Efficacy of coenzyme Q10 in mitigating spinal cord injury‑induced osteoporosis

  • Authors:
    • Xue‑Xue Zhang
    • Ke‑Jian Qian
    • Yong Zhang
    • Zhi‑Jian Wang
    • Yan‑Bo Yu
    • Xiao‑Jian Liu
    • Xin‑Tian Cao
    • Yun‑Hua Liao
    • Da‑Ying Zhang
  • View Affiliations

  • Published online on: May 27, 2015     https://doi.org/10.3892/mmr.2015.3856
  • Pages: 3909-3915
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Spinal cord injury (SCI)‑induced osteoporosis may cause mild trauma to bone and increase the risk of bone fracture. The present study aimed to investigate the efficacy of coenzyme Q (CoQ10) on SCI‑induced osteoporosis in rats. SCI was induced by surgical transection of the cord at the T10‑12 level. Animals were treated with CoQ10 (10 mg/kg; intragastrically) daily from 12 h after the surgery and over 10 subsequent days. At the end of the experimental period, blood was collected from the animals and femurs and tibiae were removed for evaluation using biochemical assays. Treatment with CoQ10 prevented SCI‑induced bone loss by rescuing the decreased levels of bone mineral density and bone mineral content observed in the SCI rats. Furthermore, CoQ10 administration reduced bone malondialdehyde levels with a concomitant increase in superoxide dismutase levels, thus alleviating SCI‑induced oxidative injury. In addition, serum inflammatory cytokine levels were markedly increased in rats post‑SCI, which was attenuated by treatment with CoQ10. Finally, the osteoclast‑specific genes receptor activator of nuclear factor kappa‑B ligand and cathepsin K were significantly upregulated and the osteoblast‑specific gene core‑binding factor alpha 1 in the femur was downregulated following SCI, which was effectively restored following treatment with CoQ10. The results suggested that CoQ10 treatment may be effective in attenuating SCI‑induced osteoporosis.

Introduction

Traumatic spinal cord injury (SCI) is a severe pathological event with consequences which are sustained throughout the life of the patient and eventually cause distress to the family and society (1,2). SCI activates an inflammatory cascade and during this, inflammatory cells from the circulation deteriorate vital organs, including the liver, kidney and lungs (3). Oxidative stress and inflammation may result in post-SCI pathogenesis, including cellular apoptosis, activation of free radicals and enhanced lipid peroxidation (LPO) with subsequent depletion of anti-oxidant agents, and have a pivotal role in SCI-induced secondary organ/tissue damage (47). One of the imminent consequences of SCI is a significant bone loss within a few months to a few years of injury (8), leading to fracture in 50% of patients with complete SCI. SCI-induced bone loss generally affects the lower limbs of rats due to longer bones as well as metaphysis, epiphysis and diaphysis of the femur and tibia of rats (9,10). SCI-induced bone loss has significant morbidity and is likely to aggravate already profound disability. Treatment strategies to ameliorate bone loss after SCI by physical methods include passive standing, minimal electrical stimulation and body weight-supported treadmill training (11,12). However, treatment using these strategies has no significant effects. Effective interventions may require targeting of multiple pathways to achieve significant clinical improvement after SCI, and complications including bone loss are warranted. Coenzyme Q10 (CoQ10) is a key mediator of the electron transfer reaction in the respiratory chain in mitochondria. A study suggested that CoQ10 has a free-radical-quenching effect and also displays insulin-like properties in diabetic patients (13). Previous studies provided evidence that CoQ10 has potent anti-oxidant activity (14,15) and protective efficacy in experimental SCI (16). Previous pre-clinical studies demonstrated the anti-osteonecrotic effects (17) and the inhibitory effect on osteoclast differentiation in bone-marrow-derived monocytes and RAW 264.7 cells of CoQ10, which are mediated by its free-radical-scavenging mechanism (18). However, to the best of our knowledge, the effect of CoQ10 in SCI-induced bone loss has not been studied to date. Therefore, the present study was designed to evaluate the therapeutic efficacy of CoQ10 against bone loss induced by SCI in rats.

Materials and methods

Chemicals

Co-enzyme Q10, superoxide dismutase (SOD) and malondialdehyde (MDA) diagnostic kits were obtained from Sigma-Aldrich (St. Louis, MO, USA). All other chemicals were of the highest available commercial grade.

Animals

Forty male Sprague-Dawley rats (8 weeks-old, weighing 170–200 g) were obtained from the animal facility at Nanchang University (Nanchang, China). The animals were maintained under standard laboratory conditions of relative humidity (55±5%), temperature (25±2°C), and light (12 h light/dark cycle). They were fed standard diet pellets and water was provided ad libitum. The study was approved by the ethics committee of The First Affiliated Hospital of Nanchang University, (Nanchang, China).

Animal model of SCI

The rats were anesthetized by administration of xylazine + ketamine [10 and 75 mg/kg, respectively; intraperitoneally (i.p.)]. After the dorsum of the animals was shaved and sterilized, an incision was made from the posterior to the lower thoracic region. Laminectomy (thoracic T10–T12 vertebrae) was performed to expose the spinal cord alone (sham group). After the laminectomy, the lower thoracic cord was subsequently completely transected with fine sterilized micro scissors (SCI group) under a magnifier. Both stumps of the spinal cord were gently lifted away to create a 1–2-mm gap, which was filled with sponge gel. The muscle fascia and skin were sutured, and the rats were returned to their cages. After completion of surgery, the animals received a bolus of Lactate Ringers solution (5 ml; i.p.) to compensate for blood loss, and antibiotic cover (systemic gentamycin, 50 mg/kg intramuscularly; local treatment with neosporin ointment) was provided. Furthermore, the SCI rats received daily assistance in bladder emptying until spontaneous miction recovered.

Evaluation of locomotor functions

The quality of locomotion was assessed using the Basso, Beattie, and Bresnahan (BBB) locomotor rating score (19).

Study design

Sprague-Dawley rats were divided into four groups (n=10 each) and treated for 10 days as follows: i) Group I – sham-operated rats (Sham); ii) Group II – SCI rats (SCI); iii) Group III – sham-operated rats receiving CoQ10 (10 mg/kg) intragastrically for 10 days (sham + CoQ10); iv) Group IV – SCI rats receiving CoQ10 (10 mg/kg) for 10 days (SCI + CoQ10).

At the end of the experimental period, rats were fasted overnight and sacrificed by decapitation. Blood was collected in heparinized BD vacutainer (BD Biosciences, San Jose, CA, USA) and serum samples were collected by centrifugation at 450 × g for 20 min. Femur and tibiae were immediately excised, rinsed in ice-cold saline to remove the blood and stored at −80°C until required.

Preparation of bone homogenate

Frozen bone samples (150 mg) were minced in a phosphate buffer and homogenized in a MagNA Lyser instrument (Roche Applied Science, Penzberg, Germany). Samples were centrifuged three times at 530 × g for 20 sec with intermediate cooling 5 min in the MagNA Lyser Cooling Block. The tissue homogenate was then centrifuged at 10,000 × g at 4°C for 10 min. The supernatant was separated, stored at −80°C and used for further biochemical analysis.

Measurements of bone mineral content (BMC) and bone mineral density (BMD)

At the end of experiment, one half of the experimental rats (n=5) were anesthetized using xylazine and ketamine (10 and 75 mg/kg, respectively i.p.; Sigma-Aldrich) and the BMD and BMC of the left femur and tibia were estimated using dual energy X-ray absorptiometry instrument (DEXA, Norland X46; Norland, Fort Atkinson, WI, USA) equipped with dedicated software (version 3.9.6) for small animal measurements. The BMC (expressed in grams) was divided by the area of the site that was scanned to obtain the BMD (expressed in g/cm2) (20).

Assessment of systemic oxidative stress

SOD levels of femur and tibiae bone homogenate were estimated by the method of Kakkar et al (21). The inhibition of reduction of nitro blue tetrazolium to blue formazan in the presence of phenazine methosulphate and nicotinamide adenine dinucleotide was measured at 560 nm using n-butanol as blank with a Shimadzu-1601 PC UV-Visible scanning spectrophotometer (Shimadzu Corp., Kyoto, Japan). One unit (U) of enzyme activity was defined as the amount of enzyme that inhibits the reaction rate by 50% in 1 min under the defined assay conditions and the results are expressed as U/mg protein.

MDA levels were determined by the method of Ohkawa et al (22). Briefly, 0.5 ml femur and tibiae bone homogenate tissue was mixed with 2.5 ml 20% trichloroacetic acid in a 10-ml centrifuge tube. To the mixture, 1 ml 0.67% thiobarbituric acid was added, followed by mixing and heating for 30 min in a boiling water bath followed by rapid cooling. Subsequently, 4 ml n-butyl-alcohol was added followed by mixing. The mixture was centrifuged at 154 × g for 10 min. The resultant n-butyl-alcohol layer was separated and its MDA content was determined from the absorbance at 535 nm. The results are expressed as nM/mg protein.

Assay for inflammatory cytokine levels

Concentrations of interleukin (IL)-6 and tumor necrosis factor (TNF)-α were determined in serum using commercially available TNF-α and IL-6 ELISA kits (USCN LIFE; Wuhan EIAab Science Co., Ltd, Wuhan, China).

Bone gene expression analysis

The mRNA expression of genes relevant to osteoclastogenesis [receptor activator of nuclear factor kappa-B ligand (RANKL) and cathepsin K] and osteoblastogenesis [core-binding factor alpha 1 (Cbfa1)] in the femur, was investigated using reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis. Briefly, the frozen samples of distal femurs were finely ground into powder while immersed in liquid nitrogen using a mortar and pestle free from RNase. The frozen powder was transferred into a vial containing TRIzol (Invitrogen Life Technologies Carlsbad, CA, USA) and extraction of total RNA was performed using the QuantiTect™ nSYBR® Green PCR kit (Shanghai Tiangen Chemical Co., Ltd., Shanghai, China) in accordance with the manufacturer's instructions. 1 µg total RNA was digested with 10 µl DNase I (Invitrogen Life Technologies) and from this 5 µl (500 ng) was reverse transcribed with 200 U SuperScript II (Invitrogen Life Technologies) using 500 ng oligo-dT and 250 ng random hexamers. RT-PCR analysis was performed using QuantiTect™ nSYBR® Green PCR (Tiangen, Shanghai, China) according to the manufacturer's instructions. The RT-PCR data were based on SYBR green amplification. The sequences of primers are listed in Table I. The highly specific measurement of mRNA was performed using the Light Cycler system (Bio-Rad Laboratories, Hercules, CA, USA). PCR amplification was performed in 96-well optical reaction plates for 40 cycles, with cycles of 94°C for 30 sec, 58–63°C for 30 sec and 72°C for 60 sec. Each sample was run and analyzed in duplicate. GAPDH mRNA as an internal control was used to normalize the data to determine the relative expression of the target genes. The fold changes relative to values of the sham-operated group were obtained and used to express the changes in gene expression.

Table I

Sequences of oligonucleotides used as primers.

Table I

Sequences of oligonucleotides used as primers.

Gene (abbreviation)Gene (full name)IDSequence (5′→3′)Tm (°C)Size (bp)
RANKLReceptor activator of nuclear factor-κB ligand117516Forward: TCAGGAGTTCCAGCTATGAT
Reverse: CCATCAGCTGAAGATAGTCC
55298
Cathepsin KCathepsin K29175Forward: GAGACATGACCAGCGAAGAA
Reverse: CACATATTGGAAGGCAGTGG
56332
Cbfa1Core binding factor alpha 1367218Forward: CGAAATGCCTCTGCTGTTAT
Reverse: TTCTGTCTGTGCCTTCTTGG
53194
GAPDHGlyceraldehyde 3-phosphate dehydrogenase2597Forward: ACCACAGTCCATGCCATCAC
Reverse: TCCACCACCCTGTTGCTGTA
60452
Statistical analysis

Values are expressed as the mean ± standard deviation. The results were statistically analyzed by one-way analysis of variance followed by Dunnet's t-test using SPSS software version 13.0 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference between values.

Results

CoQ10 alleviates decreased BMD and BMC in rats following SCI

The BMD and BMC of femur and tibia were significantly decreased in the SCI group as compared with that in the sham group (P<0.05). Treatment with CoQ10 (10 mg/kg) significantly alleviated the decreasing effect of SCI on BMC (Fig. 1A) and BMD (Fig. 1B) (P<0.05). Treatment of sham-operated rats with CoQ10 had no significant effect on these parameters.

CoQ10 alleviates oxidative stress in bones following SCI

Compared with the sham group, SOD levels in femur and tibia were significantly depleted in SCI rats (P<0.05). However, treatment with CoQ10 effectively restored the SOD status to normal levels (Fig. 2A). Furthermore, MDA, a toxic adduct formed during lipid peroxidation, was significantly elevated in the femur and tibia of SCI rats compared with that in the sham operated rats (P<0.05). However, treatment with CoQ10 significantly attenuated the elevated MDA in femur and tibia to normal levels (P<0.05) (Fig. 2B).

CoQ10 reduces serum inflammatory markers in SCI rats

In the present study, SCI rats displayed a significant elevation of serum inflammatory cytokines IL-6 (Fig. 3) and TNF-α (Fig. 4) (P<0.05). Oral administration of CoQ10 effectively reduced the IL-6 and TNF-α levels in serum to normal levels and thus minimized inflammation.

CoQ10 attenuates SCI-induced increases in osteoclastogenesis gene expression in femurs of rats

The mRNA levels of osteoclast-specific genes RANKL (Fig. 5A) and cathepsin K (Fig. 5B) were increased in femurs of SCI rats. Of note, treatment with CoQ10 significantly decreased the RANKL and cathepsin K mRNA levels in femurs (P<0.05).

CoQ10 attenuates SCI-induced decreases in osteoblastogenesis gene expression in femurs of rats

The mRNA levels of the osteoblast-specific gene Cbfa1 (Fig. 6) were decreased in femurs of SCI rats. However, administration of CoQ10 rescued the mRNA levels of Cbfa1 in the femurs of rats following SCI (P<0.05).

Discussion

Therapeutic agents including bisphosphonates, estrogen and raloxifene have been implicated in the treatment of bone diseases. However, despite their beneficial effects, they exert certain adverse effects, including thromboembolism and oesophageal irritation (2325). Therefore, the discovery of novel drugs to treat bone-associated disorders is required. CoQ10 may be a candidate for the prevention of osteoporosis, as it displays cytoprotective properties and acts as an effective free radical scavenger.

The present study explored the efficacy of CoQ10 on bone loss induced by SCI in a murine model. Complete SCI at the lower segment of the thoracic cord of rats is routinely used in pre-clinical studies on the pathogenesis of SCI-induced osteoporosis (8,26,27). It induces severe forms of osteoporosis and an array of factors increasing the susceptibility to osteoporosis, including carrying heavy objects, neural lesions and hormonal imbalance (28). Further direct denervation of bone and indirect alteration of vasoregulation are attributed to SCI-mediated osteoporosis (29). Furthermore, negative imbalance of Ca2+ mediated by altered hormone levels is involved in the post-SCI osteoporosis (30). Previous studies on rodents and humans suggested that following SCI, bone resorption is increased due to osteoclast activation (31,32). Morse et al (33) showed that ten days post-SCI, the bone formation rate in rats at the distal femur was significantly lower than that in sham-operated rats. Furthermore, a significant reduction in the number of osteoclasts was observed in the distal femur five days post-SCI.

It is essential to asses and monitor post-SCI osteoporosis to minimize the prevalence of fracture. BMD and BMC are reliable markers in the assessment of osteoporosis and clearly show the fracture risk in the majority of patients (34). In the present study, rats displayed a significant decrease in BMD and BMC of femur and tibia following SCI as compared with those in the sham group, indicating that tibial and bone loss had occurred. Treatment with CoQ10 restored the BMC and BMD to normal, which may be due to the re-establishment of bone balance through preventing an increase in the number of osteoclasts by inhibiting osteoclast maturation (18).

Reactive oxygen species have a pivotal role in the development of secondary complications following SCI (35). In the present study, SCI rats displayed elevated levels of femoral and tibial MDA with a concomitant decrease in the levels of the antioxidant enzyme SOD. These depleted levels of SOD may have been due to the involvement of SOD in scavenging the free radicals generated by SCI. Thus, these results demonstrated the role of oxidative stress in the progression of osteoporosis following SCI, which is in corroboration with the results of a previous study (36). Treatment with CoQ10 mitigated the oxidative stress and restored the levels of MDA and SOD to normal levels. Thus, the preventive effect of CoQ10 against bone loss may be due to its free radical scavenging properties (37).

Elevated cytokine levels within the bone have been involved in SCI-induced osteoporosis. Demulder et al (38) reported that levels of IL-6 were increased in serum and bone samples of the sternum and iliac crest from patients with SCI. Thus, the elevated cytokines may lead to the recruitment of osteoclasts from marrow precursors and enhance osteoclast activity in bones. In the present study, elevated serum levels of IL-6 were significantly diminished by CoQ10 treatment, which is in corroboration with previous study (39). Furthermore, osteoclasts ware highly activated and osteoblasts are suppressed by the inflammatory cytokine TNF-α via the RANKL and osteoprotegerin (OPG) system. In the present study, the elevated serum levels of TNF-α in rats following SCIs were significantly reduced by CoQ10 treatment. Previous studies reported the potential of CoQ10 to decrease TNF-α (40,41). Thus, the anti-osteoporotic effect rendered by CoQ10 may be mediated through an anti-cytokine mechanism.

Previous studies reported increased bone resorption activity post-SCI. RANKL, which is expressed on the surface of bone marrow stromal/osteoblast precursor cells, T cells and B cells, is the prime molecule involved in osteoclast synthesis. RANKLs bind to their cognate receptors, RANK, on osteoclast lineage cells, and are neutralized by the soluble, decoy receptor, OPG, which is also produced by osteoblastic lineage cells (4244). A previous study showed that RANKL mRNA and protein expression in cultured osteoblast-like cells from SCI rats was significantly increased and resulted in increased osteoclastogenesis, thus leading to osteoporosis after SCI (10). In the present study, rats displayed increased mRNA expression of RANKL in the femur following SCI and CoQ10 treatment significantly reversed the altered mRNA expression to normal levels (45).

Cathepsin K is primarily expressed in osteoclasts (46) and has a pivotal role in the degradation of the collagen matrix components of bone (predominantly type-I collagen) at acidic pH. Based on human genetics (47,48), experimental genetics in mice (49), substrate preference and cellular distribution (50), the pivotal role of cathepsin K in osteoclastic bone resorption has been demonstrated. In the present study, rats displayed increased mRNA expression of Cathepsin K in the femur post-SCI. Of note, CoQ10 treatment downregu-lated cathepsin K in the femurs of rats following SCI and thus prevented the degradation of the bone matrix.

The bone-specific Cbfa1 gene is a runt-domain-containing transcription factor essential for osteoblastic differentiation and bone formation during embryogenesis and post-natal life (51). Cbfa1 has two vital functions – promotion of the initial phase of differentiation from mesenchymal stem cells to pre-osteoblasts and inhibition of pre-osteoblast differentiation to mature osteoblasts (52). As expected, in the present study, rats displayed decreased mRNA expression of Cbfa1 in the femur post-SCI. However, CoQ10 rescued Cbfa1 mRNA expression and promoted bone matrix production.

In conclusion, treatment with CoQ10 mitigated the bone loss in rats following SCI by increasing BMD and BMC levels, attenuating oxidative stress, debilitating the cytokine levels, depressing RANKL and cathepsin K expression, as well as restoring Cbfa1 mRNA levels. Thus, CoQ10 may be an effective nutraceutical to ameliorate osteoporosis after SCI. However, further molecular studies are warranted to explore the feasibility of using CoQ10 as an anti-osteoporotic agent.

References

1 

Carlson GD and Gorden C: Current developments in spinal cord injury research. Spine J. 2:116–128. 2002. View Article : Google Scholar

2 

Becker D, Sadowsky CL and McDonald JW: Restoring function after spinal cord injury. Neurologist. 9:1–15. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Bao F, Brown A, Dekaban GA, Omana V and Weaver LC: CD11d integrin blockade reduces the systemic inflammatory response syndrome after spinal cord injury. Exp Neurol. 231:272–283. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Balentine JD: Pathology of experimental spinal cord trauma I. The necrotic lesion as a function of vascular injury. Lab Invest. 39:236–253. 1978.PubMed/NCBI

5 

Wrathall JR, Teng YD and Choiniere D: Amelioration of functional deficits from spinal cord trauma with systemically administered NBQX, an antagonist of non-N-methyl-D-aspartate receptors. Exp Neurol. 137:119–126. 1996. View Article : Google Scholar : PubMed/NCBI

6 

Bao F, John SM, Chen Y, Mathison RD and Weaver LC: The tripeptide phenylalanine-(d) glutamate-(d) glycine modulates leukocyte infiltration and oxidative damage in rat injured spinal cord. Neuroscience. 140:1011–1022. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Liu NK, Zhang YP, Titsworth, et al: A novel role of phospho-lipase A2 in mediating spinal cord secondary injury. Ann Neurol. 59:606–619. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Jiang SD, Jiang LS and Dai LY: Mechanisms of osteoporosis in spinal cord injury. Clin Endocrinol (Oxf). 65:555–565. 2006. View Article : Google Scholar

9 

Morse L, Teng YD, Pham L, et al: Spinal cord injury causes rapid osteoclastic resorption and growth plate abnormalities in growing rats (SCI-induced bone loss in growing rats). Osteoporos Int. 19:645–652. 2008. View Article : Google Scholar

10 

Jiang SD, Jiang LS and Dai LY: Spinal cord injury causes more damage to bone mass, bone structure, biomechanical properties and bone metabolism than sciatic neurectomy in young rats. Osteoporos Int. 17:1552–1561. 2006. View Article : Google Scholar : PubMed/NCBI

11 

Needham-Shropshire BM, Broton JG, Klose KJ, Lebwohl N, Guest RS and Jacobs PL: Evaluation of a training program for persons with SCI paraplegia using the Parastep 1 ambulation system, part 3: lack of effect on bone mineral density. Arch Phys Med Rehabil. 78:799–803. 1997. View Article : Google Scholar : PubMed/NCBI

12 

Giangregorio LM, Hicks AL, Webber CE, et al: Body weight supported treadmill training in acute spinal cord injury: impact on muscle and bone. Spinal Cord. 43:649–657. 2005. View Article : Google Scholar : PubMed/NCBI

13 

Matsumura T, Saji S, Nakamura R and Folkers K: Evidence for enhanced treatment of periodontal disease by therapy with coenzyme Q. Intl J Vitamin Nutr Res. 43:537–548. 1973.

14 

Deichmann R, Lavie C and Andrews S: Coenzyme q10 and statin-induced mitochondrial dysfunction. Ochsner J. 10:16–21. 2010.

15 

Kalayci M, Unal MM, Gul S, et al: Effect of coenzyme Q10 on ischemia and neuronal damage in an experimental traumatic brain-injury model in rats. BMC Neurosci. 12:752011. View Article : Google Scholar : PubMed/NCBI

16 

Kerimoğlu A, Paşaoğlu O, Kanbak G, Hanci V, Ozdemir F and Atasoy MA: Efficiency of coenzyme Q (10) at experimental spinal cord injury. Ulus Travma Acil Cerrahi Derg. 13:85–93. 2007.In Turkish.

17 

Kömürcü E, Oktay M, Kaymaz B, Hatay Gölge U, Göksel F and Nusran G: Preventive effects of coenzyme Q10 (CoQ10) on steroid-induced osteonecrosis in rats. Acta Orthop Traumatol Turc. 48:217–222. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Moon HJ, Ko WK, Han SW, Kim DS, Hwang YS, Park HK and Kwon IK: Antioxidants, like coenzyme Q10, selenite and curcumin, inhibited osteoclast differentiation by suppressing reactive oxygen species generation. Biochem Biophys Res Commun. 418:247–253. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Basso DM, Beattie MS and Bresnahan JC: Graded histological and locomotor outcomes after spinal cord contusion using the NYU weight-drop device versus transection. Exp Neurol. 139:244–256. 1996. View Article : Google Scholar : PubMed/NCBI

20 

Jo HJ and Choi M: Effects of isoflavone supplementation on the bone mineral density of growing female rats. Nutr Res Pract. 2:68–73. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Kakkar P, Das B and Viswanathan PN: A modified spectrophoto-metric assay of superoxide dismutase. Indian J Biochem Biophys. 21:130–132. 1984.PubMed/NCBI

22 

Ohkawa H, Ohishi N and Yagi K: Assay for lipid peroxidation in animal tissues by thiobarbituric acid reaction. Anal Biochem. 95:351–358. 1979. View Article : Google Scholar : PubMed/NCBI

23 

Lloyd M: Treatment of postmenopausal osteoporosis. N Engl J Med. 338:739–746. 1998.

24 

Rodan GA and Martin TJ: Therapeutic approaches to bone diseases. Science. 289:1508–1514. 2000. View Article : Google Scholar : PubMed/NCBI

25 

Rachner TD, Khosla S and Hofbauer LC: Osteoporosis: now and the future. Lancet. 377:1276–1287. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Jiang SD, Jiang LS and Dai LY: Changes in bone mass, bone structure, bone biomechanical properties and bone metabolism after spinal cord injury: a 6-month longitudinal study in growing rats. Calcif Tissue Int. 80:167–175. 2007. View Article : Google Scholar : PubMed/NCBI

27 

Liu D, Zhao CQ, Li H, Jiang SD, Jiang LS and Dai LY: Effects of spinal cord injury and hindlimb immobilization on sublesional and supralesional bones in young growing rats. Bone. 43:119–125. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Giangregorio LM, Craven BC and Webber CE: Musculoskeletal changes in women with spinal cord injury: a twin study. J Clin Densitom. 8:347–351. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Schmid A, Huonker M, Stahl F, et al: Free plasma catecholamines in spinal cord injured persons with different injury levels at rest and during exercise. J Auton Nerv Syst. 68:96–100. 1998. View Article : Google Scholar : PubMed/NCBI

30 

Vaziri ND, Pandian MR, Segal JL, Winer RL, Eltorai I and Brunnemann S: Vitamin D, parathormone and calcitonin profiles in persons with long-standing spinal cord injury. Arch Phys Med Rehabil. 75:766–769. 1994.PubMed/NCBI

31 

Morse LR, Xu Y, Solomon B, et al: Severe spinal cord injury causes immediate multi-cellular dysfunction at the chondro-osseous junction. Transl Stroke Res. 2:643–650. 2011. View Article : Google Scholar

32 

Pietschmann P, Pils P, Woloszczuk W, Maerk R, Lessan D and Stipicic J: Increased serum osteocalcin levels in patients with paraplegia. Paraplegia. 30:204–209. 1992. View Article : Google Scholar : PubMed/NCBI

33 

Morse L, Teng YD, Pham L, et al: Spinal cord injury causes rapid osteoclastic resorption and growth plate abnormalities in growing rats (SCI-induced bone loss in growing rats). Osteoporos Int. 19:645–652. 2008. View Article : Google Scholar

34 

Majumdar S, Kothari M, Augat P, et al: High-resolution magnetic resonance imaging: three-dimensional trabecular bone architecture and biomechanical properties. Bone. 22:445–454. 1998. View Article : Google Scholar : PubMed/NCBI

35 

Jia Z, Zhu H, Li J, Wang X, Misra H and Li Y: Oxidative stress in spinal cord injury and antioxidant-based intervention. Spinal Cord. 50:264–274. 2012. View Article : Google Scholar

36 

Sun Y, Shuang F, Chen DM and Zhou RB: Treatment of hydrogen molecule abates oxidative stress and alleviates bone loss induced by modeled microgravity in rats. Osteoporos Int. 24:969–978. 2013. View Article : Google Scholar

37 

Fouad AA, Al-Sultan AI, Refaie SM and Yacoubi MT: Coenzyme Q10 treatment ameliorates acute cisplatin nephrotoxicity in mice. Toxicology. 274:49–56. 2010. View Article : Google Scholar : PubMed/NCBI

38 

Demulder A, Guns M, Ismail A, Wilmet E, Fondu P and Bergmann P: Increased osteoclast-like cells formation in long-term bone marrow cultures from patients with a spinal cord injury. Calcif Tissue Int. 63:396–400. 1998. View Article : Google Scholar : PubMed/NCBI

39 

Lee J, Hong YS, Jeong JH, et al: Coenzyme Q10 ameliorates pain and cartilage degradation in a rat model of osteoarthritis by regulating nitric oxide and inflammatory cytokines. PLoS One. 8:e693622013. View Article : Google Scholar : PubMed/NCBI

40 

Jin HJ, Xue Y, Chen G and Wu ZY: Effect of coenzyme Q10 on the expression of tumor necrosis factor-α and interleukin-10 in gingival tissue of experimental periodontitis in rats. Zhonghua Kou Qiang Yi Xue Za Zhi. 48:660–663. 2013.In Chinese.

41 

Fouad AA and Jresat I: Hepatoprotective effect of coenzyme Q10 in rats with acetaminophen toxicity. Environ Toxicol Pharmacol. 33:158–167. 2012. View Article : Google Scholar : PubMed/NCBI

42 

Lacey DL, Timms E, Tan HL, et al: Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell. 93:165–176. 1998. View Article : Google Scholar : PubMed/NCBI

43 

Hsu H, Lacey DL, Dunstan CR, et al: Tumor necrosis factor receptor family member RANK mediates osteoclast differentiation and activation induced by osteoprotegerin ligand. Proc Natl Acad Sci USA. 96:3540–3545. 1999. View Article : Google Scholar : PubMed/NCBI

44 

Simonet WS, Lacey DL, Dunstan CR, et al: Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell. 89:309–319. 1997. View Article : Google Scholar : PubMed/NCBI

45 

Moon HJ, Ko WK, Jung MS, et al: Coenzyme q10 regulates osteoclast and osteoblast differentiation. J Food Sci. 78:H785–H891. 2013. View Article : Google Scholar : PubMed/NCBI

46 

Brömme D and Okamoto K: Human cathepsin O2, a novel cysteine protease highly expressed in osteoclastomas and ovary molecular cloning, sequencing and tissue distribution. Biol Chem Hoppe Seyler. 376:379–384. 1995. View Article : Google Scholar

47 

Ho N, Punturieri A, Wilkin D, et al: Mutations of CTSK result in pycnodysostosis via a reduction in cathepsin K protein. J Bone Miner Res. 14:1649–1653. 1999. View Article : Google Scholar : PubMed/NCBI

48 

Johnson MR, Polymeropoulos MH, Vos HL, Oetiz De Luna RI and Francomano CA: A nonsense mutation in the cathepsin K gene observed in a family with pycnodysostosis. Genome Res. 6:1050–1055. 1996. View Article : Google Scholar : PubMed/NCBI

49 

Saftig P, Hunziker E, Wehmeyer O, et al: Impaired osteoclastic bone resorption leads to osteopetrosis in cathepsin-K-deficient mice. Proc Natl Acad Sci USA. 95:13453–13458. 1998. View Article : Google Scholar : PubMed/NCBI

50 

Pennypacker BL, Oballa RM, Levesque S, Kimmel DB and Duong le T: Cathepsin K inhibitors increase distal femoral bone mineral density in rapidly growing rabbits. BMC Musculoskelet Disord. 14:3442013. View Article : Google Scholar : PubMed/NCBI

51 

Xiao G, Jiang D, Ge C, et al: Cooperative interactions between activating transcription factor 4 and Runx2/Cbfa1 stimulate osteoblast-specific osteocalcin gene expression. J Biol Chem. 280:30689–30696. 2005. View Article : Google Scholar : PubMed/NCBI

52 

Liu W, Toyosawa S, Furuichi T, et al: Overexpression of Cbfa1 in osteoblasts inhibits osteoblast maturation and causes osteopenia with multiple fractures. J Cell Biol. 155:157–166. 2001. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

September 2015
Volume 12 Issue 3

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Zhang, X., Qian, K., Zhang, Y., Wang, Z., Yu, Y., Liu, X. ... Zhang, D. (2015). Efficacy of coenzyme Q10 in mitigating spinal cord injury‑induced osteoporosis. Molecular Medicine Reports, 12, 3909-3915. https://doi.org/10.3892/mmr.2015.3856
MLA
Zhang, X., Qian, K., Zhang, Y., Wang, Z., Yu, Y., Liu, X., Cao, X., Liao, Y., Zhang, D."Efficacy of coenzyme Q10 in mitigating spinal cord injury‑induced osteoporosis". Molecular Medicine Reports 12.3 (2015): 3909-3915.
Chicago
Zhang, X., Qian, K., Zhang, Y., Wang, Z., Yu, Y., Liu, X., Cao, X., Liao, Y., Zhang, D."Efficacy of coenzyme Q10 in mitigating spinal cord injury‑induced osteoporosis". Molecular Medicine Reports 12, no. 3 (2015): 3909-3915. https://doi.org/10.3892/mmr.2015.3856