP3 and IL-17.

Statistical analysis

SPSS version 13.0 (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis and the values were expressed as the mean ± standard deviation. Numerical data were analyzed by the χ2 test, and quantitative differences between groups were processed by analysis of variance. Pair-wise comparisons were performed by the q test. The cumulative varicose vein rebleeding and survival rates were analyzed by a product-limit method (Kaplan-Meier) and all statistical tests were bilateral probability tests (α=0.05). P<0.05 was considered to indicate a statistically significant difference.

Results

Quantitative determination of EBI3, IL-17 and FOXP3 expression by qPCR

The results of reverse transcription qPCR (RT-qPCR) are presented in Fig. 1. EBI3, IL-17 and FOXP3 mRNA expression levels in PBMCs from patients with LC, CHB and CSHB were significantly higher than those in the controls (P<0.01 or P<0.05). The levels of IL-17, EBI3 and FOXP3 mRNA differed significantly according to the Child-Pugh classification C or B vs. A. For EBI3: Child-Pugh A exhibited the highest expression; Child-Pugh C vs. A, P=0.002; Child-Pugh C vs. B, P=0.236; Child-Pugh B vs. A, P=0.019. For IL-17: Child-Pugh C exhibited the highest expression; Child-Pugh C vs. A, P<0.001; Child-Pugh C vs. B, P<0.001; Child-Pugh B vs. A, P<0.001. For FOXP3: Child-Pugh A exhibited the highest expression; Child-Pugh C vs. A, P<0.001; Child-Pugh C vs. B, P=0.373; Child-Pugh B vs. A, P<0.001.

Figure 1

Fluorescent determination of EBI3, FOXP3 and IL-17 expression with polymerase chain reaction. NC, normal control; LC-A–C, liver cirrhosis Child-Pugh class A; LC-B, LC Child-Pugh class B; LC-C, LC Child-Pugh class C; CHB, chronic hepatitis B; CSHB, chronic severe hepatitis B, IL-17, interlaukin 17; EBI3, Epstein-Barr virus-induced gene 3; FOXP3, forkhead box P3.

Expression levels of EBI3, IL-17 and FOXP3 mRNA in patients with LC were significantly higher than in the CHB group (EBI3, Child-Pugh C/B/A vs. CHB, P<0.001 for all three comparisons; IL-17, Child-Pugh C/B/A vs. CHB, P<0.001 for all three comparisons; FOXP3, Child-Pugh C vs. CHB, P=0.001; Child-Pugh B vs. CHB, P=0.003; Child-Pugh A vs. CHB, P<0.001). There was also a significant difference in EBI3, IL-17 and FOXP3 mRNA expression between the different Child-Pugh classes compared with CSHB. For EBI3: Child-Pugh C vs. CSHB, P=0.820; Child-Pugh B vs. CSHB, P=0.330; Child-Pugh A vs. CSHB, P=0.003. For IL-17: Child-Pugh C vs. CSHB, P<0.001; Child-Pugh B vs. CSHB, P=0.966; Child-Pugh A vs. CSHB, P<0.001. For FOXP3: Child-Pugh C vs. CSHB, P=0.015; Child-Pugh B vs. CSHB, P=0.003; Child-Pugh A vs. CSHB, P=0.010.

Determination of IL-35 (EBI3), FOXP3 and IL-17 expression levels with western blotting

Western blotting indicated that in patients with LC, CHB and CSHB, IL-35 (EBI3), FOXP3 and IL-17 protein expression levels were significantly higher than those in the NC group. Patients with LC with different Child-Pugh classes also demonstrated differences in EBI3, FOXP3 and IL-17 protein expression levels (EBI3, Child-Pugh A had relatively high expression; IL-17, Child-Pugh C had relatively high expression; and FOXP3, Child-Pugh A had relatively high expression). The change in protein expression was consistent with that observed in the mRNA expression (Fig. 2).

Figure 2

Changes in expression of IL-35 (Epstein-Barr virus-induced gene 3), IL-17 and FOXP3 by western blotting. Lanes: 1, normal control; 2, LC Child-Pugh class A; 3, LC Child-Pugh class B; 4, LC Child-Pugh class C; 5, chronic hepatitis B; 6, chronic severe hepatitis B. IL, interleukin; FOXP3, forkhead box P3; LC, liver cirrhosis.

Determination of IL-17 and IL-35 (EBI3) concentrations in the peripheral blood by ELISA

The results of the ELISA demonstrated (Fig. 3) that, in LC, CHB and CSHB, the serum concentrations of IL-17 and IL-35 were significantly higher than those in the NC group (P<0.001). Patients with LC with different Child-Pugh classes demonstrated different EBI3 and IL-17 levels (EBI3, Child-Pugh A exhibited higher levels by pairwise comparison, P<0.001; IL-17, Child-Pugh C exhibited relatively high levels by pairwise comparison, P<0.001). In patients with LC Child-Pugh B and C, IL-17 and IL-35 concentrations in the peripheral blood were significantly higher than those in the CHB group (EBI3, P<0.001; IL-17, P<0.001). In patients in the LC group with Child-Pugh class A, IL-35 serum concentrations were higher than those in the CHB group (P<0.001), but IL-17 serum levels did not differ significantly (P=0.393). Fig. 3 demonstrates the differences in IL-35 and IL-17 serum levels between the LC and CSHB groups (IL-35, Child-Pugh C vs. CSHB, P=0.850; Child-Pugh B vs. CSHB, P<0.001; Child-Pugh A vs. CSHB, P<0.001; IL-17, Child-Pugh A–C vs. CSHB, P<0.001).

Figure 3

ELISA determination of IL-17 and IL-35 serum concentration. Serum concentrations of (A) IL-17 and (B) IL-35. IL, interleukin; NC, normal control; LC-A, liver cirrhosis Child-Pugh class A; LC-B, LC Child-Pugh class B; LC-C, LC Child-Pugh class C; CHB, chronic hepatitis B; CSHB, chronic severe hepatitis B.

Correlation analysis

Serum alanine aminotransferase (ALT), total bilirubin (TBIL) and albumin levels were compared with IL-17 and IL-35 levels. Correlation analysis identified that serum IL-17 and IL-35 levels were negatively correlated with albumin and serum IL-17 levels were significantly positively correlated with TBIL, ALT and Child-Pugh class (P<0.01). The serum IL-35 levels were negatively correlated with Child-Pugh class and demonstrated no correlation with ALT and TBIL (Table III).

Table III

Correlations between liver function and serum concentrations of IL-17 and IL-35.

Table III

Correlations between liver function and serum concentrations of IL-17 and IL-35.

IL-17IL-35


rPrP
Total bilirubin0.338<0.0010.1220.146
Albumin−0.698<0.001−0.384<0.001
Alanine aminotransferase0.2480.0030.0380.651
Child-Pugh classification0.873<0.001−0.798<0.001

[i] IL, interleukin.

Discussion

IL-17 is predominantly produced by activated Th17 cells, and the serum IL-17 level reflects the number and function of Th17 cells to a certain extent (13–15). A study by Sun et al (16) suggested that the increase in Th17 cells in patients with LC promotes hepatic stellate cell activity, which leads to further disease progression. Ye et al (17) indicated that the number of IL-17-positive cells increases with stage of liver fibrosis. This may be associated with the crucial function that transforming growth factor (TGF)-β1 has in the development of liver fibrosis and the fact that cooperation between TGF-β1 and IL-6 may promote maturation of CD4+ T cells into Th17 cells (18–20). Th17 cells produce IL-6 and IL-17, which promote chronic liver inflammation, leading to the occurrence of cirrhosis. The current study identified that EBI3, IL-17 and FOXP3 mRNA and protein expression levels in PBMCs from patients with LC, CHB and CSHB were higher than those in the controls. Serum concentrations of IL-17 rose significantly, which were negatively correlated with albumin, but positively correlated with TBIL, ALT and Child-Pugh class. Serum IL-17 levels increased with LC Child-Pugh classification and were correlated with liver inflammation, necrosis and synthesis function, suggesting an important function in the occurrence and development of liver fibrosis.

IL-35 is a heterodimer that consists of the EBI3 protein and IL-12 p35 subunit (10,21,22). IL-35 is secreted mainly by T regulatory (Treg) cells. Its primary physiological function may be to induce the formation of Th1 cells and facilitate the proliferation of Treg cells (23). A previous study (10) established that IL-35 can inhibit differentiation of Th17 cells and IL-17 production and that IL-17 production is greater in spleen cells from EBI3-deficient mice. Liu et al (24) have demonstrated that EBI3 inhibits the responses of Th17, Th1, IL-2 and Treg. TGF-β can enhance the proinflammatory response by accelerating Th17 differentiation. IL-35 may upregulate interferon-γ, which can prevent phosphorylation of the TGF-β receptor downstream effector SMAD family member 3. This blocks TGF-β binding to its receptor and prevents the differentiation of Th17 cells (15). Retinoid-related orphan receptor γt (RORγt) is an important transcription factor of Th17 cell differentiation, and EBI3 deletion increased the expression of IL-17, IL-22 and RORγt (25). Several research groups have demonstrated that specific expression of FOXP3 in Treg cells is required for the Treg cell development and function (26–28).

The current study identified that patients with CHB, LC and CSHB, IL-17, IL-35 and FOXP3 mRNA and protein expression levels were higher than those in the NC group. Serum levels of IL-35 were significantly increased, which indicated that proinflammatory cytokines were increased in the cirrhotic process, while anti-inflammatory cytokine IL-35 levels were correspondingly upregulated. IL-17 mRNA and protein levels increased with LC Child-Pugh classification, whereas the expression of IL-35 mRNA and protein was reduced. The downregulated EBI3 content was also reduced following transcription into the EBI3 subunit and binding with the p35 subunit to form IL-35. Serum concentrations and protein expression levels are consistent with the mRNA. Further analysis demonstrated that serum IL-35 levels were negatively correlated with the LC Child-Pugh classification. The results indicate that in LC, reduced IL-35 expression hinders Treg cell amplification from secreting more IL-35. Thus, IL-35 cannot inhibit Th17 cell differentiation and IL-17 overexpression, excessive inflammation reactions are not prevented and the development of LC is promoted. The mRNA and protein levels of FOXP3 support this conclusion.

Previous studies have suggested that immune hyper-reactivity has an important function in the pathogenesis of severe hepatitis (29). It has been demonstrated that in patients with CHB, LC and CSHB, mRNA and protein levels of IL-17, IL-35 and FOXP3 are higher than those in the NC group, and the serum levels of IL-17 and IL-35 are significantly increased. Treg cells can suppress the immune response from over-reaction and reduce the immunopathological damage, however, they also inhibit the cytotoxic response against pathogens, which may lead to the exacerbation of infection.

The preliminary view is that IL-17 and IL-35 may be critically involved in the pathogenesis of hepatitis B-related LC. Studies on the association between IL-17 and IL-35 may further the understanding of the immune mechanisms involved in the progression of LC, and aid the development novel therapeutic targets. The present study had only a small number of cases and short follow-up; therefore, it was not possible to evaluate the dynamic changes in IL-17 and IL-35. Further studies with a larger number of samples and extended follow-up are warranted.

Acknowledgements

This study was funded by a grant from the Shanghai Municipal Health Bureau Shanghai Municipal Health Bureau Key Disciplines (no. ZK2012A05).

References

1 

Wang L, Chen S and Xu K: IL-17 expression is correlated with hepatitis B-related liver diseases and fibrosis. Int J Mol Med. 27:385–392. 2011.PubMed/NCBI

2 

Liaw YF and Chu CM: Hepatitis B virus infection. Lancet. 373:582–592. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Cholongitas E, Papatheodoridis GV, Vangeli M, et al: Systematic review: The model for end-stage liver disease - should it replace Child-Pugh’s classification for assessing prognosis in cirrhosis? Aliment Pharmacol Ther. 22:1079–1089. 2005.

4 

Infante-Rivard C, Esnaola S and Villeneuve JP: Clinical and statistical validity of conventional prognostic factors in predicting short-term survival among cirrhotics. Hepatology. 7:660–664. 1987. View Article : Google Scholar : PubMed/NCBI

5 

Pugh RN, Murray-Lyon IM, Dawson JL, Pietroni MC and Williams R: Transection of the oesophagus for bleeding oesophageal varices. Br J Surg. 60:646–649. 1973. View Article : Google Scholar : PubMed/NCBI

6 

Lok AS and McMahon B: Chronic hepatitis B. Hepatology. 45:507–539. 2007. View Article : Google Scholar

7 

Iloeje UH, Yang HI, Su J, et al: Predicting cirrhosis risk based on the level of circulating hepatitis B viral load. Gastroenterology. 130:678–686. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Kao JH: Role of viral factors in the natural course and therapy of chronic hepatitis B. Hepatol Int. 1:415–430. 2007. View Article : Google Scholar : PubMed/NCBI

9 

Zhang P, Chen Z, Gong Z, et al: Study on relationship between Th17 cells, Th17 cytokine and the inflammatory activity of liver tissue in post hepatitis B cirrhosis. Wei Chang Bing Xue. 15:456–461. 2010.(In Chinese).

10 

Niedbala W, Wei XQ, Cai B, et al: IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol. 37:3021–3029. 2007. View Article : Google Scholar

11 

Chinese Society of Hepatology, Chinese Society of Infectious Diseases and Chinese Medical Association. Viral hepatitis prevention and treatment programs. Zhonghua Gan Zang Bing Za Zhi. 8:324–329. 2000.(In Chinese).

12 

Chinese Society of Hepatology, Chinese Society of Infectious Diseases and Chinese Medical Association. The guideline of prevention and treatment for chronic hepatitis B. Zhonghua Gan Zang Bing Za Zhi. 13:881–891. 2005.(In Chinese).

13 

Harrington LE, Hatton RD, Mangan PR, et al: Interleukin 17-producing CD4+ effector T cells develop via a lineage distinct from the T helper type 1 and 2 lineages. Nat Immunol. 6:1123–1132. 2005. View Article : Google Scholar

14 

Infante-Duarte C, Horton HF, Byrne MC and Kamradt T: Microbial lipopeptides induce the production of IL-17 in Th cells. J Immunol. 165:6107–6115. 2000. View Article : Google Scholar : PubMed/NCBI

15 

Park H, Li Z, Yang XO, et al: A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nat Immunol. 6:1133–1141. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Sun HQ, Zhang JY, Zhang H, Zou ZS, Wang FS and Jia JH: Increased Th17 cells contribute to disease progression in patients with HBV-associated liver cirrhosis. J Viral Hepat. 19:396–403. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Ye Y, Xie X, Yu J, et al: Involvement of Th17 and Th1 effector responses in patients with Hepatitis B. J Clin Immunol. 30:546–555. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Mangan PR, Harrington LE, O’Quinn DB, et al: Transforming growth factor-beta induces development of the T(H)17 lineage. Nature. 441:231–234. 2006. View Article : Google Scholar

19 

Bettelli E, Carrier Y, Gao W, et al: Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 441:235–238. 2006. View Article : Google Scholar

20 

Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM and Stockinger B: TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity. 24:179–189. 2006. View Article : Google Scholar

21 

Olson BM, Sullivan JA and Burlingham WJ: Interleukin 35: a key mediator of suppression and the propagation of infectious tolerance. Front Immunol. 4:3152013. View Article : Google Scholar : PubMed/NCBI

22 

Vignali DA and Kuchroo VK: IL-12 family cytokines: immunological playmakers. Nat Immunol. 13:722–728. 2012.PubMed/NCBI

23 

Collison LW, Chaturvedi V, Henderson AL, et al: IL-35-mediated induction of a potent regulatory T cell population. Nat Immunol. 11:1093–1101. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Liu JQ, Liu Z, Zhang X, et al: Increased Th17 and regulatory T cell responses in EBV-induced gene 3-deficient mice lead to marginally enhanced development of autoimmune encephalomyelitis. J Immunol. 188:3099–3106. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Yang J, Yang M, Htut TM, et al: Epstein-Barr virus-induced gene 3 negatively regulates IL-17, IL-22 and RORgamma t. Eur J Immunol. 38:1204–1214. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Fontenot JD, Gavin MA and Rudensky AY: Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat Immunol. 4:330–336. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Hori S, Nomura T and Sakaguchi S: Control of regulatory T cell development by the transcription factor Foxp3. Science. 299:1057–1061. 2003. View Article : Google Scholar : PubMed/NCBI

28 

Khattri R, Cox T, Yasayko SA and Ramsdell F: An essential role for Scurfin in CD4+CD25+T regulatory cells. Nat Immunol. 4:337–342. 2003. View Article : Google Scholar : PubMed/NCBI

29 

Zou ZS, Xu DP, Li BS, et al: Immunologically-competent cells in liver infiltrating lymphocytes in patients with chronic severe hepatitis B. Zhonghua Yi Xue Za Zhi. 87:2416–2419. 2007.(In Chinese).

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Shi M, Wei J, Dong J, Meng W, Ma J, Wang T, Wang N and Wang Y: Function of interleukin‑17 and ‑35 in the blood of patients with hepatitis B‑related liver cirrhosis. Mol Med Rep 11: 121-126, 2015.
APA
Shi, M., Wei, J., Dong, J., Meng, W., Ma, J., Wang, T. ... Wang, Y. (2015). Function of interleukin‑17 and ‑35 in the blood of patients with hepatitis B‑related liver cirrhosis. Molecular Medicine Reports, 11, 121-126. https://doi.org/10.3892/mmr.2014.2681
MLA
Shi, M., Wei, J., Dong, J., Meng, W., Ma, J., Wang, T., Wang, N., Wang, Y."Function of interleukin‑17 and ‑35 in the blood of patients with hepatitis B‑related liver cirrhosis". Molecular Medicine Reports 11.1 (2015): 121-126.
Chicago
Shi, M., Wei, J., Dong, J., Meng, W., Ma, J., Wang, T., Wang, N., Wang, Y."Function of interleukin‑17 and ‑35 in the blood of patients with hepatitis B‑related liver cirrhosis". Molecular Medicine Reports 11, no. 1 (2015): 121-126. https://doi.org/10.3892/mmr.2014.2681
Copy and paste a formatted citation
x
Spandidos Publications style
Shi M, Wei J, Dong J, Meng W, Ma J, Wang T, Wang N and Wang Y: Function of interleukin‑17 and ‑35 in the blood of patients with hepatitis B‑related liver cirrhosis. Mol Med Rep 11: 121-126, 2015.
APA
Shi, M., Wei, J., Dong, J., Meng, W., Ma, J., Wang, T. ... Wang, Y. (2015). Function of interleukin‑17 and ‑35 in the blood of patients with hepatitis B‑related liver cirrhosis. Molecular Medicine Reports, 11, 121-126. https://doi.org/10.3892/mmr.2014.2681
MLA
Shi, M., Wei, J., Dong, J., Meng, W., Ma, J., Wang, T., Wang, N., Wang, Y."Function of interleukin‑17 and ‑35 in the blood of patients with hepatitis B‑related liver cirrhosis". Molecular Medicine Reports 11.1 (2015): 121-126.
Chicago
Shi, M., Wei, J., Dong, J., Meng, W., Ma, J., Wang, T., Wang, N., Wang, Y."Function of interleukin‑17 and ‑35 in the blood of patients with hepatitis B‑related liver cirrhosis". Molecular Medicine Reports 11, no. 1 (2015): 121-126. https://doi.org/10.3892/mmr.2014.2681
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team