Transcriptomic study of high‑glucose effects on human skin fibroblast cells

  • Authors:
    • Lingxia Pang
    • Youpei Wang
    • Meiqin Zheng
    • Qing Wang
    • Hong Lin
    • Liqing Zhang
    • Lingjian Wu
  • View Affiliations

  • Published online on: January 28, 2016     https://doi.org/10.3892/mmr.2016.4822
  • Pages: 2627-2634
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Skin ulcers are a common complication of diabetes mellitus (DM). Fibroblasts are located within the dermis of skin tissue and can be damaged by diabetes. However, the underlying mechanism of how DM affects fibroblasts remains elusive. To understand the effects of DM on fibroblasts, the current study mimicked DM by high‑glucose (HG) supplementation in the culture medium of human foreskin primary fibroblast cells, and the analysis of transcriptomic changes was conducted. RNA sequencing‑based transcriptome analysis identified that, upon HG stress, 463 genes were upregulated and 351 genes downregulated (>1.5‑fold changes; P<0.05). These altered genes were distributed into 20 different pathways. In addition, gene ontology (GO) analysis indicated that 31 GO terms were enriched. Among the pathways identified, nuclear factor κB (NF‑κB) pathway genes were highly expressed, and the addition of Bay11‑7082, a typical NF‑κB signaling inhibitor, blocked the previously observed alterations in plasminogen activator inhibitor 1 (PAI1), an inflammation marker and frizzled class receptor 8 (FZD8), a Wnt signaling gene, expression that resulted from HG stress. Furthermore, an inhibitor of Wnt signaling diminished the role of Bay11‑7082 in the regulation of PAI1 expression under HG conditions, suggesting that Wnt signaling may function downstream of the NF‑κB pathway to protect fibroblast cells from HG stress. To the best of our knowledge, the current study is the first analysis of transcriptomic responses under HG stress in human fibroblasts. The data provided here may aid the understanding of the molecular mechanisms by which fibroblast cells are damaged in the skin of patients with DM.

Introduction

Diabetes mellitus (DM) is the most severe metabolic disease in the developed world, affecting a large number of people. A major symptom of DM is hyperglycemia, which leads to severe complications (1). Among patients with DM, ~15% exhibit impaired skin wound healing (2), and high blood sugar is linked to skin ulceration by altering angiogenesis (3), but the underlying mechanism remains unclear.

Skin wound repair requires the coordination of several cell types, including keratinocytes, fibroblasts, endothelial cells, macrophages and platelets. Fibroblast cell proliferation and migration, collagen deposition and remodeling, wound contraction and angiogenesis are important steps during wound repair (4,5). Extracellular matrix (ECM) forms the largest component of the dermal skin layer, therefore, the repair of damaged ECM is a key step for wound healing (6). Fibroblasts constitute one of the important cell layers that participate in the production and remodeling the ECM and fibroblast proliferation and migration are important for the formation of granulation tissue and further skin repair (7,8). The impaired wound healing during DM is attributed to altered protein and lipid metabolism and the associated abnormal formation of granulation tissue (9). Higher glucose levels in the blood result in abnormal attachment of aldose sugars to a protein or lipid, which affects normal glycosylation modifications (9). The aberrantly glycosylated products [advanced glycation end products (AGEs)] then accumulate in cells. AGEs attached to ECM proteins may lead to a reduction in their turnover rate (9). Nitric oxide (NO) is an important mediator of cell proliferation, maturation and differentiation and serves a key role in wound healing (10). Fibroblasts isolated from diabetic ulcers are usually large and widely spread during in vitro culture compared with normal fibroblasts in age-matched controls. They often exhibit abnormal endoplasmic reticulum, increased numbers of vesicular bodies and lost microtubular structure. Therefore, DM affects protein turnover, autonomous trafficking and normal protein secretion in diabetic ulcer fibroblasts (11,12). Fibroblasts from diabetic ulcers have defects in cell proliferation, which may result in decreased ECM protein production and further delayed wound healing (13). High glucose-induced fibroblast migration was previously identified to be a result of reduced JNK activity (14). However, few molecular studies have investigating the underlying mechanisms of DM-mediated fibroblast cell damage.

In the present study, RNA sequencing (RNA-Seq) was used to analyze the alterations of large numbers of transcripts following HG stimulation of human fibroblast cells, and the genes and pathways associated with HG stress were identified. Additionally, the inflammatory response pathway and Wnt signaling were further analyzed for their role in the protection of fibroblasts from HG damage. The results of current study may be important for understanding the mechanisms of DM-mediated skin ulceration and may provide a theoretical basis for repair of skin damage in patients with DM in the future.

Materials and methods

Human foreskin fibroblast cell culture

Human fibroblast cells were isolated and subsequently cultured for analysis of the effects of HG treatment. All the procedures followed for purification and culture of human fibroblasts were described by Xuan et al (14). Human foreskin samples were collected from 3 patients in Department of Dermatology, the First Affiliated Hospital, Wenzhou Medical University (Wenzhou, China). This study was approved by the ethics committee of Wenzhou Medical University (Wenzhou, China) and written informed consent was obtained from all the patients involved. The fat was removed from the tissue and was cut into 3 by 2 mm strips and were incubated overnight at 4°C in 0.05% Dispase I (Sigma-Aldrich, St. Louis, MO, USA). The epidermis was removed and the dermis was placed in 25-cm2 flasks pre-treated with FBS, and placed horizontally for 1 h and then vertically for 3 h in a culture chamber with 5% CO2 at 37°C. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM; HyClone; GE Healthcare Life Sciences, Logan, UT, USA) containing 5.5 mM glucose with 10% fetal bovine serum (FBS; HyClone; GE Healthcare Life Sciences) and 1% penicillin-streptomycin (Gibco; Thermo Fisher Scientific Inc., Watham, MA, USA) the medium was changed every 3 days. When cell confluence reached 70–80% the cells were digested and passaged with 0.25% trypsin (Gibco; Thermo Fisher Scientific Inc.) Cells were cultured for 3 days in 5.5 mM glucose medium and transferred to the media containing either 5.5 mM glucose (LG) or 30 mM glucose (HG). Cells at passage 3–6 were used for the LG and HG treatment. Cells were harvested after 1 h of LG and HG treatment.

Cell proliferation assay

Cell proliferation was assayed using a Cell Counting Kit-8 (CCK-8) kit (Dojindo Molecular Technologies, Inc., Kumamoto, Japan). The fibroblast cell culture and measurement of cell densities under different treatments were followed as previously described (14). In summary, 50 ml of the cell resuspension solution (1×103 cells/well) were transferred into 96-well plates following digestion with trypsin, and five parallel wells were used for each treatment. Subsequent to attachment to the culture plate, the cells were subjected to the different glucose treatments for 72 h in a 5% CO2 incubator at 37°C. Then, 5 ml of CCK-8 was added to each well, and the cells were cultured for another 3 h. Cell density was determined by quantifying the absorbance at 450 nm using a Varioskan Flash Multimode Reader (Thermo Fisher Scientific, Inc.) using the following formula: Cell dens ity=(Acell+CCK8+medium-ACCK8+medium/Acell+CCK8-ACCK8+medium) × 100.

RNA deep sequencing

Total RNA was extracted from human foreskin fibroblasts for RNA-Seq experiments following treatment with a low (5.5 mM) or high (30 mM) concentration of glucose. RNA-Seq experiments and data analysis were performed by the NovelBio Bio-Pharm Technology Co., Ltd. (Shanghai, China). The RNA-Seq data is available upon request.

Analysis of the pathway and gene ontology (GO) category

Differentially expressed genes were identified by analyzing for association with biological process gene ontology (GO) terms (15). Fisher's exact test was used to classify the GO category, and the false discovery rate (FDR) was calculated to correct the P-value (16). Enrichment of GO members among differentially expressed gene sets was identified using the one-tailed Fisher's exact test for 2×2 contingency tables (17), which measures the significance of the function that as the enrichment increases, the corresponding function is more specific, which aids the identification of GOs with a more concrete function description in the experiment. Pathway analysis was used to determine the significant pathways of the differential genes according to Kyoto Encyclopedia of Genes and Genomes (KEGG) (18), BioCarta (http://cgap.nci.nih.gov/Pathways/BioCarta_Pathways and Reactome (19). Fisher's exact test was followed by Benjamini-Hochberg multiple testing correction to select the significant pathway and the threshold of significance was defined by P-value and FDR (20).

Total RNA extraction, cDNA synthesis and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from stimulated or unstimulated fibroblasts treated with high-concentration glucose (30 mM), Bay11-7082 (0.5 μM; Sigma-Aldrich) or inhibitor of Wnt response (IWR) (0.5 μM; Sigma-Aldrich). The cell monolayer was rinsed with ice-cold phosphate-buffered saline once. Each sample was treated with RQ1-DNAse (Promega Corporation, Madison, WI, USA). The cells were then lysed directly in a culture dish by adding 1 ml TRIzol (Thermo Fisher Scientific, Inc.) per each 3.5 cm diameter dish, scraped with a cell scraper and then 0.2 ml chloroform was added per 1 ml TRIzol. RNA (2 μg) was reverse transcribed at 42°C for 60 min, 70°C for 5 min and following stop the reaction at 8°C using a GoScript Reverse Transcription System (Promega Corporation) following the manufacturer's protocol. A SYBR Green Master Mix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used to perform the qPCR on an Illumina Eco 3.0 (Illumina, Inc., San Diego, CA, USA). A typical reaction consisted of an initial denaturation at 95°C for 3 min, followed by 40 cycles of denaturation for 30 sec at 95°C, annealing for 30 sec at 58°C, and extension at 72°C for 30 sec, followed by a final extension at 72°C for 5 min. The transcription levels were normalized against those of GAPDH using the 2−ΔΔCq method (21). The gene-specific primer sequences used for RT-qPCR are described in Table I. Each experiment was repeated at least 3 times. A unreversed transcribed RNA was used as a PCR template control.

Table I

Reverse transcription-quantitative polymerase chain reaction primer sequences.

Table I

Reverse transcription-quantitative polymerase chain reaction primer sequences.

PrimerSequence
Caspase 3F: TGATGATGACATGGCGTGTC
R: GTTGCCACCTTTCGGTTAAC
PAI1F: GAGACTGAAGTCGACCTCAG
R: CTGTCCATGATGATCTCCTC
GAPDHF: GACCTGCCGTCTAGAAAAAC
R: CTGTAGCCAAATTCGTTGTC
CCL13F: CGTCCCATCTACTTGCTGCT
R: TCAAGTCTTCAGGGTGTGAGC
IL8F: GGTGCAGTTTTGCCAAGGAG
R: TTCCTTGGGGTCCAGACAGA
FZD8F: CTGGTGGAGATCCAGTGCTC
R: TTGTAGTCCATGCACAGCGT
EGR2F: TCGCAAGTACCCCAACAGAC
R: CTCATCACTCCGGGCAAACT

[i] PAI1, plasminogen activator inhibitor 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CCL13, chemokine (C-C motif) ligand 13; IL8, interleukin 8; FZD8, frizzled class receptor 8; EGR2, early growth response 2.

Western blot analysis

For extraction of total protein, the cells were lysed in an ice-cold lysis solution containing 7 M urea, 2 Mthiourea, 2% CHAPS detergent, 40 mM Trizma base, 40 mM dithiothreitol, 1% protease inhibitor, the lysates were centrifuged for 15 min at 15,000 × g. All reagents were sourced from Sigma-Aldrich. The supernatant from each tube was moved to a new tube. The total proteins were separated on a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis gel (Sigma-Aldrich) at 100 V for 2 h following extraction. Then transferred onto Immobilon-P Transfer Membranes (Merck Millipore, Tokyo, Japan). The membranes were incubated in Tris-buffered saline containing 5% skimmed milk and 0.05% Tween-20 (EMD Milipore, Billerica, MA, USA) for 1–2 h and reacted with the corresponding primary antibodies at 4°C overnight. The following primary antibodies were purchased from Abcam, all at dilution of 1:2,000 (Cambridge, MA, USA): p-IKBα (mouse monoclonal; cat no. 39A1431, reactivity - mouse, rat, cow, human), IKBα (rabbit polyclonal; cat no. ab7217; reactivity - mouse, rat, human) and GAPDH (mouse monoclonal; cat no. mAbcam 9484; reactivity - mouse, rat, rabbit, chicken, cow, dog, human, pig). The membranes were incubated for 1 h with an anti-mouse or polyclonal anti-rabbit horseradish peroxidase-linked secondary antibody (cat. no. 7074; 1:2,000; Cell Signaling Technology, Inc., Danvers, MA, USA).

Statistical analysis

Statistical calculations were performed with Prism 5 software package (GraphPad Software, Inc., La Jolla, CA, USA). Significant differences are expressed as the mean ± standard error. The comparison between two groups was analyzed by t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

HG induces apoptosis and inflammatory responses in fibroblasts

To simulate diabetes, HG was utilized to study its effects on the fibroblasts (22). To analyze the effects of different concentrations of HG on fibroblasts, cell proliferation was monitored in different concentrations of glucose-containing media with 10% fetal bovine serum. HG treatment up to 30 mM did not markedly alter cell proliferation, whilst culture in 50 and 70 mM glucose significantly inhibited cell proliferation compared with culture in low-glucose (LG; 5.5 mM; P<0.01; Fig. 1A). However, this concentration of glucose is much higher than the levels recorded in patients' blood; therefore, 20 and 30 mM were used to further analyze gene expressions. Compared to 30 mM, 20 mM of glucose did not significantly affect the expression levels of caspase 3 and PAI1 (data not shown). Therefore, 30 Mm of glucose was selected for transcriptome analysis. As presented in Fig. 1A, 30 mM glucose treatment did not affect cell proliferation activity, thus, the expression levels of two apoptosis and inflammation marker genes, caspase 3 and plasminogen activator inhibitor 1 (PAI1), were further monitored at this concentration. RT-qPCR results indicated that the application of 30 mM glucose led to an increase in the expression levels of caspase 3 and PAI1 following 3-h treatment, which reached a peak at 6 h (Fig. 1B). These data indicate that HG culture damages fibroblast cells.

Identification of HG-regulating transcriptome in fibroblasts

To identify HG-regulated genes and pathways, RNA-Seq experiments were performed using human fibroblast cells cultured in LG (5.5 mM) and HG (30 mM). Since Caspase 3 and PAI1 expression levels were highest at 6 h subsequent to HG stress, the fibroblast cells stimulated for 6 h with LG and HG were collected for RNA-Seq analysis. The RNA-Seq results demonstrated that 814 genes were differentially expressed (>1.5-fold change; P<0.05) in the HG-treated fibroblasts compared with LG-treated cells. Among them, 351 genes were downregulated, and 463 genes were upregulated (Fig. 2A), determined from statistical outcomes by analysis for association with biological process GO terms. To verify the RNA-Seq data, HG-mediated expression levels of the following four genes were assessed by RT-qPCR: Interleukin 8 (IL8), chemokine (C-C motif) ligand 13 (CCL13), frizzled class receptor 8 (FZD8) and early growth receptor 2 (EGR2). The inflammatory response genes (IL8 and CCL13) were upregulated, while the Wnt signaling gene (FZD8) and putative SUMO E3 ligase (EGR2) were repressed by HG stimulation, and the RT-qPCR results were similar to RNA-Seq data (Fig. 2B). GO analysis indicated that 31 GO terms were enriched (P<0.01; Table II). These genes were associated with multiple biological processes, including cellular triglyceride homeostasis, positive regulation of cholesterol efflux, the canonical Wnt signaling pathway and transcription (Table II). Further pathway analysis was performed with 814 genes that were altered by HG stress. The results demonstrated that these genes were divided into 20 different pathways, including NF-κB, tumor necrosis factor (TNF), Wnt, ECM/receptor interaction and hedgehog signaling pathways. Among them, certain inflammatory response pathways involving NF-κB and TNF were upregulated by HG stress, while Wnt signaling genes were downregulated (Table III). Together, these data indicate that HG regulates a large number of genes involved in various biological processes.

Table II

GO classification.

Table II

GO classification.

GO IDGO termEnrichment(−log2P) Up/downregulated
0071371Cellular response to gonadotropin stimulus19.1289910.23295Up
0034421Post-translational protein acetylation63.763319.872556Up
0071320Cellular response to cAMP9.5644979.733907Up
0001508Regulation of action potential15.940839.562348Up
0050890Cognition15.101849.362226Up
0034088Maintenance of mitotic sister chromatid cohesion47.822499.297728Up
0006642Triglyceride mobilization38.257998.822425Up
0035356Cellular triglyceride homeostasis38.257998.822425Up
0071356Cellular response to tumor necrosis factor7.5015668.538068Up
0042471Ear morphogenesis31.881668.417503Up
0042158Lipoprotein biosynthetic process31.881668.417503Up
0045444Fat cell differentiation6.5962057.912633Up
0048752Semicircular canal morphogenesis23.911247.753206Up
0030728Ovulation23.911247.753206Up
0006955Immune response2.6106577.576953Up
0006351Transcription, DNA-templated1.6286937.526714Up
0042472Inner ear morphogenesis5.7101477.220235Up
0010875Positive regulation of cholesterol efflux17.389996.989887Up
0002237Response to molecule of bacterial origin17.389996.989887Up
0006334Nucleosome assembly7.59854321.94307Down
0035115Embryonic forelimb morphogenesis12.565313.38364Down
0007275Multicellular organism development2.14941911.51722Down
0032688Negative regulation of interferon-beta production53.611949.387513Down
0060675Ureteric bud morphogenesis53.611949.387513Down
2001181Positive regulation of interleukin-10 secretion53.611949.387513Down
0048706Embryonic skeletal system development8.2479918.969668Down
0009952Anterior/posterior pattern specification4.6845388.623385Down
0060070Canonical Wnt signaling pathway5.1549948.014638Down
0010042Response to manganese ion26.805977.938039Down
0009954Proximal/distal pattern formation10.052247.809469Down
0046628Positive regulation of insulin receptor signaling pathway22.976557.587427Down

[i] GO, gene ontology.

Table III

Pathway classification.

Table III

Pathway classification.

Pathway IDPathway termEnrichment(−log2P) Up/downregulated
05034Alcoholism8.3987532.3993Up
05322Systemic lupus erythematosus9.12907629.151Up
05217Basal cell carcinoma7.63522710.23381Up
04512ECM-receptor interaction4.7720177.471521Up
04916Melanogenesis4.1577976.698221Up
04390Hippo signaling pathway3.272246.165099Up
05203Viral carcinogenesis2.8401575.914846Up
05202Transcriptional misregulation in cancer2.7995835.229064Up
04910Insulin signaling pathway2.9573064.892077Up
04340Hedgehog signaling pathway4.499334.869559Up
04977Vitamin digestion and absorption6.9989584.700239Up
04064NF-κB signaling pathway6.152938.938564Up
04668TNF signaling pathway5.0901527.82519Up
04060Cytokine-cytokine receptor interaction3.8032089.593708Down
04310Wnt signaling pathway2.744694.521127Down
05202Transcriptional misregulation in cancer3.7327786.955703Down
05166HTLV-I infection2.946936.11439Down
04621NOD-like receptor signaling pathway5.4185485.528479Down
05132Salmonella infection3.9523534.424635Down
05161Hepatitis B3.0680374.341831Down

[i] ECM, extracellular matrix; NF-κB, nuclear factor κB; TNF, tumor necrosis factor; HTLV-I, human T-lymphotropic virus 1; NOD, nucleotide-binding oligomerization domain.

Regulatory role of the inflammatory response in HG-mediated fibroblast cell damage

The NF-κB pathway was identified to be involved in HG-regulated biological processes, the effect of the inflammatory response in HG-mediated fibroblast cell damage was further examined. To further evaluate the effects of HG on NF-κB signaling, the activity of IκBα, the most characterized and studied NF-κB regulator, was examined. IκBα is phosphorylated by IκB kinases (IKK), resulting in the translocation of NF-κB to the nucleus and transcription of target genes (23). Western blot analysis indicated that HG induced IκBα phosphorylation (p-IκBα), but did not change total IκBα (t-IκBα) levels (Fig. 3A). To further analyze the effect of the inflammatory response on HG-mediated gene expression, a combination of HG stress and Bay11-7082 (0.5 μM), a representative NF-κB pathway inhibitor, was used to treat fibroblasts. RNA was extracted and RT-qPCR was performed to monitor PAI1 gene expression. The results indicated that HG induced an increase in PAI1 mRNA levels at 3 (P<0.05), 6 and 12 h (P<0.01) compared with the levels observed at 0 h, and this induction was blocked by inhibiting NF-κB with Bay11-7082 (Fig. 3B). Taken together, these results suggest that the inflammatory response is inversely correlated with HG-regulated gene expression.

Wnt signaling is downstream of the NF-κB pathway

Wnt signaling is known to regulate diverse aspects of numerous biological processes (24). The RNA-Seq data from the present study demonstrated repressed expression of a number of Wnt signaling genes following HG stimulation in fibroblasts. NF-κB pathway inhibition partially rescued HG-mediated fibroblast damage. Therefore, the relationship between NF-κB and Wnt signaling were investigated further. In the fibroblast cells stimulated with Bay11-7082 (0.5 μM) and HG, expression levels of the Wnt signaling gene, FZD8, were similar to the levels in the LG cells (P>0.05; Fig. 4A). To further evaluate the role of Wnt signaling in HG-mediated gene expression, IWR, a typical Wnt signaling inhibitor, was also used to treated fibroblasts alongside Bay11-7082 and HG culture, then PAI1 gene expression was measured. Notably, IWR application reduced the effect of Bay11-7082 on HG-induced PAI1 expression levels (Fig. 4B). Together, these data demonstrate that NF-κB inhibition blocked the gene expression changes induced by HG. Additionally, Wnt signaling inhibition reversed Bay11-7082-mediated PAI1 repression under HG conditions.

Discussion

Fibroblasts are important for synthesizing ECM and collagen, the structural framework (stroma) for skin tissues, and serve a key role in wound healing (25). Skin wound healing requires the involvement of several cell types, including keratinocytes, fibroblasts, endothelial cells, macrophages and platelets (26). Therefore, understanding the underlying mechanisms by which fibroblast cells protect themselves from DM is important for the treatment of skin ulcers (4). One of the strategies that all living organisms utilize to adapt to environmental changes is the rapid reprogramming of transcriptional regulations via cell signaling mechanisms (2729). Therefore, analysis of transcriptomic changes under certain stress is a method to clarify the regulation of these mechanisms. In the present study, RNA-Seq was utilized to analyze transcriptomes, providing an efficient experimental basis to extract information regarding gene expression, somatic mutations and novel gene fusions (30) using HG-cultured human primary fibroblast cells. The results demonstrated a large population of differentially expressed genes following HG stimulation. Among them, 351 genes were downregulated and 463 were upregulated. Further, analyses of the associated pathways using GO and KEGG databases revealed various biological processes and pathways (Tables II and III).

ECM synthesis is important for skin wound repair. Various genes involved in ECM/receptor interactions were identified as undergoing changes in expression levels following HG stress (data available upon request). Other pathways identified to be altered by HG include NF-κB, TNF, Wnt, Hedgehog and Hippo signaling. The Wnt signaling pathway and fibroblast growth factor (FGF) regulate T-box family transcription factors, control cell fate within the zebrafish tailbud and are involved in axis elongation (31); FGF positively regulates Hedgehog signaling during embryonic tracheal cell migration (32); Hippo signaling and EGFR pathways control growth and activate tumorigenesis when dysregulated. Epidermal growth factor receptor (EGFR) activates Yorkie, a key Hippo pathway transcription factor that has been indicated to influence cell proliferation in Drosophila (33); and bFGF previously inhibited TNF-mediated activation of NF-κB by blocking phosphorylation and degradation of IκBα, leading to the repression of leukocyte adhesion in tumor vessels (34). HG has been demonstrated to affect FGF and downstream JNK activity, resulting in delay to human fibroblast cell migration (14). Therefore, those pathways that are regulated by HG may be partially connected to FGF signaling, which is known to accelerate DM-induced skin wound repair. Further biochemical and molecular studies are required to specify how these pathways are connected.

In the current study, inhibition of the NF-κB pathway through treatment with Bay11-7082 repressed the HG-induced PAI1 levels, suggesting that HG stimulation may activate inflammatory response pathways and cause damage to cells. Notably, Bay11-7082 application reversed the repression of FZD8 expression levels resulting from HG stress.

In addition, treatment with the Wnt signaling inhibitor, IWR, together with Bay11-7082 diminished the effects of Bay11-7082 on PAI1 repression under HG conditions, indicating that Wnt signaling functions downstream of the NF-κB pathway to regulate HG-mediated gene expression. HG stress negatively and positively regulated the NF-κB and Wnt signaling pathways, respectively, and this suggests that Wnt activation is important for the protection of fibroblasts from DM. The present study demonstrated HG-regulated gene expression in fibroblasts, and a link between the NF-κB pathway and Wnt signaling. In the future, these findings may be notable for the treatment of DM-induced skin ulcers.

Acknowledgments

The present study was made possible by an initiative grant from Wenzhou Medical University (Wenzhou, China).

References

1 

Brownlee M: Biochemistry and molecular cell biology of diabetic complications. Nature. 414:813–820. 2001. View Article : Google Scholar : PubMed/NCBI

2 

Yach D, Stuckler D and Brownell KD: Epidemiologic and economic consequences of the global epidemics of obesity and diabetes. Nat Med. 12:62–66. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Braiman-Wiksman L, Solomonik I, Spira R and Tennenbaum T: Novel insights into wound healing sequence of events. Toxicol Pathol. 35:767–779. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Martin P: Wound healing - aiming for perfect skin regeneration. Science. 276:75–81. 1997. View Article : Google Scholar : PubMed/NCBI

5 

Gurtner GC, Werner S, Barrandon Y and Longaker MT: Wound repair and regeneration. Nature. 453:314–321. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Brem H and Tomic-Canic M: Cellular and molecular basis of wound healing in diabetes. J Clin Invest. 117:1219–22. 2007. View Article : Google Scholar : PubMed/NCBI

7 

Wagner W and Wehrmann M: Differential cytokine activity and morphology during wound healing in the neonatal and adult rat skin. J Cell Mol Med. 11:1342–1351. 2007. View Article : Google Scholar

8 

Kanazawa S, Fujiwara T, Matsuzaki S, Shingaki K, Taniguchi M, Miyata S, Tohyama M, Sakai Y, Yano K, Hosokawa K and Kubo T: bFGF regulates PI3-kinase-Rac1-JNK pathway and promotes fibroblast migration in wound healing. PLoS One. 5:e122282010. View Article : Google Scholar : PubMed/NCBI

9 

Goldin A, Beckman JA, Schmidt AM and Creager MA: Advanced glycation end products: Sparking the development of diabetic vascular injury. Circulation. 114:597–605. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Obayashi K, Akamatsu H, Okano Y, Matsunaga K and Masaki H: Exogenous nitric oxide enhances the synthesis of type I collagen and heat shock protein 47 by normal human dermal fibroblasts. J Dermatol Sci. 41:121–126. 2006. View Article : Google Scholar

11 

Loots MA, Lamme EN, Mekkes JR, Bos JD and Middelkoop E: Cultured fibroblasts from chronic diabetic wounds on the lower extremity (non-insulin-dependent diabetes mellitus) show disturbed proliferation. Arch Dermatol Res. 291:93–99. 1999. View Article : Google Scholar : PubMed/NCBI

12 

Rowe DW, Starman BJ, Fujimoto WY and Williams RH: Abnormalities in proliferation and protein synthesis in skin fibroblast cultures from patients with diabetes mellitus. Diabetes. 26:284–290. 1977. View Article : Google Scholar : PubMed/NCBI

13 

Bachschmid MM, Xu S, Maitland-Toolan KA, Ho YS, Cohen RA and Matsui R: Attenuated cardiovascular hypertrophy and oxidant generation in response to angiotensin II infusion in glutaredoxin-1 knockout mice. Free Radic Bio Med. 49:1221–1229. 2010. View Article : Google Scholar

14 

Xuan YH, Huang BB, Tian HS, Chi LS, Duan YM, Wang X, Zhu ZX, Cai WH, Zhu YT, Wei TM, et al: High-glucose inhibits human fibroblast cell migration in wound healing via repression of bFGF-regulating JNK phosphorylation. PLoS One. 9:e1081822014. View Article : Google Scholar : PubMed/NCBI

15 

Gene Ontology Consortium: The gene ontology (GO) project in 2006. Nucleic Acids Res. 34:D322–D326. 2006. View Article : Google Scholar :

16 

Dupuy D, Bertin N, Hidalgo CA, Venkatesan K, Tu D, Lee D, Rosenberg J, Svrzikapa N, Blanc A, Carnec A, et al: Genome-scale analysis of in vivo spatiotemporal promoter activity in Caenorhabditis elegans. Nat Biotechnol. 25:663–668. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Dunnick JK, Brix A, Cunny H, Vallant M and Shockley KR: Characterization of polybrominated diphenyl ether toxicity in Wistar Han rats and use of liver microarray data for predicting disease susceptibilities. Toxicol Pathol. 40:93–106. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Kanehisa M and Goto S: KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 28:27–30. 2000. View Article : Google Scholar

19 

Matthews L, Gopinath G, Gillespie M, Caudy M, Croft D, de Bono B, Garapati P, Hemish J, Hermajakob H, Jassal B, et al: Reactome knowlegdebase of human biological pathways and processes. Nucleic Acids Res. 37:619–622. 2009. View Article : Google Scholar

20 

Draghici S, Khatri P, Tarca AL, Amin K, Done A, Voichita C, Georgescu C and Romero R: A systems biology approach for pathway level analysis. Genome Res. 17:1537–1545. 2007. View Article : Google Scholar : PubMed/NCBI

21 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

22 

Lamers ML, Almeida ME, Vicente-Manzanares M, Horwitz AF and Santos MF: High glucose-mediated oxidative stress impairs cell migration. PLoS One. 6:e228652011. View Article : Google Scholar : PubMed/NCBI

23 

Baeuerle PA: IkappaB-NF-kappaB structures: At the interface of inflammation control. Cell. 95:729–731. 1998. View Article : Google Scholar : PubMed/NCBI

24 

Malinauskas T and Jones EY: Extracellular modulators of Wnt signalling. Curr Opin Struct Biol. 29:77–84. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Krafts KP: Tissue repair: The hidden drama. Organogenesis. 6:225–233. 2010. View Article : Google Scholar

26 

Hinz B: Masters and servants of the force: The role of matrix adhesions in myofibroblast force perception and transmission. Eur J Cell Biol. 85:175–181. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Greenhalgh DG: The role of apoptosis in wound healing. Int J of Biochem Cell Biol. 30:1019–1030. 1998. View Article : Google Scholar

28 

Stashak TS, Farstvedt E and Othic A: Update on wound dressings: Indications and best use. Clin Tech Equine Prac. 3:148–163. 2004. View Article : Google Scholar

29 

Versteeg HH, Heemskerk JW, Levi M and Reitsma PH: New fundamentals in hemostasis. Physiological Reviews. 93:327–358. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Meyerson M, Gabriel S and Getz G: Advances in understanding cancer genomes through second-generation sequencing. Nat Rev Genet. 11:685–696. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Stulberg MJ, Lin A, Zhao H and Holley SA: Crosstalk between Fgf and Wnt signaling in the zebrafish tailbud. Dev Biol. 369:298–307. 2012. View Article : Google Scholar : PubMed/NCBI

32 

Butí E, Mesquita D and Araújo SJ: Hedgehog is a positive regulator of FGF signalling during embryonic tracheal cell migration. PLoS One. 9:e926822014. View Article : Google Scholar : PubMed/NCBI

33 

Reddy BV and Irvine KD: Regulation of Hippo signaling by EGFR-MAPK signaling through Ajuba family proteins. Dev Cell. 24:459–471. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Flati V, Pastore LI, Griffioen AW, Satijn S, Toniato E, D'Alimonte I, Laglia E, Marchetti P, Gulino A and Martinotti S: Endothelial cell anergy is mediated by bFGF through the sustained activation of p38-MAPK and NF-kappaB inhibition. Int J Immunopathol Pharmacol. 19:761–773. 2006.PubMed/NCBI

Related Articles

Journal Cover

March-2016
Volume 13 Issue 3

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Pang L, Wang Y, Zheng M, Wang Q, Lin H, Zhang L and Wu L: Transcriptomic study of high‑glucose effects on human skin fibroblast cells. Mol Med Rep 13: 2627-2634, 2016
APA
Pang, L., Wang, Y., Zheng, M., Wang, Q., Lin, H., Zhang, L., & Wu, L. (2016). Transcriptomic study of high‑glucose effects on human skin fibroblast cells. Molecular Medicine Reports, 13, 2627-2634. https://doi.org/10.3892/mmr.2016.4822
MLA
Pang, L., Wang, Y., Zheng, M., Wang, Q., Lin, H., Zhang, L., Wu, L."Transcriptomic study of high‑glucose effects on human skin fibroblast cells". Molecular Medicine Reports 13.3 (2016): 2627-2634.
Chicago
Pang, L., Wang, Y., Zheng, M., Wang, Q., Lin, H., Zhang, L., Wu, L."Transcriptomic study of high‑glucose effects on human skin fibroblast cells". Molecular Medicine Reports 13, no. 3 (2016): 2627-2634. https://doi.org/10.3892/mmr.2016.4822