Open Access

Silencing of TBX20 gene expression in rat myocardial and human embryonic kidney cells leads to cell cycle arrest in G2 phase

  • Authors:
    • Peiyan Liu
    • Yueling Sun
    • Guangbin Qiu
    • Hongkun Jiang
    • Guangrong Qiu
  • View Affiliations

  • Published online on: August 19, 2016     https://doi.org/10.3892/mmr.2016.5660
  • Pages: 2904-2914
  • Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Congenital heart diseases (CHDs) are the most common birth defects due to abnormal cardiac development. The T-box 20 (TBX20) gene is a member of the T‑box family of transcription factors and encodes TBX20, which is essential for early heart development. In the present study, reduced TBX20 expression was observed in CHD tissue samples compared with normal tissues, and the function of TBX20 in Rattus norvegicus myocardial cells [H9c2(2-1)] and human embryonic kidney cells (HEK293) was investigated. TBX20 was silenced in H9c2 and HEK293 cells via transfection of small interfering RNA and short hairpin RNA duplexes, respectively, and TBX20 mRNA and protein levels were subsequently examined using reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) and western blot analysis. Cell proliferation was assessed using a cell counting kit and proliferating cell nuclear antigen expression was determined by western blotting. Analysis of cell apoptosis was achieved by annexin V‑fluorescein isothiocyanate/propidium iodide staining and a fluorometric terminal deoxynucleotidyl transferase dUTP nick‑end labeling system. Cell cycle analysis was achieved using fluorescence‑activated cell sorting, and, an RT‑qPCR array was used to profile the expression of TBX20‑related genes. Silencing of TBX20 in H9c2 and HEK293 cells significantly inhibited cell proliferation, induced cell apoptosis and led to G2/M cell cycle arrest. A reduction in cyclin B1 mRNA levels and an increase in cyclin‑dependent kinase inhibitor 1B mRNA levels was observed, which indicated that cells were arrested in G2 phase. Concurrently, the mRNA levels of GATA binding protein 4 were increased in both cell lines, which may provide an explanation for the abnormal cardiac hypertrophy observed in patients with congenital heart disease. These results suggest that TBX20 is required for heart morphogenesis, and inhibition of TBX20 expression may lead to the suppression of cell proliferation and cell cycle arrest.

Introduction

Heart defects account for the majority of human birth defects and are the leading cause of birth defect-related cases of mortality (1). Congenital heart disease (CHD) is a defect in the structure of the heart and great vessels that is present at birth. Approximately 9 in 1,000 people are born with a congenital heart defect (2). The heritability of risk for CHD is estimated to be 55–65%, however, both genetic and environmental factors are responsible for the onset of the disease (35). During fetal development, a series of events including cell growth, migration and programmed cell death results in the development of a well-formed heart at birth. Disruption of any one of these processes may result in a heart defect (6). It is therefore important to identify the genes that function to regulate this process of cardiac development.

The T-box 20 (TBX20) gene is a member of the T-box family of transcription factors that share a highly conserved DNA binding region (known as the T-box) and serve an essential role in early heart development (710), adult heart function (11) and CHD in humans (1216). During heart morphogenesis, TBX20 coordinates cardiac cell proliferation and differentiation, and formation of cardiac chambers (810). Tbx20 knockout mice have been observed to exhibit arrested development at E9.0 and die at E10.5 (7), and increased Tbx20 expression leads to congenital atrial septal defects, patent foramen ovale and cardiac valve defects (14). One study involving heterozygous mutations of Tbx20 in adult mice, indicates that Tbx20 haploinsufficiency is associated with left ventricular dilation, decreased heart wall thickness and contractile dysfunction (9). Ablation of Tbx20 in the adult mouse myocardium causes dilation of the cardiac chambers and lethality within 15 days (17). Mechanistically, TBX20 physically interacts with a number of major factors involved in the regulation of cardiac development, such as GATA binding protein 4 (GATA4) and NK2 homeobox 5 (NKX2-5) transcription factors (9,14). Tbx20 also functions as a transcriptional repressor of T-box 2 (9) and ISL LIM homeobox 1 transcription factors (7) and is an activator of myocyte enhancer factor 2C (10). Therefore, TBX20 serves a crucial role in cardiac morphogenesis and functions by interacting with other genes and regulating downstream targets.

In the present study, the expression levels of TBX20 were investigated in cardiac tissue samples derived from patients with sporadic types of CHD. Reduced TBX20 expression levels were observed in CHD tissue samples compared with normal tissues. To determine whether reduced TBX20 expression leads to inhibition of cell proliferation and cell cycle arrest, TBX20 small-interfering RNAs (siRNAs) were transfected into H9c2(2-1) Rattus norvegicus myocardial cells. Additionally, TBX20 short-hairpin RNAs (shRNAs) were transfected into HEK293 human embryonic kidney cells to investigate the effects of TBX20 knockdown in human cells.

Materials and methods

Patient samples and cell lines

Informed consent from patients or guardians was first obtained prior to the collection of 24 cardiac tissue samples, which were provided by the Shengjing Hospital of China Medical University (Shenyang, China). This study received ethical approval from the local Medical Ethics Committee of China Medical University (Shenyang, China). Tissue specimens were obtained from the free wall of the left ventricle or atrial appendage in 12 patients with CHD (patient group; gestational age, GA: 14–38 weeks), and 12 age and gender-matched autopsies (control group; GA: 22–32 weeks) that exhibited no structural or hemodynamic abnormalities of the heart.

HEK293 human embryonic kidney cells and H9c2(2-1) Rattus norvegicus myocardial cells were purchased from the cell bank of Chinese Academy of Sciences (Shanghai, China). The cell lines were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, and maintained in a humidified 5% (v/v) CO2 incubator at 37°C.

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from cardiac tissue samples and cell lines using the TRIzol Reagent (Invitrogen; Thermo Fisher Scientific, Inc., Carlsbad, CA, USA) according to the manufacturer's instructions. cDNA was synthesized from 3 µg of RNA using a Reverse Transcription system purchased from Promega (Beijing) Biotech Co., Ltd. (Beijing, China) and PCR was performed using β-actin as an internal control to analyze TBX20 mRNA expression in cardiac tissue samples and the primers listed in Table I. The relative expression levels of mRNA were determined using the optical density ratio (TBX20/β-actin) using AlphaImager 2200 software (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Analysis of TBX20 expression in cell lines by qPCR was achieved using the primers listed in Table I and was performed using an Applied Biosystems 7500 Real-Time PCR system (Thermo Fisher Scientific, Inc., Foster City, CA, USA). Reaction mixtures consisted of 12.5 µl SYBR® Green PCR Master mix (Applied Biosystems; Thermo Fisher Scientific, Inc.), 0.5 µl primer (10 mM/l) and 1 µl cDNA. Thermal cycling conditions consisted of an initial denaturation step of 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 sec and annealing and extension at 60°C for 1 min. Fluorescence measurements were collected at the end of each extension step. The quantification cycles (Cq) were then determined and the relative concentrations of mRNA were calculated and normalized against the levels of β-actin or glyceraldehyde 3-phosphate dehydrogenase (Gapdh) expression in each sample (18). Reactions were performed with non-template controls. Melting curve analyses were conducted following completion of the thermal cycling program using a temperature ramp that increased the temperature from 45–95°C at a rate of 0.5°C every 2 sec. During this time, fluorescence signals were monitored continuously to determine the specificity of PCR primers, which was subsequently confirmed by conventional gel electrophoresis. For each sample, reactions were conducted in triplicate to ensure the reproducibility of the results.

Table I

Details of primer sequences used for reverse transcription-quantitative polymerase chain reaction.

Table I

Details of primer sequences used for reverse transcription-quantitative polymerase chain reaction.

SpeciesPrimersSequence (5′−3′)Product size (bp)
Homo sapiensTBX20 (1)F: AGGAGGCGACGGAGAACA286
R: CTGCCCGACTTGGTGATG
TBX20 (2)F: CATCCAGATTCTCCTTTTACCG272
R: TTCAGCTTCGTTATCAGTTGATTC
P27F: AGCGACCTGCAACCGACGATTC120
R: GGCCAGGCTTCTTGGGCGTC
Cyclin B1F: TCTGGATAATGGTGAATGGACA157
R: CGATGTGGCATACTTGTTCTTG
NKX2-5F: CAAGTGTGCGTCTGCCTTT105
R: GCGCACAGCTCTTTCTTTTC
GATA4F: CGGAAGCCCAAGAACCTGA176
R: CTGCTGTGCCCGTAGTGAG
β-actin (1)F: CTCTTCCAGCCTTCCTTCCT511
R: CACCTTCACCGTTCCAGTTT
β-actin (2)F: ATAGCACAGCCTGGATAGCAACGTAC158
R: CACCTTCTACAATGAGCTGCGTGTG
Rattus norvegicusTbx20F: AGCAGTCACAGCCTACCAGA187
R: ATGCCAAGGAAGACGAGTT
p27F: GCGGCAAGAGAGGCGAGGC129
R: CGGAAGGCTTGGGGTGCTCG
Cyclin b1F: GGCGCTCAGGGTCACTAGGAACA173
R: GGGGTATTCTTGACTGTTCGCTGAC
Nkx2-5F: GATGCCACAGGGCAATTC104
R: TCTCCTAAAGGTGGGAGTCG
Gata4F: CACTATGGGCACAGCAGCTCC186
R: TTGGAGCTGGCCTGCGATGTC
GapdhF: CCCACTCGTAGCCCCTCTG289
R: TGCTGAGTATGTCGTGGAGT

[i] TBX20 (1) and β-actin (1) were used for cardiac tissue samples, whereas TBX20 (2) and β-actin (2) are the primers of real time-PCR in cell lines. TBX20, T-box 20; P27, cyclin-dependent kinase inhibitor (CDKI) 1B; NKX2-5, NK2 homeobox 5; GATA4, GATA binding protein 4; bp, base pair; F, forward; R, reverse.

Western blotting analysis

Total protein was extracted from 24 frozen cardiac tissue samples and cultured cells using a lysis buffer containing protease inhibitors (KeyGen Biotechnology, Co., Ltd., Nanjing, China). Protein concentrations of sample lysates were determined using a bicinchoninic acid kit (KeyGen Biotechnology, Co., Ltd.) according to the manufacturer's instructions. Samples (20 µg) were denatured by adding 5X SDS-PAGE sample loading buffer (Beyotime Institute of Biotechnology, Jiangsu, China) and incubating for 10 min at 95°C. Sample proteins were then separated by 12% SDS-PAGE and electroblotted onto a polyvinylidene fluoride membrane. Membranes were blocked using non-fat dry milk (5%) in phosphate-buffered saline (PBS, 0.05%) and 0.05% Tween-20 at room temperature for 2 h. This was followed by incubation with rabbit anti-TBX20 (catalog no. sc-134061) or rabbit anti-α-tubulin (catalog no. sc-5546) at a dilution of 1:500 (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) overnight at 4°C. The following day, membranes were washed three times with PBS containing 0.05% Tween-20 for 15 min, and incubated with the secondary horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody (1:2,000; catalog no. sc-2004; Santa Cruz Biotechnology, Inc.) for 2 h at room temperature. Protein bands were visualized using enhanced chemiluminescence detection, and the membranes were exposed to X-ray film. α-Tubulin was used as the internal control. The relative expression levels of protein were determined using the optical density ratio (TBX20/α-Tubulin) using AlphaImager 2200 software (Bio-Rad Laboratories, Inc.).

Design of shRNA and siRNA duplexes

shRNA and siRNA duplexes targeting TBX20 were designed according to the characterization of the TBX20 gene by Hammer et al (19). TBX20 has two splice variants, TBX20A and TBX20B; both isoforms share six identical exons, while TBX20A has two additional exon sequences. Therefore, shRNA and siRNA duplexes used for the purposes of this study, were designed to target TBX20B. Similarly, rat Tbx20 has two splice variants, Tbx20a and Tbx20b. shRNAs that target human TBX20B (Ensembl Transcript ID: ENST00000492961; www.ensembl.org) and siRNAs that targeted rat Tbx20b (Ensembl Transcript ID: ENSRNOT00000064783) were designed by GenePharma Co., Ltd., (Shanghai, China). A total of three green-fluorescent protein (GFP)-tagged shRNA sequences were designed to target human TBX20 mRNA transcripts at the nucleotide positions 845–864, 1094–1113, and 1152–1171, and three siRNA duplexes were designed to target rat Tbx20 mRNA transcripts at nucleotide positions 752–772, 1042–1062, and 1089–1109. Negative control shRNA (NC-shRNA) and siRNA (NC-siRNA) duplexes consisted of random sequences that do not target any known mammalian genes. siRNA duplexes were chemically synthesized, and 1.0 optical density (20 µM/l) of NC-siRNA was labeled with the carboxyfluorescin (FAM) fluorophore (GenePharma Co., Ltd.). NC-shRNA duplexes were cloned into GFP-tagged vectors.

Transfection of siRNA and shRNA into mammalian cells

Transfection of shRNA and siRNA duplexes into HEK293 and H9c2 cells was achieved using the FuGENE® HD Transfection Reagent (Roche Diagnostics, Basel, Switzerland) according to the manufacturer's instructions. At 24 h post-transfection with GFP-labeled NC-shRNA or FAM-labeled NC-siRNA, cells were visualized using an inverted fluorescence microscope with a digital charged-coupled device imaging system (IX71/DP70; Olympus Corporation, Tokyo, Japan) in order to determine transfection efficiency.

Cell proliferation assay

Cell viability was determined using a cell counting kit (CCK-8; Beyotime Institute of Biotechnology). Cells (5×103/well) were seeded onto 96-well flat-bottom plates one day prior to transfection. At 24, 48, 72, and 96 h post-transfection, 10 µl CCK-8 was added to each well, and cells were incubated for a further 2 h. Sample absorbance was proportional to the number of living cells and was measured using a microplate reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA) at 450 nm. The rate of cell proliferation inhibition was calculated using the following formula: Rate of cell proliferation inhibition=[(Average absorbance of the control group-average absorbance of the experimental group)/average absorbance of the control group]×100%.

Cells harvested at 96 h post-transfection were subject to western blot analysis for proliferating cell nuclear antigen (PCNA) using a mouse anti-PCNA antibody (1:500; catalog no. sc-53407; Santa Cruz Biotechnology, Inc.) and a goat anti-mouse IgG-HRP secondary antibody (1:2,000; catalog no. sc-2005; Santa Cruz Biotechnology, Inc.), which is a reliable assay for the determination of cell proliferation. This was performed using the same procedures described previously.

Cell apoptosis assay

In order to detect early cell apoptosis, annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) staining (BD Biosciences, Franklin Lakes, NJ, USA) and flow cytometry analysis were performed according to the manufacturer's instructions. Briefly, cells (5×105 cells/well) were seeded onto six-well flat-bottom plates. At 48 h post-transfection, cells were trypsinized, resuspended in binding buffer and incubated in 5 µl annexin V-FITC and 5 µl PI for 15 min at 25°C in the dark, prior to flow cytometry analysis. Early FITC-stained apoptotic cells were represented in the lower-right quadrant of the fluorescence-activated cell sorting histogram.

In order to detect late cell apoptosis, the DeadEnd™ Fluorometric TUNEL System (Promega Corporation, Madison, WI, USA) was used according to the manufacturer's instructions. Briefly, adherent cells in two-well chamber slides were fixed with 4% formaldehyde and treated with 0.2% Triton X-100. Following equilibration at room temperature, cells were incubated in buffer containing nucleotides and the terminal deoxynucleotidyl transferase enzyme for 1 h. Cells were then stained with PI for 5 min in the dark and visualized under the microscope. Cells were considered to be apoptotic if they had TUNEL-positive nuclei and morphological features of cell death, including cell shrinkage, fragmentation and regions of dense chromatin condensation. The apoptotic index was defined as the percentage of TUNEL-positive cells in each well, from three random fields of view (magnification, ×20).

Cell cycle analysis

Cell cycle analysis was achieved using PI staining and flow cytometry (FACSCalibur flow cytometer; BD Biosciences). Briefly, cells were seeded onto six-well plates and transfected with siRNA or shRNA using the aforementioned procedures. At 48 or 96 h post-transfection, cells were harvested and fixed by adding 70% ethanol and incubating for 12 h at −20°C. Cells were then stained with PI in a PBS solution containing RNase (KeyGen Biotechnology, Co., Ltd.) and analyzed by flow cytometry.

In order to determine the expression levels of factors involved in regulating cell cycle progression, the mRNA levels of cyclin B1, P27, P16 and P21 were assessed by RT-qPCR and normalized to β-actin or Gapdh, as described above. The expression levels of these genes were determined in cells harvested at 48 or 96 h post-transfection using the aforementioned procedures.

Statistical analysis

The data are expressed as the mean ± standard deviation and differences between the means were evaluated using analysis of variance and the Student's t-test with SPSS software (version 16.0; SPSS Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

TBX20 expression is decreased in CHD cardiac tissues

The mRNA expression levels of TBX20 were significantly reduced in cardiac tissues from CHD patients compared to cardiac tissues from normal controls (P=0.023; Fig. 1A), which was confirmed by western blotting analysis (P=0.031; Fig. 1B).

TBX20 expression is reduced following transfection of H9c2 and HEK293 cells with TBX20 siRNA and shRNA duplexes, respectively

At 24 h post-transfection with fluorescently-labelled TBX20 siRNA and shRNA duplexes, the transfection efficiency was determined using fluorescence microscopy by comparing optical microscope images of identical fields of view. Following confirmation of a high transfection efficiency for TBX20 siRNA and shRNA duplexes in H9c2 (80%) and HEK293 (90%) cells, respectively, the mRNA and protein expression levels of TBX20 were determined by RT-qPCR and western blotting analysis. At 48 h post-transfection with Tbx20-1089-siRNA, H9c2 cells exhibited a significant decrease (P=0.021 and P=0.011) in the expression levels of TBX20 mRNA and protein compared with normal controls (Fig. 2A and B). Consistent with these observations, at 96 h following transfection of HEK293 cells with TBX20-845-shRNA, the expression levels of TBX20 mRNA and protein were significantly reduced (P=0.018 and P=0.012, respectively; Fig. 2C and D). These results indicate that Tbx20-1089-siRNA and TBX20-845-shRNA duplexes inhibit TBX20 expression in H9c2 and HEK293 cells, respectively.

TBX20 inhibition represses cell proliferation in H9c2 and HEK293 cells

To investigate the association between TBX20 inhibition and H9c2 and HEK293 cell proliferation, cell viability was assessed using a CCK-8 assay following transfection of cells with TBX20 siRNA and shRNA duplexes, respectively. Compared with NC-siRNA-transfected controls, a significant time-dependent decrease in cell proliferation rates were observed at 72 and 96 h (48.3±0.036 and 51.8±0.110%, respectively) following transfection of H9c2 cells with Tbx20-1089-siRNA (P<0.01; Fig. 3A). A significant time-dependent reduction in cell proliferation rates were also observed in HEK293 cells at 72, 96 and 120 h (57.3±0.049, 42.3±0.034 and 43.3±0.020%, respectively) following transfection with TBX20-845-shRNA (P<0.01; Fig. 3B).

The putative repressive effect of TBX20 inhibition on cell proliferation was then investigated by western blotting analysis for PCNA, which is only expressed in proliferating cells (20). A significant reduction in PCNA protein expression levels was observed in H9c2 cells at 96 h post-transfection with Tbx20-1089-siRNA (P=0.017; Fig. 3C). In addition, a significant reduction in PCNA protein expression levels was observed in HEK293 cells at 96 h post-transfection with TBX20-845-shRNA (P=0.022; Fig. 3D). These results are consistent with those obtained from the CCK-8 assays, which suggests that TBX20 inhibition suppresses the proliferation of H9c2 and HEK293 cells.

TBX20 inhibition induces cell apoptosis in H9c2 and HEK293 cells

Annexin V-FITC/PI staining was performed to detect early cell apoptosis. Compared with negative controls, the percentage of early apoptotic cells was observed to increase significantly in H9c2 cells transfected with Tbx20-1089-siRNA (P=0.027; 7.73±0.9%), and in HEK293 cells transfected with TBX20-845-shRNA (P=0.034; 12.16±2.1%; Fig. 4A and B).

TUNEL staining was then performed in order to determine late cell apoptosis. As demonstrated in Fig. 4C and D, a significant increase in the percentage of late apoptotic cells was observed in H9c2 cells transfected with Tbx20-1089-siRNA (P=0.028; 17.5±0.013%) and in HEK293 cells transfected with TBX20-845-shRNA (P=0.024; 10.5±0.15%). These results suggest that TBX20 inhibition may induce apoptosis of H9c2 and HEK293 cells.

TBX20 inhibition leads to cell cycle arrest in G2 phase of H9c2 and HEK293 cells

To investigate the effects of TBX20 inhibition on cell cycle progression, PI staining and flow cytometry analyses were conducted to examine the cell cycle phases of H9c2 and HEK293 cells transfected with TBX20 siRNA and shRNA duplexes respectively. As demonstrated in Table II and Fig. 5A and B, the percentage of cells in the G2/M phase were significantly increased in Tbx20-1089-siRNA-transfected H9c2 cells (P=0.036; 6.38±0.78%) and TBX20-845-shRNA-transfected HEK293 cells (P=0.025; 7.86±1.56%) compared with negative controls.

Table II

Percentage of H9c2 and HEK293 cells in different cell cycle phases following silencing of TBX20 expression.

Table II

Percentage of H9c2 and HEK293 cells in different cell cycle phases following silencing of TBX20 expression.

GroupG0/G1 phase (%)S phase (%)G2/M phase (%)
H9c2-NC-siRNA75.99±1.3320.78±1.443.22±0.99
H9c2-Tbx20-1089-siRNA67.69±0.8324.95±1.036.38±0.78a
HEK293-NC-shRNA67.81±0.2431.11±1.541.08±1.30
HEK293-TBX20-845-shRNA62.33±1.9229.82±3.477.86±1.56a

{ label (or @symbol) needed for fn[@id='tfn2-mmr-14-04-2904'] } Results are presented as mean ± standard deviation.

a P<0.05 vs. NC controls. TBX20, T-box 20; siRNA, small-interfering RNA; shRNA, short-hairpin RNA; NC, negative control.

To investigate the mechanisms of cell cycle arrest following TBX20 inhibition, RT-qPCR analysis was used to detect the expression of a number of important cell cycle regulators including, cyclin B1, P27, P21 and P16. Compared with negative controls, at 48 h post-transfection of H9c2 cells with Tbx20-1089-siRNA, Tbx20 inhibition resulted in a significant reduction in the expression of cyclin B1 mRNA expression levels (P=0.003; Fig. 5C), with a concomitant significant increase in the expression levels of p27 (P=0.015; Fig. 5D), and no considerable alterations in p16 and p21 expression levels (P=0.23; Fig. 5E and F). Similarly, at 96 h following transfection of HEK293 cells with TBX20-845-shRNA, the mRNA expression levels of cyclin B1 were significantly reduced (P=0.026; Fig. 5C), P27 expression levels were significantly increased (P=0.006; Fig. 5D), and no notable alterations in P16 and P21 expression levels were observed when compared with negative controls (P=0.38; Fig. 5E and F).

TBX20 inhibition upregulates GATA4 mRNA expression in H9c2 and HEK293 cells

In order to investigate the role of TBX20 in heart development, the mRNA expression levels of GATA4 and NKX2-5 were determined in H9c2 and HEK293 cells following transfection with TBX20-siRNA and shRNA duplexes respectively. As demonstrated in Fig. 6A and B, the mRNA expression levels of Gata4 were significantly increased (P=0.001) within H9c2 cells 48 h following transfection with Tbx20-1089-siRNA compared with negative controls, whereas no significant alterations in Nkx2-5 expression levels were observed. Similarly, the expression levels of GATA4 mRNA were significantly increased (P=0.012) in HEK293 cells 96 h following transfection with TBX20-845-shRNA and no notable alterations in NKX2-5 expression levels were observed, when compared with controls (P=0.09; Fig. 6A and B).

Discussion

During the process of human heart morphogenesis, both cardiomyocyte proliferation and enlargement contribute to postnatal heart growth (15). Notably, targeted disruption of cardiomyocyte proliferation at mid-gestation, leads to hypoplastic ventricular walls and impaired trabeculation (16). Therefore, normal cardiomyocyte proliferation is necessary to support the growth and development of the postnatal human heart. The T-box family of transcription factors serve critical functional roles in embryonic development and organogenesis including, cell type specification, tissue patterning and morphogenesis (21). In particular, the endocardium, myocardium and epicardium of the developing heart express TBX20, which suggests that TBX20 has numerous roles in cardiac development (22). The results of the present study suggest that TBX20 is a key mediator of cell proliferation, particularly cell cycle progression.

TBX20 is a dose-sensitive regulator. In zebrafish and mouse models, knockout or knockdown of Tbx20 is associated with abnormal heart cyclization, right ventricular dysplasia, severe damage of the outflow tract and disordered chamber differentiation, which suggests that maintaining normal Tbx20 expression is critical for normal heart development (710,23).

In the present study, the mRNA and protein expression levels of TBX20 in CHD patients were significantly lower than normal controls, which is consistent with previous animal studies (710,23). Therefore, it was hypothesized that this low level of TBX20 expression may be insufficient to maintain normal heart development in CHD patients and therefore be responsible for heart malformations. In contrast, Hammer et al (19) reported that TBX20 expression was increased in patients with tetralogy of fallot. However, this may due to the study population and sample size, as this was a German study performed on 13 patients and 6 healthy controls.

During the heart development process, the number of cardiomyocytes increases due to mitosis and heart volume increases to support the rising hemodynamic load. Therefore, the ordered proliferation of cardiomyocytes is essential for normal heart development (15). A number of studies have confirmed that a reduction in the proliferation rate of fetal rat cardiomyocytes results in thinning of the myocardial compact layer and derangement of the heart trabeculae, which leads to cardiac septal defects as well as other structural deformities (7,16,22).

The results of the present study demonstrate that TBX20 participates in cardiomyocyte proliferation, which is consistent with previous mouse studies (7,22). Additionally, the results provide evidence of a possible mechanism by which TBX20 may regulate cardiomyocyte proliferation. Cyclin B1 is the primary activator of cyclin-dependent kinase 1 (CDK1). Through complex formation with CDK1, cyclin B1 controls the G2/M transition during cell cycle progression (24,25). P27 is a member of the kinase-inhibiting protein 1 family and controls G2/M transition by repressing CDK1 (26,27). In the present study, transfection of siRNA and shRNA duplexes targeting TBX20 in rat myocardial cells and human embryonic kidney cells respectively, was associated with a significant reduction in the expression levels of cyclin B1 mRNA and a significant increase in P27 mRNA expression levels. Through the inactivation of CDK1, this decrease in cyclin B1 and increase in P27 expression was hypothesized to have lead to cell cycle arrest in G2, thereby blocking mitotic division and inhibiting cell proliferation. However, it is unclear whether TBX20 regulates cyclin B1 and P27 through direct or indirect mechanisms. Future research is necessary to clarify this further.

In addition to an adequate number of cardiomyocytes, normal heart development requires correct cardiomyocyte differentiation and maturation. GATA4 and NKX2-5 can be detected at an early stage of heart development, and regulate the differentiation and maturation of cardiomyocytes by interacting with myocyte enhancer factor 2, serum response factor, and atrial natriuretic factor (2833). GATA4 and NKX2-5 are dosage-sensitive regulators of cardiac morphogenesis, and insufficient or excessive expression may result in a hypoplastic heart or abnormal cardiac hypertrophy (3440). In the present study, TBX20 inhibition upregulated GATA4 mRNA expression levels in rat myocardial cells, and had no effects on NKX2-5 mRNA expression, which suggested that TBX20 may participate in cardiomyocyte differentiation and maturation. Combined with the decreased expression of TBX20 in cardiac tissue samples from CHD patients, this may partially explain abnormal cardiac hypertrophy observed in some CHD patients. The functions of TBX20 and GATA4 have been studied extensively in early cardiac cells (8,9,15,35,41); however, the results of the present study demonstrate that TBX20 may additionally regulate the expression of GATA4 in human kidney cells. This may be due to the presence of analogous signaling pathways for heart and kidney development. The present results therefore provide novel evidence to suggest that TBX20 and GATA4 may serve a functional role in human kidney development, which should be investigated further using in vivo methodologies.

In conclusion, the results of the present study identified reduced TBX20 expression in cardiac tissues samples, and silencing of TBX20 in H9c2 and HEK293 cells significantly inhibited cell proliferation and induced cell apoptosis and G2/M cell cycle arrest. A reduction in TBX20 expression was associated with a significant decrease in cyclin B1 expression and a significant increase in P27 expression, which may have resulted in the observed cell cycle arrest of rat myocardial and human embryonic kidney cells in G2 phase. These results suggest that TBX20 may serve a functional role in cardiomyocyte proliferation by regulating cyclin B1 and P27 expression during heart morphogenesis. Furthermore, increased expression of GATA4 was observed following inhibition of TBX20 in the same cell lines, which may affect the maturation and differentiation of cardiomyocytes in vivo and lead to cardiac hypertrophy observed in CHD patients. We hypothesize that the inhibition of TBX20 expression alters normal development of the heart and leads to the occurrence of CHDs, and that a role is played by TBX20 in heart development.

Acknowledgments

The present study was supported by the National Natural Science Foundation of China (grant no. 81070131) and the Program for Liaoning Excellent Talents in University (grant no. LJQ2012069).

References

1 

Hoffman JI and Kaplan S: The incidence of congenital heart disease. J Am Coll Cardiol. 39:1890–1900. 2002. View Article : Google Scholar : PubMed/NCBI

2 

van der Linde D, Konings EE, Slager MA, Witsenburg M, Helbing WA, Takkenberg JJ and Roos-Hesselink JW: Birth prevalence of congenital heart disease worldwide: A systematic review and meta-analysis. J Am Coll Cardiol. 58:2241–2247. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Thienpont B, Mertens L, de Ravel T, Eyskens B, Boshoff D, Maas N, Fryns JP, Gewillig M, Vermeesch JR and Devriendt K: Submicroscopic chromosomal imbalances detected by array-CGH are a frequent cause of congenital heart defects in selected patients. Eur Heart J. 28:2778–2784. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Corrigan N, Brazil DP and McAuliffe F: Fetal cardiac effects of maternal hyperglycemia during pregnancy. Birth Defects Res A Clin Mol Teratol. 85:523–530. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Gong LG, Qiu GR, Jiang H, Xu XY, Zhu HY and Sun KL: Analysis of single nucleotide polymorphisms and haplotypes in HOXC gene cluster within susceptible region 12q13 of simple congenital heart disease. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 22:497–501. 2005.PubMed/NCBI

6 

Srivastava D: Making or breaking the heart: From lineage determination to morphogenesis. Cell. 126:1037–1048. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Cai CL, Zhou W, Yang L, Bu L, Qyang Y, Zhang X, Li X, Rosenfeld MG, Chen J and Evans S: T-box genes coordinate regional rates of proliferation and regional specification during cardiogenesis. Development. 132:2475–2487. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Singh MK, Christoffels VM, Dias JM, Trowe MO, Petry M, Schuster-Gossler K, Bürger A, Ericson J and Kispert A: Tbx20 is essential for cardiac chamber differentiation and repression of Tbx2. Development. 132:2697–2707. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Stennard FA, Costa MW, Lai D, Biben C, Furtado MB, Solloway MJ, McCulley DJ, Leimena C, Preis JI, Dunwoodie SL, et al: Murine T-box transcription factor Tbx20 acts as a repressor during heart development, and is essential for adult heart integrity, function and adaptation. Development. 132:2451–2462. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Takeuchi JK, Mileikovskaia M, Koshiba-Takeuchi K, Heidt AB, Mori AD, Arruda EP, Gertsenstein M, Georges R, Davidson L, Mo R, et al: Tbx20 dose-dependently regulates transcription factor networks required for mouse heart and motoneuron development. Development. 132:2463–2474. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Qian L, Mohapatra B, Akasaka T, Liu J, Ocorr K, Towbin JA and Bodmer R: Transcription factor neuromancer/TBX20 is required for cardiac function in Drosophila with implications for human heart disease. Proc Natl Acad Sci USA. 105:19833–19838. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Kirk EP, Sunde M, Costa MW, Rankin SA, Wolstein O, Castro ML, Butler TL, Hyun C, Guo G, Otway R, et al: Mutations in cardiac T-box factor gene TBX20 are associated with diverse cardiac pathologies, including defects of septation and valvulogenesis and cardiomyopathy. Am J Hum Genet. 81:280–291. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Liu C, Shen A, Li X, Jiao W, Zhang X and Li Z: T-box transcription factor TBX20 mutations in Chinese patients with congenital heart disease. Eur J Med Genet. 51:580–587. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Posch MG, Gramlich M, Sunde M, Schmitt KR, Lee SH, Richter S, Kersten A, Perrot A, Panek AN, Al Khatib IH, et al: A gain-of-function TBX20 mutation causes congenital atrial septal defects, patent foramen ovale and cardiac valve defects. J Med Genet. 47:230–235. 2010. View Article : Google Scholar :

15 

Pan Y, Geng R, Zhou N, Zheng GF, Zhao H, Wang J, Zhao CM, Qiu XB, Yang YQ and Liu XY: TBX20 loss-of-function mutation contributes to double outlet right ventricle. Int J Mol Med. 35:1058–1066. 2015.PubMed/NCBI

16 

Chen J, Sun F, Fu J and Zhang H: Association of TBX20 gene polymorphism with congenital heart disease in Han Chinese neonates. Pediatr Cardiol. 36:737–742. 2015. View Article : Google Scholar

17 

Shen T, Aneas I, Sakabe N, Dirschinger RJ, Wang G, Smemo S, Westlund JM, Cheng H, Dalton N, Gu Y, et al: Tbx20 regulates a genetic program essential to adult mouse cardiomyocyte function. J Clin Invest. 121:4640–4654. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar

19 

Hammer S, Toenjes M, Lange M, Fischer JJ, Dunkel I, Mebus S, Grimm CH, Hetzer R, Berger F and Sperling S: Characterization of TBX20 in human hearts and its regulation by TFAP2. J Cell Biochem. 104:1022–1033. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Kubben FJ, Peeters-Haesevoets A, Engels LG, Baeten CG, Schutte B, Arends JW, Stockbrügger RW and Blijham GH: Proliferating cell nuclear antigen (PCNA): A new marker to study human colonic cell proliferation. Gut. 35:530–535. 1994. View Article : Google Scholar : PubMed/NCBI

21 

Stennard FA and Harvey RP: T-box transcription factors and their roles in regulatory hierarchies in the developing heart. Development. 132:4897–4910. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Chakraborty S and Yutzey KE: Tbx20 regulation of cardiac cell proliferation and lineage specialization during embryonic and fetal development in vivo. Dev Biol. 363:234–246. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Shelton EL and Yutzey KE: Tbx20 regulation of endocardial cushion cell proliferation and extracellular matrix gene expression. Dev Biol. 302:376–388. 2007. View Article : Google Scholar

24 

Tang L, Zhang Y, Pan H, Luo Q, Zhu XM, Dong MY, Leung PC, Sheng JZ and Huang HF: Involvement of cyclin B1 in progesterone-mediated cell growth inhibition, G2/M cell cycle arrest and apoptosis in human endometrial cell. Reprod Biol Endocrinol. 7:1442009. View Article : Google Scholar

25 

Paruthiyil S, Cvoro A, Tagliaferri M, Cohen I, Shtivelman E and Leitman DC: Estrogen receptor β causes a G2 cell cycle arrest by inhibiting CDK1 activity through the regulation of cyclin B1, GADD45A and BTG2. Breast Cancer Res Treat. 129:777–784. 2011. View Article : Google Scholar

26 

Yadav V, Sultana S, Yadav J and Saini N: Gatifloxacin induces S and G2-phase cell cycle arrest in pancreatic cancer cells via p21/p27/p53. PloS One. 7:e477962012. View Article : Google Scholar : PubMed/NCBI

27 

Mitrea DM, Yoon MK, Ou L and Kriwacki RW: Disorder-function relationships for the cell cycle regulatory proteins p21 and p27. Biol Chem. 393:259–274. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Lee Y, Shioi T, Kasahara H, Jobe SM, Wiese RJ, Markham BE and Izumo S: The cardiac tissue-restricted homeobox protein Csx/Nkx2.5 physically associates with the zinc finger protein GATA4 and cooperatively activates atrial natriuretic factor gene expression. Mol Cell Biol. 18:3120–3129. 1998. View Article : Google Scholar : PubMed/NCBI

29 

Sepulveda JL, Vlahopoulos S, Iyer D, Belaguli N and Schwartz RJ: Combinatorial expression of GATA4, Nkx2-5, and serum response factor directs early cardiac gene activity. J Biol Chem. 277:25775–25782. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Vincentz JW, Barnes RM, Firulli BA, Conway SJ and Firulli AB: Cooperative interaction of Nkx2.5 and Mef2c transcription factors during heart development. Dev Dyn. 237:3809–3819. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Snyder M, Huang XY and Zhang JJ: Stat3 directly controls the expression of Tbx5, Nkx2.5, and GATA4 and is essential for cardiomyocyte differentiation of P19CL6 cells. J Biol Chem. 285:23639–23646. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Schlesinger J, Schueler M, Grunert M, Fischer JJ, Zhang Q, Krueger T, Lange M, Tönjes M, Dunkel I and Sperling SR: The cardiac transcription network modulated by Gata4, Mef2a, Nkx2.5, Srf, histone modifications and microRNAs. PLoS Genet. 7:e10013132011. View Article : Google Scholar

33 

Chen Y and Cao X: NFAT directly regulates Nkx2-5 transcription during cardiac cell differentiation. Biol Cell. 101:335–349. 2009. View Article : Google Scholar

34 

Zhao R, Watt AJ, Battle MA, Li J, Bondow BJ and Duncan SA: Loss of both GATA4 and GATA6 blocks cardiac myocyte differentiation and results in acardia in mice. Dev Biol. 317:614–619. 2008. View Article : Google Scholar : PubMed/NCBI

35 

Pu WT, Ishiwata T, Juraszek AL, Ma Q and Izumo S: GATA4 is a dosage-sensitive regulator of cardiac morphogenesis. Dev Biol. 275:235–244. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Oka T, Maillet M, Watt AJ, Schwartz RJ, Aronow BJ, Duncan SA and Molkentin JD: Cardiac-specific deletion of Gata4 reveals its requirement for hypertrophy, compensation, and myocyte viability. Circ Res. 98:837–845. 2006. View Article : Google Scholar : PubMed/NCBI

37 

Guner-Ataman B, Paffett-Lugassy N, Adams MS, Nevis KR, Jahangiri L, Obregon P, Kikuchi K, Poss KD, Burns CE and Burns CG: Zebrafish second heart field development relies on progenitor specification in anterior lateral plate mesoderm and nkx2.5 function. Development. 140:1353–1363. 2013. View Article : Google Scholar : PubMed/NCBI

38 

Zhao L, Ju D, Gao Q, Zheng X and Yang G: Over-expression of Nkx2.5 and/or cardiac α-actin inhibit the contraction ability of ADSCs-derived cardiomyocytes. Mol Biol Rep. 39:2585–2595. 2012. View Article : Google Scholar

39 

Liu H, Harris TM, Kim HH and Childs G: Cardiac myocyte differentiation: The Nkx2.5 and Cripto target genes in P19 clone 6 cells. Funct Integr Genomics. 5:218–239. 2005. View Article : Google Scholar : PubMed/NCBI

40 

Yamak A, Temsah R, Maharsy W, Caron S, Paradis P, Aries A and Nemer M: Cyclin D2 rescues size and function of GATA4 haplo-insufficient hearts. Am J Physiol Heart Circ Physiol. 303:H1057–H1066. 2012. View Article : Google Scholar : PubMed/NCBI

41 

Laforest B and Nemer M: GATA5 interacts with GATA4 and GATA6 in outflow tract development. Dev Biol. 358:368–378. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October-2016
Volume 14 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Liu P, Sun Y, Qiu G, Jiang H and Qiu G: Silencing of TBX20 gene expression in rat myocardial and human embryonic kidney cells leads to cell cycle arrest in G2 phase. Mol Med Rep 14: 2904-2914, 2016
APA
Liu, P., Sun, Y., Qiu, G., Jiang, H., & Qiu, G. (2016). Silencing of TBX20 gene expression in rat myocardial and human embryonic kidney cells leads to cell cycle arrest in G2 phase. Molecular Medicine Reports, 14, 2904-2914. https://doi.org/10.3892/mmr.2016.5660
MLA
Liu, P., Sun, Y., Qiu, G., Jiang, H., Qiu, G."Silencing of TBX20 gene expression in rat myocardial and human embryonic kidney cells leads to cell cycle arrest in G2 phase". Molecular Medicine Reports 14.4 (2016): 2904-2914.
Chicago
Liu, P., Sun, Y., Qiu, G., Jiang, H., Qiu, G."Silencing of TBX20 gene expression in rat myocardial and human embryonic kidney cells leads to cell cycle arrest in G2 phase". Molecular Medicine Reports 14, no. 4 (2016): 2904-2914. https://doi.org/10.3892/mmr.2016.5660