Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
March-2016 Volume 13 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2016 Volume 13 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer

  • Authors:
    • Jiwei Cao
    • Gang Xu
    • Jing Lan
    • Qingqing Huang
    • Zuxiong Tang
    • Liping Tian
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou, Jiangsu 215000, P.R. China
  • Pages: 2829-2835
    |
    Published online on: February 2, 2016
       https://doi.org/10.3892/mmr.2016.4842
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Previous studies have demonstrated that abnormal expression levels of PIWI may serve a crucial role in tumorigenesis. However, the pathological role and its association with prognosis remains to be fully elucidated. In the present study, the expression levels of piwi‑like RNA‑mediated gene silencing 1 (HIWI) and piwi‑like RNA‑mediated gene silencing 2 (HILI) in breast cancer tissues were reported to be high. The high expression levels of HIWI are correlated with poor prognosis in detected patients. In addition, by overexpression and interference, it was demonstrated that HIWI promotes the activity of breast cancer cells while depression of HIWI may induce apoptosis of breast cancer cells. It was additionally identified that suppression of HIWI may arrest the cells at the G2/M stage. The expression levels of transforming growth factor‑β receptor (TβR)I, TβRII, cyclin‑dependent kinase (CDK)4, CDK6 and CDK8 were observed to be regulated by HIWI, which indicated a novel mechanism of HIWI in the regulation of breast cancer progression. The present study provides novel insight into the HIWI expression in breast cancer, providing a potential biomarker for assessment of prognosis and therapy of breast cancer.

Introduction

Breast cancer is one of most common causes of cancer-associated mortality worldwide (1). In general, the development stage of breast cancer includes the benign proliferation, precancer and cancer like other types of cancer (1). During the early stages of breast cancer, intervention of the progression of the precancer can eradicate the cancer. Once organisms have entered into the cancer stages, breast cancer has a poor survival rate (3). Thus, accurate and effective specific biomarkers for breast cancer are required for monitoring the progression of breast cancer. At present, the commonly used therapeutic strategies for breast cancer are surgical resection, chemotherapy and radiotherapy (3). However, these treatments have a low long-term survival rate (1). The pathogenesis of cancer is complex, involving genetic, epigenetic and environmental factors (4,5). Thus, improvement in the understanding of the developmental mechanisms would aid in the diagnosis of patients and the development of effective treatment strategies. Studies investigating the epigenetics of cancer may provide a strategy for the identification of diagnostic biomarkers and for novel therapeutic strategies.

In cancer cells, the genomes are often unstable, exhibiting a duplication and/or deletion of genes and deviant epigenetic alterations (5). Previously, epigenetic alterations including mRNA silencing, genome methylation and histone modification during the progression of cancer have been thoroughly investigated (5,6). Genome hypomethylation influences cancer progression by affecting transcription and transposable elements (TEs) (7). Several previous studies have indicated that the methylation levels of oncogenes and tumor suppressor genes are associated with abnormal expression of these genes, and result in increased cancer progression (5–9). In addition, the unstable TEs in genome transfer in the chromosomes have been reported to lead to deleterious mutations and aberrant expression of oncogenes and tumor suppressor genes (4,10). These active TEs contribute to the progression of cancer. Thus, epigenetics may potentially be used for diagnosis and monitoring of prognosis. However, the association between epigenetics and cancer progression remains unclear.

In previous studies, a broad pathway, the PIWI-piRNA pathway, was identified in germline cells from mouse testes (11,12). Subsequent studies demonstrated that this pathway was highly conserved in different organisms, from invertebrates to mammals (13–15). PIWI homologs were initially suggested to be specifically expressed in germline cells. Low and high expression levels of PIWI have been reported to result in reproductive disorders in different animals, including those in flies (14), fish (15), frogs (16) and mammals (17). Previously, studies have identified aberrant expression levels of PIWI in multiple types of human cancer, including ovarian, lung and pancreatic cancer (18,19). In breast, endometrial and gastrointestinal tract cancer, PIWI expression has been detected, while in normal tissues, the expression of PIWI was not observed (20). Thus, it is suggested that PIWI participates in the progression of cancer. In humans, four different homologs, including piwi-like RNA-mediated gene silencing 1 (PIWIL1/HIWI), piwi-like RNA-mediated gene silencing 2 (PIWIL2/HILI), piwi-like RNA-mediated gene silencing 3 (PIWIL3) and piwi-like RNA-mediated gene silencing 4 (PIWIL4/HIWI2) have been identified (13). The function of these different homologs remains to be fully elucidated. HIWI has been regarded as an inducer for tumor growth and mortality (21). The expression of HILI has been identified in different types of cancer cells, including those of breast and cervical cancer (19). PIWIL3 and HIWI2 have been identified in colon cancer alone (22). Thus, the expression profiles and its association with cancer progression require further investigation.

The present study focused upon the expression profile of PIWI homologs during the progression of breast cancer, and in association with the patient prognosis. In addition, by transfection of cells, the effects of overexpression, interference, overexpression reversal and interference reversal of the key PIWI homologs were assayed in the breast cancer cell line MCF-7. Furthermore, the role of HIWI in regulating the expression levels of TβR and cyclin-dependent kinases (CDKs) was investigated in the breast cancer cell line MCF-7.

Materials and methods

Materials

The human tissue samples including normal (n=25), benign (n=19) and malignant (n=8) tissues were obtained from 27 female patients (age, 30–45 years) during tumor resection at the First Hospital Affiliated to Soochow University (Suzhou, China). The tissue type was confirmed pathologically. All patients provided written informed consent and approval was provided by the Ethics Committee of the First Hospital Affiliated to Soochow University. Informed consent was obtained from all patients.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The gene expression in tissues was assayed by RT-qPCR. The total RNAs of the tissue samples were extracted by TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. Subsequently, 1 µg RNA was transcribed to the first-strand cDNA using SuperScript II reverse transcriptase (Invitrogen Life Technologies). The primers used are presented in Table I. β-actin was used as an internal control. RT-qPCR was performed with the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems Life Technologies, Foster City, CA, USA). The PCR conditions were as follows: 94°C for 2 min followed by 40 cycles of 94°C for 15 sec and 60°C for 45 sec. A final extension step was conducted at 72°C for 30 sec. Subsequent to the amplification, melting curve analysis was conducted to confirm the specificity of the amplification products using AB 7500 software, version 2.0.6 (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). For each sample, RT-qPCR reactions were performed in triplicate. The results were analyzed with the 2−ΔΔCt method (23).

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Table I

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

GenePrimer sequence 5′→3′
MAELF: CTGATGATAGAACCAGAGTC
MAELR: GAATCCAAGTCTTAGAGGGC
HIWIF: GAAGCAGCCTGTCTTGGTCAGCCAGCCTG
HIWIR: GAATCAAAGCTCAAACCCCAGTCTC
HILIF: ATCTATATCTGGCTGCTCCTC
HILIR: GATGCAAGATGTGTCCTGAC
PIWIL3F: GGTGATTTGTATCCTGCCCA
PIWIL3R: TGACCATCTCCCACTCCATC
HIWI2F: AATGCTCGCTTTGAACTAGAGAC
HIWI2R: ATTTTGGGGTAGTCCACATTAAATC
TβRIF: TGGCGGGGAGAAGAAGTTG
TβRIR: CTGCTGCTATAAATCCCAGGATG
TβRIIF: AGAAGTCGGATGTGGAAATGGA
TβRIIR: CTGCACCGTTGTTGTCAGTG
CDK4F: CAGGACCTAAGGACATATCTGGA
CDK4R: CTCGGTACCAGAGTGTAACAACC
CDK6F: TGATCAACTAGGAAAAATCTTGGAC
CDK6R: GGCAACATCTCTAGGCCAGT
CDK8F: ATCAGTCGGGCTGGTGCTG
CDK8R: CTTTATCATCCTTCCCATCTTTCC
β-actinF: CACCATGAAGATCAAGATCATTGC
β-actinR: GGCCGGACTCATCGTACTCCTGC

[i] MAEL, maelstrom spermatogenic transposon silencer; HIWI, piwi-like RNA-mediated gene silencing 1; HILI, piwi-like RNA-mediated gene silencing 2; PIWIL3, piwi-like RNA-mediated gene silencing 3; HIWI2, piwi-like RNA-mediated gene silencing 4; TβRI, transforming growth factor-β type I receptor; CDK, cyclin-dependent kinase; F, forward; R, reverse.

Western blot analysis

The tissues were lysed in radioimmunoprecipitation assay buffer (Beyotime Institute of Biotechnology, Haimen, China) on ice and centrifuged at 12,000 × g for 30 min at 4°C to obtain the protein. The extracted proteins were then separated by 15% polyacrylamide gels and transferred onto polyvinylidene difluoride membranes (GE Healthcare Life Sciences, New Orleans, LA, USA). Subsequent to blocking in milk for 1 h, the membranes were incubated with the dilution of primary antibodies overnight at 4°C. The primary antibodies were: Rabbit polyclonal anti-human MAEL (1:500; Abcam, Cambridge, MA, USA; cat. no. ab106713), rabbit polyclonal anti-human HIWI (1:500; Abcam; cat. no. ab12337), rabbit polyclonal anti-human HILI (1:500; Abcam; cat. no. ab181340), rabbit polyclonal anti-human PIWIL3 (1:500; Abcam; cat. no. ab93709), rabbit polyclonal anti-human HIWI2 (1:500; Abcam; cat. no. 180867) and rabbit polyclonal anti-human GAPDH (1:2,000; Abcam; cat. no. ab9485). The samples were washed with phosphate-buffered saline (PBS; Beyotime Institute of Biotechnology) three times and then probed with the goat anti-rabbit horseradish peroxidase (HRP)-conjugated IgG (H+L) secondary antibody (1:2,000; Thermo Fisher Scientific, Inc.; cat. no. 31460) for 1 h at room temperature. The signals were detected using the Bio-Rad ChemiDoc Touch System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Three independent experiments were repeated, with each sample protein normalized to GAPDH.

Cell culture

The MCF-7 cell line was provided by the American Type Culture Collection (Manassas, VA, USA). These cells were incubated in Dulbecco's modified Eagle's medium (DMEM; Gibco Life Technologies, Grand Island, NY, USA), which was supplemented with 10% fetal bovine serum (Invitrogen Life Technologies), at 37°C in an incubator with 5% CO2. The viability of the cells was analyzed using trypan blue exclusion (Sangon Biotech Co., Ltd., Shanghai, China) subsequent to cell culture for 24 h. For the detection of cellular morphology, the cells were grown in glass cover slips for 24 h at 37°C and observed using an inverted microscope (PM-10AD; Olympus Corporation, Tokyo, Japan).

Cell transfection

The interference and overexpression vectors were constructed in order to examine the biophysical properties of the cell line subsequent to knockdown and overexpression of HIWI. The transfection vector was constructed using a plasmid of pcDNA3.1(t) (pc3.1) (Invitrogen Life Technologies) and HIWI. The open reading frame fragment of HIWI was obtained and cloned into pc3.1 between the BamHI and EcoRI sites in order to construct the recombinant plasmids. Subsequent to construction of the plasmids, transfection was conducted using Lipofectamine™ 2000 (Invitrogen Life Technologies) according to the manufacturer's instructions. The cells were cultured in DMEM at 37°C in an incubator and collected at 24 h for the following analysis.

The cells were divided into five groups (5 parallel treatments for each group), including the control (non-treated group), HIWI interference group (1 µg HIWI shRNA plasmid transfection), HIWI overexpression group (1 µg pcDNA3.1(t)-HIWI plasmid transfection), HIWI interference reversal group (1 µg HIWI shRNA plasmid transfection for 12 h followed by 1 µg pcDNA3.1(t)-HIWI plasmid transfection for 12 h) and HIWI overexpression reversal group (1 µg pcDNA3.1(t)-HIWI plasmid transfection for 12 h followed by 1 µg HIWI shRNA plasmid transfection for 12 h).

Flow cytometry

Flow cytometric analysis was used to investigate the apoptosis of the cells. All fluorescence signals of labeled cells were detected using the FACScan flow cytometer (BD Biosciences, San Jose, CA, USA). Using the Annexin V-Fluorescein Isothiocyanate (FITC) Apoptosis Detection kit (BD Biosciences), the phosphatidylserine redistribution in the plasma membranes was measured according to the manufacturer's instructions.

Statistical analysis

All data are presented as the mean ± standard error. The statistical analyses were conducted using SPSS software, version 17.0 (SPSS, Inc., Chicago, IL, USA). The significant differences among the groups were determined by one-way analysis of variance. The Cox's regression analysis based on gene expression and prognostic outcome was performed. The follow-up information for 187 patients for a period of 100 months was collected. The patients were divided into two groups: higher HIWI expression group (mRNA relative expression, >5) and the lower HIWI expression group (mRNA relative expression, >2 but <4). The result was calculated by fitting the predictive prognosis model using SPSS. In addition, expression of HIWI and HILI were analyzed using a Kruskal-Wallis test, followed by Dunn's multiple comparison tests with SPSS. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression levels of HIWI and HILI are increased in malignant breast cancer tissues

In order to investigate the important role of PIWI in breast cancer, RT-qPCR and western blotting were conducted in order to analyze the expression of HIWI, HILI, PIWIL3, HIWI2 and maelstrom spermatogenic transposon silencer (MAEL) in normal breast tissue (n=25), benign breast tumors (n=19) and malignant breast cancer tumors (n=8). The results demonstrated that the relative expression levels of MAEL, HIWI and HILI were significantly higher in malignant breast cancer tissues compared with normal and benign breast tissues (Fig. 1A–C). However, the relative expression levels of PIWIL3 and HIWI2 in malignant breast tissues were not significantly different to the normal and benign breast tissues (Fig. 1D and E). Furthermore, the results of western blotting of these genes were consistent with the results of RT-qPCR (Fig. 1F). The protein expression levels of MAEL, HIWI and HILI in malignant breast cancer were significantly higher than those of normal and benign breast tissues, while no significant differences in PIWIL3 and HIWI2 expression levels were observed between the three tissue groups.

Figure 1

Box plots representing the expression of HIWI pathway genes in normal breast, benign breast cancer and malignant breast cancer tissues. Reverse transcription-quantitative polymerase chain reaction analysis of mRNA expression of (A) MAEL, (B) HIWI, (C) HILI, (D) PIWIL3 and (E) HIWI2. (F) The protein expression levels of HIWI pathway genes in normal breast, benign breast cancer and malignant breast cancer tissues. The Kruskal-Wallis test was performed to compare the gene expression levels between the two groups. Filled dots indicate the mean of each group, *P<0.05. HIWI, piwi-like RNA-mediated gene silencing 1; MAEL, maelstrom spermatogenic transposon silencer; HILI, piwi-like RNA-mediated gene silencing 2; PIWIL3, piwi-like RNA-mediated gene silencing 3; HIWI2, piwi-like RNA-mediated gene silencing 4.

HIWI is associated with a reduced prognosis in breast cancer

The follow-up information for 187 patients for a period of 100 months was collected (Table II). The patients were first divided into two groups: The higher HIWI expression group (mRNA relative expression >5) and the lower HIWI expression group (mRNA relative expression >2). The tumor specific survival rates with HIWI and HILI are presented in Fig. 2A. For HIWI, a significant correlation between HIWI and survival rate was identified (P<0.05). The higher HIWI expression group exhibited significantly higher survival curves than the lower HIWI expression group. However, no significant differences were observed for HILI (Fig. 2B).

Figure 2

Multivariate Cox's regression analyses. (A) Expression of HIWI and its correlation with tumor-specific survival. (B) Expression of HILI and its correlation with tumor-specific survival. HIWI, piwi-like RNA-mediated gene silencing 1; HILI, piwi-like RNA-mediated gene silencing 2.

Table II

Characteristics for the 187 patients at the beginning of the experiment.

Table II

Characteristics for the 187 patients at the beginning of the experiment.

CharacteristicExpression
P-value
Low (n =98)High (n =89)
Age47.98±5.6249.52±7.840.58
Stage I32410.45
Stage II48370.78
Stage III + IV18110.74
Tumor size (mm3)5.42±2.6123.54±1.620.012
Regulation of breast cancer cell progression by HIWI

In order to detect the effect of HIWI on breast cancer cell lines, the interference and overexpression HIWI vectors were constructed and transfected into cells by Lipofectamine™ 2000. The mRNA expression and protein expression was analyzed by RT-qPCR and western blotting, respectively.

The results indicated that the highest expression of HIWI was present in the overexpression group and the lowest mRNA expression was observed in the interference group. While the control group, overexpression reversal group and interference reversal group exhibited intermediate expression (Fig. 3A). Accordingly, the protein expression results were similar to that of the mRNA expression. The overexpression group had the strongest signals compared with the other groups. The interference group had the lowest expression of HIWI protein among all of the groups (Fig. 3B).

Figure 3

Interference and overexpression of HIWI in breast cancer cells. (A) HIWI mRNA expression analyzed by reverse transcription-quantitative polymerase chain reaction. (B) HIWI protein expression analyzed by western blotting. (C) Apoptosis analysis by flow cytometry among all the treatment groups. (D) Apoptotic index and (E) G2/M arrested rate inferred from flow cytometric analysis. HIWI, piwi-like RNA-mediated gene silencing 1; C; control; I, interference; O, overexpression; OR, overexpression reversal; IR, interference reversal.

To elucidate the effects of HIWI on cellular regulation, the cell cycle progression and cellular apoptosis were detected by flow cytometry. The results demonstrated that the lowest apoptotic rate in was in the overexpression group, whereas the highest apoptotic rate was in the interference group (Fig. 3C and D). In addition, the interference group exhibited a significantly greater rate of G2/M arrest compared with other groups (Fig. 3E).

HIWI regulates TβR and CDK expression levels in breast cancer cells

In order to demonstrate the mechanism of HIWI regulation in the TβR and CDK pathway, the mRNA and protein expression levels of TβR and CDK were assayed. The mRNA and protein expression of TβRI and TβRII were observed to be downregulated by overexpression of HIWI, while the other groups had no significant differences (Fig. 4A, B and F). However, the mRNA and protein expression levels of CDK4 were upregulated by overexpression of HIWI (Fig. 4C). The mRNA expression levels of CDK4 were the lowest in the control, interference and overexpression reversal groups, with no significant differences observed (Fig. 4C). While the expression in the interference reversal group exhibited no significant differences from the other groups. By contrast, the levels of CDK6 and CDK8 in the overexpression group exhibited the highest expression, while no significant differences were observed in the remaining four groups (Fig. 4D and E). In addition, CDK4, CDK6 and CDK8 exhibited a significant increase in the overexpression group, while other groups exhibited no significant differences (Fig. 4F).

Figure 4

HIWI regulates TβR and CDKs in the breast cancer cell line. mRNA expression of (A) TβRI, (B) TβRII, (C) CDK4, (D) CDK6 and (E) CDK8 analyzed by reverse transcription-quantitative polymerase chain reaction (characters indicate a significant difference; P<0.05). (F) Protein expression levels of TβRI, TβRII, CDK4, CDK6 and CDK8 analyzed by western blotting. HIWI, piwi-like RNA-mediated gene silencing 1; CDK, cyclin-dependent kinase; TβRI, transforming growth factor-β type I receptor; C, control; I, interference; O, overexpression; OR, overexpression reversal; IR, interference reversal.

Discussion

In the present study, it was demonstrated for the first time, to the best of our knowledge, that overexpression of PIWI promotes progression of breast cancer in vivo and in vitro. By comparing the expression levels of PIWI genes among normal, benign and malignant tissues, it was demonstrated that HIWI and HILI exhibited high levels of expression in malignant breast cancer. The results indicated that these two overexpressed genes may mediate the progression of breast cancer. Furthermore, it was identified that high expression levels of HIWI are associated with an impaired prognosis, while HILI did not exhibit such effects in breast cancer. Previous studies have demonstrated similar results, observing high expression levels of PIWI genes in colorectal and endometrial cancer (13,24,25). In these types of cancer, the overexpression of PIWI was observed to be associated with the initiation and progression of cancer. In addition, PIWI homologs have been observed to exhibit varied alterations in different types of cancer studied. For example, HILI is highly expressed in precancerous stem cells during tumorigenesis (19) while in colon cancer, only PIWIL3 and HIWI2 have been observed (22,26). In breast cancer, Liu et al (20) demonstrated that HILI was expressed in various stages of cancer, and they proposed that HILI may be a potential biomarker for diagnosis. The results of the current study additionally suggested that high expression of HILI is present in malignant breast cancer, however the association of patient prognosis with HILI was poor. By contrast, high expression of HIWI was additionally observed in malignant breast cancer, and a significant correlation between HIWI expression and prognosis was identified. Thus, based on the observations of the current study, HIWI is suggested as a more suitable biomarker for breast cancer than HILI.

Subsequent to identification of the abnormally high expression of HIWI during the development of breast cancer, the question of how this factor influences the progression of cancer was addressed. Thus, transfection was used to detect the effect of HIWI on progression of breast cancer cells. Subsequent to interference and overexpression of HIWI in cells, the expression levels were altered accordingly. The flow cytometry results suggested that overexpression of HIWI promoted cell activity and inhibited the apoptosis of cells compared with the control group. Subsequent to interference of HIWI, the apoptotic rate increased significantly. Activities of tumor cells, including metastasis and invasion, are regulated by the cell cycle (27). Previous studies have demonstrated that HIWI participates in the stability of the genome and regulates genes expression via binding with piRNAs (7,28). The PIWI-piRNA pathway was only identified in 2006, thus the understanding of this pathway in cancer remains limited (29). Although HIWI is aberrantly expressed in human cancer and its correlation with prognosis has been reported in previous studies (21,30,31), the effects of HIWI on the activities of cells remain unclear. In addition, interference of HIWI may inhibit the progression of breast cancer cells, which provides a novel potential therapy for use in cancer treatment.

HILI may inhibit transforming growth factor β (TGF-β) signaling by regulating Hsp90 and promoting TβR degradation (32). In the present study, the results suggested that HIWI promoted cell activities. Thus, the current study additionally investigated gene regulation by HIWI. The results suggested that inhibition of HIWI arrested cells in the G2/M stage. Due to the fact that HIWI may regulate cell progression of breast cancer via controlling the cell cycle, the cell cycles were affected by HIWI. The results suggest that TGF-β signaling and/or CDK genes may be responsible for cell cycle regulation via HIWI. The results of the current study demonstrated that overexpression of HIWI reduced the levels of TβRI and TβRII, which is similar to the result of HILI overexpression. However, it remains unclear whether this effect is mediated by HILI. In addition, the expression of HIWI, which is suggested to regulate TβR degradation, may serve a crucial role in the progression of cancer. In order to understand the molecular mechanism of HIWI on the cell cycle, the expression levels of factors associated with the cell cycle, including CDK4, CDK6 and CDK8 were detected (33). The results demonstrated that overexpression of HIWI promotes mRNA in addition to protein expression levels of these genes. The members of the CDK family serve an important role in the cell cycle (34). In the CDK family, CDK4, CDK6 and CDK8 are key genes which control DNA synthesis and the transition from G1-S stage (33). Under or overexpression of these genes leads to dysfunction of cell progression (34). Thus, it is proposed that the overexpression of HIWI in breast cancer contributed to the promotion of CDK gene expression and the induction of cancer progression.

In conclusion, the present study demonstrated that high expression levels of HIWI are associated with a reduction in the patient prognosis in breast cancer. Suppression of HIWI may arrest the cells at the G2/M stage. Furthermore, the expression levels of TβRI, TβRII, CDK4, CDK6 and CDK8 were regulated by HIWI in breast cancer cells. These observations indicate that HIWI participates in the progression of breast cancer via regulating the gene expression of TβRs and CDKs.

References

1 

Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D and Bray F: Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 136:E359–E386. 2015. View Article : Google Scholar

2 

Montagna E, Cancello G, Dellapasqua S, Munzone E and Colleoni M: Metronomic therapy and breast cancer: A systematic review. Cancer Treat Rev. 40:942–950. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Snee M: Follow-up of women treated for breast cancer. Clin Oncol (R Coll Radiol). 8:85–89. 1996. View Article : Google Scholar

4 

Nowsheen S, Aziz K, Tran PT, Gorgoulis VG, Yang ES and Georgakilas AG: Epigenetic inactivation of DNA repair in breast cancer. Cancer Lett. 342:213–222. 2014. View Article : Google Scholar

5 

Fucito A, Lucchetti C, Giordano A and Romano G: Genetic and epigenetic alterations in breast cancer: What are the perspectives for clinical practice? Int J Biochem Cell Biol. 40:565–575. 2008. View Article : Google Scholar

6 

Sandoval J and Esteller M: Cancer epigenomics: Beyond genomics. Curr Opin Genet Dev. 22:50–55. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Chénais B: Transposable elements and human cancer: A causal relationship? Biochim Biophys Acta. 1835:28–35. 2013.

8 

Hansen KD, Timp W, Bravo HC, Sabunciyan S, Langmead B, McDonald OG, Wen B, Wu H, Liu Y, Diep D, et al: Increased methylation variation in epigenetic domains across cancer types. Nat Genet. 43:768–775. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Lopez-Serra P and Esteller M: DNA methylation-associated silencing of tumor-suppressor microRNAs in cancer. Oncogene. 31:1609–1622. 2012. View Article : Google Scholar :

10 

Levin HL and Moran JV: Dynamic interactions between trans-posable elements and their hosts. Nat Rev Genet. 12:615–627. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Girard A, Sachidanandam R, Hannon GJ and Carmell MA: A germline specific class of small RNAs binds mammalian Piwi proteins. Nature. 442:199–202. 2006.PubMed/NCBI

12 

Grivna ST, Beyret E, Wang Z and Lin H: A novel class of small RNAs in mouse spermatogenic cells. Genes Dev. 20:1709–1714. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Seto AG, Kingston RE and Lau NC: The coming of age for Piwi proteins. Mol Cell. 26:603–609. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Senti KA and Brennecke J: The piRNA pathway: A fly's perspective on the guardian of the genome. Trend Genet. 26:499–509. 2010. View Article : Google Scholar

15 

Zhou Y, Zhong H, Liu S, Yu F, Hu J, Zhang C, Tao M and Liu Y: Elevated expression of Piwi and piRNAs in ovaries of triploid crucian carp. Mol Cell Endocrinol. 383:1–9. 2014. View Article : Google Scholar

16 

Zhang D, Duarte-Guterman P, Langlois VS and Trudeau VL: Temporal expression and steroidal regulation of piRNA pathway genes (mael, piwi, vasa) during Silurana (Xenopus) tropicalis embryogenesis and early larval development. Comp Biochem Physiol C Toxicol Pharmacol. 152:202–206. 2010. View Article : Google Scholar : PubMed/NCBI

17 

Xu M, You Y, Hunsicker P, Hori T, Small C, Griswold MD and Hecht NB: Mice deficient for a small cluster of Piwi-interacting RNAs implicate Piwi-interacting RNAs in transposon control. Biol Reprod. 79:51–57. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Ye Y, Yin DT, Chen L, Zhou Q, Shen R, He G, Yan Q, Tong Z, Issekutz AC, Shapiro CL, et al: Identification of Piwil2-like (PL2L) proteins that promote tumorigenesis. PLoS One. 5:e134062010. View Article : Google Scholar : PubMed/NCBI

19 

Nikpour P, Forouzandeh-Moghaddam M, Ziaee SA, Dokun OY, Schulz WA and Mowla SJ: Absence of PIWIL2 (HILI) expression in human bladder cancer cell lines and tissues. Cancer Epidemiol. 33:271–275. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Liu JJ, Shen R, Chen L, Ye Y, He G, Hua K, Jarjoura D, Nakano T, Ramesh GK, Shapiro CL, et al: Piwil2 is expressed in various stages of breast cancers and has the potential to be used as a novel biomarker. Int J Clin Exp Pathol. 3:328–337. 2010.

21 

Taubert H, Greither T, Kaushal D, Würl P, Bache M, Bartel F, Kehlen A, Lautenschläger C, Harris L, Kraemer K, et al: Expression of the stem cell self-renewal gene Hiwi and risk of tumour-related death in patients with soft-tissue sarcoma. Oncogene. 26:1098–1100. 2007. View Article : Google Scholar

22 

Li L, Yu C, Gao H and Li Y: Argonaute proteins: Potential biomarkers for human colon cancer. BMC Cancer. 10:382010. View Article : Google Scholar : PubMed/NCBI

23 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar

24 

Liu W, Jiang X and Zhang Z: Expression of PSCA, PIWIL1, and TBX2 in endometrial adenocarcinoma. Oncol Res Treat. 33:241–245. 2010.

25 

Oh SJ, Kim SM, Kim YO and Chang HK: Clinicopathologic implications of PIWIL2 expression in colorectal cancer. Korean J Pathol. 46:318–323. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Samowitz WS: Genetic and epigenetic changes in colon cancer. Exp Mol Pathol. 85:64–67. 2008. View Article : Google Scholar : PubMed/NCBI

27 

Liang D, Fang Z, Dong M, Liang C, Xing C, Zhao J and Yang Y: Effect of RNA interference-related HiWi gene expression on the proliferation and apoptosis of lung cancer stem cells. Oncol Lett. 4:146–150. 2012.PubMed/NCBI

28 

O'Donnell KA and Boeke JD: Mighty Piwis defend the germline against genome intruders. Cell. 129:37–44. 2007. View Article : Google Scholar

29 

Siddiqi S and Matushansky I: Piwis and piwi-interacting RNAs in the epigenetics of cancer. J Cell Biochem. 113:373–380. 2012. View Article : Google Scholar

30 

Grochola LF, Greither T, Taubert H, Möller P, Knippschild U, Udelnow A, Henne-Bruns D and Würl P: The stem cell-associated Hiwi gene in human adenocarcinoma of the pancreas: Expression and risk of tumour-related death. Br J Cancer. 99:1083–1088. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Liu X, Sun Y, Guo J, Ma H, Li J, Dong B, Jin G, Zhang J, Wu J, Meng L, et al: Expression of hiwi gene in human gastric cancer was associated with proliferation of cancer cells. Int J Cancer. 118:1922–1929. 2006. View Article : Google Scholar

32 

Zhang K, Lu Y, Yang P, Li C, Sun H, Tao D, Liu Y, Zhang S and Ma Y: HILI inhibits TGF-β signaling by interacting with Hsp90 and promoting TβR degradation. PLoS One. 7:e419732012. View Article : Google Scholar

33 

Shah MA and Schwartz GK: Cyclin-dependent kinases as targets for cancer therapy. Update Cancer Ther. 1:311–332. 2006. View Article : Google Scholar

34 

Graña X and Reddy EP: Cell cycle control in mammalian cells: Role of cyclins, cyclin dependent kinases (CDKs), growth suppressor genes and cyclin-dependent kinase inhibitors (CDKIs). Oncogene. 11:211–219. 1995.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Cao J, Xu G, Lan J, Huang Q, Tang Z and Tian L: High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer. Mol Med Rep 13: 2829-2835, 2016.
APA
Cao, J., Xu, G., Lan, J., Huang, Q., Tang, Z., & Tian, L. (2016). High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer. Molecular Medicine Reports, 13, 2829-2835. https://doi.org/10.3892/mmr.2016.4842
MLA
Cao, J., Xu, G., Lan, J., Huang, Q., Tang, Z., Tian, L."High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer". Molecular Medicine Reports 13.3 (2016): 2829-2835.
Chicago
Cao, J., Xu, G., Lan, J., Huang, Q., Tang, Z., Tian, L."High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer". Molecular Medicine Reports 13, no. 3 (2016): 2829-2835. https://doi.org/10.3892/mmr.2016.4842
Copy and paste a formatted citation
x
Spandidos Publications style
Cao J, Xu G, Lan J, Huang Q, Tang Z and Tian L: High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer. Mol Med Rep 13: 2829-2835, 2016.
APA
Cao, J., Xu, G., Lan, J., Huang, Q., Tang, Z., & Tian, L. (2016). High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer. Molecular Medicine Reports, 13, 2829-2835. https://doi.org/10.3892/mmr.2016.4842
MLA
Cao, J., Xu, G., Lan, J., Huang, Q., Tang, Z., Tian, L."High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer". Molecular Medicine Reports 13.3 (2016): 2829-2835.
Chicago
Cao, J., Xu, G., Lan, J., Huang, Q., Tang, Z., Tian, L."High expression of piwi-like RNA-mediated gene silencing 1 is associated with poor prognosis via regulating transforming growth factor-β receptors and cyclin-dependent kinases in breast cancer". Molecular Medicine Reports 13, no. 3 (2016): 2829-2835. https://doi.org/10.3892/mmr.2016.4842
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team