Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
February-2018 Volume 17 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2018 Volume 17 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

N‑cadherin attenuates nucleus pulposus cell senescence under high‑magnitude compression

  • Authors:
    • Ming Niu
    • Fei Ma
    • Jun Qian
    • Junwei Li
    • Tong Wang
    • Yuzhen Gao
    • Jian Jin
  • View Affiliations / Copyright

    Affiliations: The Second Department of Surgery, Ganzhou People's Hospital, Zhangye, Gansu 734000, P.R. China, The First Department of Orthopaedic Surgery, Zhangye People's Hospital Affiliated to Hexi University, Zhangye, Gansu 734000, P.R. China, Department of Spine Surgery, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong 510515, P.R. China
    Copyright: © Niu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2879-2884
    |
    Published online on: December 11, 2017
       https://doi.org/10.3892/mmr.2017.8239
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Mechanical compression is important in disc degeneration. N-cadherin (N-CDH)-mediated signaling contributes to the maintenance of the normal nucleus pulposus (NP) cell phenotype and NP matrix biosynthesis. Our preliminary study demonstrated that a high‑magnitude compression (20% deformation) promotes NP cell senescence in a three‑dimensional scaffold culture system. The aim of the present study was to investigate whether N‑CDH‑mediated signaling alleviates NP cell senescence under the above‑mentioned high‑magnitude compression. NP cells were transfected with recombinant lentiviral vectors to enhance N‑CDH expression. All the transfected or un‑transfected NP cells were seeded into the scaffolds and subjected to 20% deformation at a frequency of 1.0 Hz for 4 h once per day for 5 days. Results indicated that N‑CDH overexpressed NP cells exhibited decreased senescence‑associated β‑galactosidase activity and downregulated expression levels of senescence‑associated markers (p16 and p53). Furthermore, the N‑CDH overexpressed NP cells exhibited increased cell proliferation potency, telomerase activity and matrix biosynthesis compared with NP cells without N‑CDH overexpression under high‑magnitude compression. Thus, N‑CDH‑mediated signaling contributes to the attenuation of NP cell senescence under high‑magnitude compression.

Introduction

Intervertebral disc degeneration (IDD) is regarded as a leading cause of lower back and leg pain (1). Due to a lack of complete understanding of the pathogenesis of IDD, current treatments are effective in symptomatic relief, but not biological regeneration of degenerative disc tissue (2–4). Further studies are required to develop effective regenerative strategies for IDD.

The intervertebral disc (IVD) functions as a connection structure that absorbs and transmits mechanical load (5). Under physiological conditions, the disc is subjected to various magnitudes of mechanical compression (6,7). In line with previous studies, it was demonstrated that mechanical compression significantly affected disc biology in vitro (8,9). Furthermore, our preliminary study identified that a high-magnitude compression (20% deformation) promoted nucleus pulposus (NP) cell senescence in a three-dimensional (3D) scaffold culture system (unpublished data). As NP senescence is a classical cellular characteristic during disc degeneration (10,11), it is proposed that prevention of NP cell senescence may be a potential mechanism to alleviate high-magnitude compression-induced disc degeneration.

N-cadherin (N-CDH) is an adhesion molecule that was initially identified in the nervous system (12,13). Recent studies have indicated that N-CDH is a molecule that is highly expressed in normal NP cells and is gradually downregulated with disc degeneration (14,15). Notably, N-CDH-mediated signaling facilitates with maintaining a normal NP cell phenotype and NP matrix biosynthesis under the stimulation of certain pathological factors (16,17). However, the effects of N-CDH-mediated signaling on NP cell senescence remain unclear.

Therefore, the aim of the present study was to investigate the effects of N-CDH-mediated signaling on NP cell senescence under high-magnitude compression. To achieve this objective, a 3D scaffold culture system based upon a self-developed perfusion bioreactor was involved (18). NP cell senescence was evaluated by senescence-associated β-galactosidase (SA-β-Gal) activity, NP cell proliferation, telomerase activity, senescence marker (p16 and p53) expression levels and the matrix homeostatic phenotype.

Materials and methods

Ethical statement

All experimental animals were used in accordance with the relevant guidelines [SYXK (YU) 2012-0012] of the Ethics Committee at Southwest Hospital affiliated to the Third Military Medical University (Chongqing, China).

Disc harvest and NP cell isolation

Twenty-five healthy New Zealand rats (weight, 250 g; age, 6–8 weeks) were obtained from the Animal Center of Third Military Medical University (Chongqing, China) and sacrificed by excessive carbon dioxide exposure. Briefly, after NP tissues were separated from the harvested thoracic and lumbar discs, NP tissue samples were sequentially digested with Gibco 0.25% trypsin (Thermo Fisher Scientific, Inc., Waltham, MA, USA) for 3–5 min at 37°C and Sigma-Aldrich type I collagenase (0.25%; Merck KGaA, Darmstadt, Germany) for 10 min. Subsequently, NP cell pellets were collected by centrifugation (500 × g at 4°C for 5 min) and cultured in Dulbecco's modified Eagle's medium/F12 (Gibco; Thermo Fisher Scientific, Inc. medium containing Gibco 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.) and 1% (v/v) penicillin-streptomycin (Gibco; Thermo Fisher Scientific, Inc.) under standard conditions (37°C, 20% O2 and 5% CO2).

NP cell transfection

NP cells were seeded in a 24-well plate and grown to 40–50% confluence. Subsequently, NP cells were incubated with 400 µl fresh culture medium containing 40 µl concentrate of recombinant lentiviral vectors (Shanghai GenePharma Co., Ltd., Shanghai, China) for 48 h to overexpress N-CDH in the NP cells (NP-N-CDH). NP cells transfected with negative vectors served as controls (NP-N-CDH-NC). Thereafter, the transfected cells were further selected via puromycin for 4–6 days. N-CDH overexpression in NP cells was verified by quantitative polymerase chain reaction (qPCR) and western blotting assays.

Compression application on NP cells

The transfected or un-transfected NP cells were suspended in collagen solution (1 mg/ml; Shengyou Biotechnology Co., Ltd., Hangzhou, China) and seeded into the prepared bovine decalcified bone matrix scaffold [DBM; 10×10×5 mm (1×107 cells per DBM)], provided by Tissue Engineering Center of the Third Military Medical University (Chongqing, China). After NP cells seeded in the scaffold were pre-cultured under standard conditions (37°C, 20% O2 and 5% CO2) for 2 days, NP cells seeded in the DBM scaffolds were perfusion-cultured at 37°C in the tissue culture chambers of the self-developed bioreactor (Fig. 1) for 5 days, and simultaneously subjected to dynamic compression (20% deformation at a frequency of 1.0 Hz for 4 h once per day).

Figure 1.

Image of the substance exchanger-based perfusion bioreactor. 1, medium reservoir; 2, substance exchanger; 3, peristaltic pump; 4, tissue culture chamber; 5, pH, PO2 and PCO2 sensor.

SA-β-Gal activity

Subsequent to compression, NP cells seeded in the scaffold were collected by digestion with 0.05% trypsin and 0.1% collagenase I. The NP cells (1×104 per group) were allowed to adhere in 6-well plates within 6–8 h. Subsequently, an SA-β-Gal staining assay was performed according to the manufacturer's instructions (Beyotime Institute of Biotechnology, Haimen, China). Finally, SA-β-Gal stain-positive cells were observed under an Olympus BX51 light microscope (Olympus Corp., Tokyo, Japan) and SA-β-Gal activity expressed as the percentage of SA-β-Gal stain-positive cells to the total cells was analyzed using the Image-Pro Plus software (Version 5.1.0.20; Media Cybernetics, Inc., Rockville, MD, USA).

Cell proliferation assay

Following compression, NP cells seeded in the scaffold were harvested as described above. NP cells (3×103 cells per group) were seeded in a 96-well plate and NP cell proliferation was detected at 6, 24 and 48 h using a Cell Counting Κit-8 (CCK-8; C0037; Beyotime Institute of Biotechnology).

Telomerase activity detection

Subsequent to compression, NP cells seeded in the scaffold were harvested as described above. The NP cell pellets were incubated with RIPA lysis buffer (Beyotime Institute of Biotechnology) and centrifuged (12,000 × g at 4°C for 5 min) to collect the supernatant. Then, a telomerase ELISA kit (ml-003023; Mlbio, Shanghai, China) was used to measure telomerase activity (IU/l) according to the manufacturer's instructions.

Cell cycle analysis

Following compression, NP cells seeded in the scaffold were harvested as described above. The NP cell pellets were fixed with 75% ethanol overnight at 4°C and stained with propidium iodide solution (50 µg/ml; Beyotime Institute of Biotechnology) and RNase A (100 µg/ml; Beyotime Institute of Biotechnology) for 30 min at 4°C. Subsequently, NP cells were subjected to flow cytometry assay and the fraction of each cell cycle phase (G0/G1, G2/M and S) was calculated using the multicycle software (FlowJo 7.6.1, Engine 2.79000; Phenix Co., Ltd., Tokyo, Japan).

qPCR analysis

Gene expression of senescence markers (p16 and p53) and matrix macromolecules (aggrecan and collagen II) was analyzed by qPCR assay. Briefly, total RNA was extracted using TriPure Isolation Reagent (11667157001, Roche Applied Science, Penzberg, Germany) and synthesized into cDNA using a First Strand cDNA Synthesis kit (04379012001, Roche Applied Science). Then, qPCR was performed using a reaction system containing cDNA, SYBR Green Mix (Toyobo Life Science, Osaka, Japan) and primers (Table I). The thermal cycling conditions for all reactions were as follows: 5 min at 95°C, followed by 35 amplification cycles of 30 sec at 95°C, 20 sec at 56°C and 15 sec at 72°C. β-actin served as an internal reference and the relative gene expression was expressed as 2−ΔΔCq (19).

Table I.

Primers of target genes.

Table I.

Primers of target genes.

GeneAccession no.Forward (5′-3′)Reverse (5′-3′)
β-actinNM_031144.3 CCGCGAGTACAACCTTCTTG TGACCCATACCCACCATCAC
AggrecanXM_002723376.1 ATGGCATTGAGGACAGCGAA GCTCGGTCAAAGTCCAGTGT
Collagen IINM_012929.1 GCCAGGATGCCCGAAAATTAG CCAGCCTTCTCGTCAAATCCT
P53XM_008767773.1 CCTTAAGATCCGTGGGCGT GCTAGCAGTTTGGGCTTTCC
P16NM_031550.1 TACCCCGATACAGGTGATGA TACCGCAAATACCGCACGA
Western blot analysis

Protein expression levels of senescence markers (p16 and p53) and matrix macromolecules (aggrecan and collagen II) were analyzed by western blotting assay. Briefly, after the total protein was extracted using RIPA lysis solution (Beyotime Institute of Biotechnology) and the protein concentration was measured using a BCA kit (P0009, Beyotime Institute of Biotechnology), protein samples were subjected to an 12% SDS-PAGE system and transferred to a polyvinylidene difluoride (PVDF) membrane (100 V for 60 min). Then, the PVDF membrane was incubated with primary antibodies [β-actin: ProteinTech Group, Inc., Chicago, IL, USA (cat. no. 60008–1-Ig); p16: Novus Biologicals, LLC, Littleton, CO, USA (cat. no. NBP2-37740); p53: ProteinTech Group, Inc. (cat. no. 10442-1-AP); aggrecan: Santa Cruz Biotechnology Inc. (cat. no. sc-16492); collagen II: Abcam, Cambridge, MA, USA. (cat. no. ab34712); all diluted 1:1,000] at 4°C overnight and the corresponding secondary antibodies (OriGene Technologies, Inc., Beijing, China; 1:2,000) at 37°C for 2 h. Protein bands were developed using the SuperSignal West Pico Trial kit (34080, Pierce; Thermo Fisher Scientific, Inc.) and analyzed using Image J software (v Java 1.6.0_20 32-bit, National Institutes of Health, Bethesda, MA, USA).

Statistical analysis

All data are expressed as means ± standard deviation and each experiment was performed in triplicate. After the homogeneity test for variance, comparisons between groups were performed by one-way analysis of variance using SPSS 13.0 software, and the post hoc test was determined by the least significant difference test. P<0.05 was considered to indicate a statistically significant difference.

Results

Verification of N-CDH overexpression in NP cells

To investigate the role of N-CDH in regulating NP cell senescence under high-magnitude compression, N-CDH expression in NP cells was enhanced by recombinant lentiviral vectors. Predictably, N-CDH expression in NP cells under high-magnitude compression also increased following N-CDH overexpression (Fig. 2).

Figure 2.

Verification of N-CDH overexpression in NP cells. (A) Successfully transfected NP cells were tagged with green fluorescent protein. Magnification, ×200. (B) Quantitative polymerase chain reaction and western blotting assays indicated that N-CDH expression levels were upregulated in NP cells following incubation with recombinant lentiviral vectors. (C) N-CDH expression was increased in NP cells under the high-magnitude compression (20% compressive deformation) following N-CDH overexpression. Data are expressed as the mean ± standard deviation (n=3). *P<0.05, indicates a significant difference between two groups. N-CDH, N-cadherin; NP, nucleus pulposus; NC, negative control.

Analysis of NP cell senescence phenotype following N-CDH overexpression under high-magnitude compression

Senescent cells often exhibit increased SA-β-Gal activity (20), decreased cell proliferation potency (21), aggravated G1 cell cycle arrest (22), decreased telomerase activity (23) and upregulated expression levels of senescence markers (p16 and p53) (24). Compared with NP cells without N-CDH overexpression under high-magnitude compression, N-CDH overexpressed NP cells exhibited significantly decreased SA-β-Gal activity (Fig. 3A), increased cell proliferation potency (Fig. 3B), decreased percentage of cells arrested in the G1 phase of the cell cycle (Fig. 3C), increased telomerase activity (Fig. 3D), and downregulated gene (Fig. 3E) and protein (Fig. 3F) expression levels of senescence markers (p16 and p53).

Figure 3.

N-CDH overexpression attenuated NP cell senescence under the high-magnitude compression (20% compressive deformation). (A) SA-β-Gal activity analysis (scale bar, 100 µm). (B) Cell proliferation analysis. (C) Cell cycle analysis. (D) Telomerase activity measurement. (E) Quantitative polymerase chain reaction analysis of gene expression of senescence markers (p16 and p53). (F) Western blot analysis of protein expression levels of senescence markers (p16 and p53). Data are expressed as the mean ± standard deviation (n=3). *P<0.05, indicates a significant difference between two groups. N-CDH, N-cadherin; NP, nucleus pulposus; NC, negative control.

Analysis of the expression levels of matrix macromolecules in NP cells following N-CDH overexpression under high-magnitude compression

Senescent cells demonstrate altered matrix metabolism and matrix catabolism is often promoted in senescent cells (25,26). qPCR indicated that the gene expression of matrix macromolecules (aggrecan and collagen II) in N-CDH overexpressed NP cells was higher than that in NP cells without N-CDH overexpression under high-magnitude compression (Fig. 4A). Additionally, protein expression levels of these matrix macromolecules presented a similar trend (Fig. 4B).

Figure 4.

N-CDH overexpression upregulated the expression levels of NP matrix macromolecules (aggrecan and collagen II) under the high-magnitude compression (20% compressive deformation). (A and B) Quantitative polymerase chain reaction and western blot analysis of the expression levels of aggrecan and collagen II, respectively. Data are expressed as the mean ± standard deviation (n=3). *P<0.05, indicates a significant difference between two groups. N-CDH, N-cadherin; NP, nucleus pulposus; NC, negative control.

Discussion

It is well established that mechanical load has important effects on disc biology, and that the un-physiological load is a validated risk factor that initiates and aggravates disc degeneration (27–29). Disc cell senescence is a type of typical pathology during disc degeneration (10,11). Our preliminary study demonstrated that high-magnitude compression (20% compressive deformation) promoted NP cell senescence in a 3D scaffold culture system (unpublished data). The present results demonstrated for the first time, to the best of our knowledge, that N-CDH-mediated signaling attenuated NP cell senescence under high-magnitude compression.

N-CDH is a molecular marker of normal juvenile disc NP cells (14,15). Previous studies have indicated that N-CDH-mediated signaling was helpful for promoting NP matrix biosynthesis and maintaining a normal NP cell phenotype (16,17). Here, to investigate whether N-CDH-mediated signaling attenuates NP cell senescence under a high-magnitude compression, N-CDH expression was enhanced during the current study using recombinant lentiviral vectors (Fig. 2).

There are various parameters for evaluating cell senescence, such as SA-β-Gal activity and telomerase activity (20,23). The present results demonstrated that N-CDH overexpression decreased SA-β-Gal activity, whereas it increased telomerase activity in NP cells under high-magnitude compression. In addition, senescent cells are often arrested in the G1 phase of the cell cycle, which lead to a limited cell proliferation potency (21,22). Consistently, the present result indicated that NP cells exhibited a decrease in the percentage of G1 phase fractions and an increase in cell proliferation potency under the high-magnitude compression following N-CDH overexpression. Thus, these findings indicate that N-CDH overexpression attenuates NP cell senescence under high-magnitude compression.

Disc cell senescence results from the natural disc aging process, as well as possibly being induced by various stresses, including growth factor insufficiency, oxidative damage, inflammation reaction and mechanical injury (11). There are two approaches responsible for the transduction senescence signal: Replicative senescence (RS) mediated by the p53-p21-pRB signaling pathway and stress-induced premature senescence (SIPS) mediated by the p16-pRB signaling pathway (24). The current results demonstrated that N-CDH overexpression downregulated expression levels of senescence markers (p16 and p53) under high-magnitude compression, indicating that N-CDH overexpression attenuates mechanical overloading-induced NP cell senescence by targeting RS and SIPS. The matrix homeostatic phenotype is an indirect indicator for evaluating cell senescence. The current study identified that expression levels of matrix macromolecules in N-CDH overexpressed NP cells were significantly increased under high-magnitude compression, further indicating that N-CDH overexpression attenuates NP cell senescence under high-magnitude compression.

In conclusion, N-CDH overexpression attenuated NP cell senescence under high-magnitude compression. Although this study provides an improved understanding of NP senescence, the potential signaling transduction behind this process requires further investigation. However, the current study provides an experimental basis for the protective effects of N-CDH on disc biology under high-magnitude compression and contributes to developing novel strategies to alleviate mechanical overload-induced disc degeneration.

Acknowledgements

The present study received funding from the National Natural Science Foundation of China (grant no. 81601932). We also appreciate Dr Li P (Third Military Medical University, Chongqing, China) for his technical help and experiment platform support.

References

1 

Chen JW, Ni BB, Li B, Yang YH, Jiang SD and Jiang LS: The responses of autophagy and apoptosis to oxidative stress in nucleus pulposus cells: Implications for disc degeneration. Cell Physiol Biochem. 34:1175–1189. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Yang SD, Ma L, Gu TX, Ding WY, Zhang F, Shen Y, Zhang YZ, Yang DL, Zhang D, Sun YP and Song YL: 17β-Estradiol protects against apoptosis induced by levofloxacin in rat nucleus pulposus cells by upregulating integrin α2β1. Apoptosis. 19:789–800. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Yang SD, Ma L, Yang DL and Ding WY: Combined effect of 17β-estradiol and resveratrol against apoptosis induced by interleukin-1β in rat nucleus pulposus cells via PI3K/Akt/caspase-3 pathway. PeerJ. 4:e16402016. View Article : Google Scholar : PubMed/NCBI

4 

Yang SD, Yang DL, Sun YP, Wang BL, Ma L, Feng SQ and Ding WY: 17β-estradiol protects against apoptosis induced by interleukin-1β in rat nucleus pulposus cells by down-regulating MMP-3 and MMP-13. Apoptosis. 20:348–357. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Lee CR, Iatridis JC, Poveda L and Alini M: In vitro organ culture of the bovine intervertebral disc: Effects of vertebral endplate and potential for mechanobiology studies. Spine (Phila Pa 1976). 31:515–522. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Neidlinger-Wilke C, Galbusera F, Pratsinis H, Mavrogonatou E, Mietsch A, Kletsas D and Wilke HJ: Mechanical loading of the intervertebral disc: From the macroscopic to the cellular level. Eur Spine J. 3 Suppl 23:S333–S343. 2014. View Article : Google Scholar

7 

Hwang D, Gabai AS, Yu M, Yew AG and Hsieh AH: Role of load history in intervertebral disc mechanics and intradiscal pressure generation. Biomech Model Mechanobiol. 11:95–106. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Li P, Gan Y, Wang H, Zhang C, Wang L, Xu Y, Song L, Li S, Li S, Ou Y and Zhou Q: Dynamic compression effects on immature nucleus pulposus: A study using a novel intelligent and mechanically active bioreactor. Int J Med Sci. 13:225–234. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Li P, Gan Y, Xu Y, Song L, Wang H, Zhang C, Wang L, Zhao C, Luo L and Zhou Q: Matrix homeostasis within the immature annulus fibrosus depends on the frequency of dynamic compression: A study based on the self-developed mechanically active bioreactor. Biomech Model Mechanobiol. 16:385–394. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Gruber HE, Ingram JA, Norton HJ and Hanley EN Jr: Senescence in cells of the aging and degenerating intervertebral disc: Immunolocalization of senescence-associated beta-galactosidase in human and sand rat discs. Spine (Phila Pa 1976). 32:321–327. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Wang F, Cai F, Shi R, Wang XH and Wu XT: Aging and age related stresses: A senescence mechanism of intervertebral disc degeneration. Osteoarthritis Cartilage. 24:398–408. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Brusés JL: N-cadherin signaling in synapse formation and neuronal physiology. Mol Neurobiol. 33:237–252. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Halbleib JM and Nelson WJ: Cadherins in development: Cell adhesion, sorting, and tissue morphogenesis. Genes Dev. 20:3199–3214. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Lv F, Leung VY, Huang S, Huang Y, Sun Y and Cheung KM: In search of nucleus pulposus-specific molecular markers. Rheumatology (Oxford). 53:600–610. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Minogue BM, Richardson SM, Zeef LA, Freemont AJ and Hoyland JA: Transcriptional profiling of bovine intervertebral disc cells: Implications for identification of normal and degenerate human intervertebral disc cell phenotypes. Arthritis Res Ther. 12:R222010. View Article : Google Scholar : PubMed/NCBI

16 

Hwang PY, Jing L, Chen J, Lim FL, Tang R, Choi H, Cheung KM, Risbud MV, Gersbach CA, Guilak F, et al: N-cadherin is key to expression of the nucleus pulposus cell phenotype under selective substrate culture conditions. Sci Rep. 6:280382016. View Article : Google Scholar : PubMed/NCBI

17 

Hwang PY, Jing L, Michael KW, Richardson WJ, Chen J and Setton LA: N-cadherin-mediated signaling regulates cell phenotype for nucleus pulposus cells of the intervertebral disc. Cell Mol Bioeng. 8:51–62. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Li ST, Liu Y, Zhou Q, Lue RF, Song L, Dong SW, Guo P and Kopjar B: A novel axial-stress bioreactor system combined with a substance exchanger for tissue engineering of 3D constructs. Tissue Eng Part C Methods. 20:205–214. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Dimri GP, Lee X, Basile G, Acosta M, Scott G, Roskelley C, Medrano EE, Linskens M, Rubelj I, Pereira-Smith O, et al: A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci USA. 92:pp. 9363–9367. 1995; View Article : Google Scholar : PubMed/NCBI

21 

Gruber HE, Ingram JA, Davis DE and Hanley EN Jr: Increased cell senescence is associated with decreased cell proliferation in vivo in the degenerating human annulus. Spine J. 9:210–215. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Oshima J and Campisi J: Fundamentals of cell proliferation: Control of the cell cycle. J Dairy Sci. 74:2778–2787. 1991. View Article : Google Scholar : PubMed/NCBI

23 

Chatterjee S: Telomeres in health and disease. J Oral Maxillofac Pathol. 21:87–91. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Beauséjour CM, Krtolica A, Galimi F, Narita M, Lowe SW, Yaswen P and Campisi J: Reversal of human cellular senescence: Roles of the p53 and p16 pathways. EMBO J. 22:4212–4222. 2003. View Article : Google Scholar : PubMed/NCBI

25 

van Deursen JM: The role of senescent cells in ageing. Nature. 509:439–446. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Cristofalo VJ, Lorenzini A, Allen RG, Torres C and Tresini M: Replicative senescence: A critical review. Mech Ageing Dev. 125:827–848. 2004. View Article : Google Scholar : PubMed/NCBI

27 

Gao X, Zhu Q and Gu W: Prediction of glycosaminoglycan synthesis in intervertebral disc under mechanical loading. J Biomech. 49:2655–2661. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Jünger S, Gantenbein-Ritter B, Lezuo P, Alini M, Ferguson SJ and Ito K: Effect of limited nutrition on in situ intervertebral disc cells under simulated-physiological loading. Spine (Phila Pa 1976). 34:1264–1271. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Chan SC, Ferguson SJ and Gantenbein-Ritter B: The effects of dynamic loading on the intervertebral disc. Eur Spine J. 20:1796–1812. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Niu M, Ma F, Qian J, Li J, Wang T, Gao Y and Jin J: N‑cadherin attenuates nucleus pulposus cell senescence under high‑magnitude compression. Mol Med Rep 17: 2879-2884, 2018.
APA
Niu, M., Ma, F., Qian, J., Li, J., Wang, T., Gao, Y., & Jin, J. (2018). N‑cadherin attenuates nucleus pulposus cell senescence under high‑magnitude compression. Molecular Medicine Reports, 17, 2879-2884. https://doi.org/10.3892/mmr.2017.8239
MLA
Niu, M., Ma, F., Qian, J., Li, J., Wang, T., Gao, Y., Jin, J."N‑cadherin attenuates nucleus pulposus cell senescence under high‑magnitude compression". Molecular Medicine Reports 17.2 (2018): 2879-2884.
Chicago
Niu, M., Ma, F., Qian, J., Li, J., Wang, T., Gao, Y., Jin, J."N‑cadherin attenuates nucleus pulposus cell senescence under high‑magnitude compression". Molecular Medicine Reports 17, no. 2 (2018): 2879-2884. https://doi.org/10.3892/mmr.2017.8239
Copy and paste a formatted citation
x
Spandidos Publications style
Niu M, Ma F, Qian J, Li J, Wang T, Gao Y and Jin J: N‑cadherin attenuates nucleus pulposus cell senescence under high‑magnitude compression. Mol Med Rep 17: 2879-2884, 2018.
APA
Niu, M., Ma, F., Qian, J., Li, J., Wang, T., Gao, Y., & Jin, J. (2018). N‑cadherin attenuates nucleus pulposus cell senescence under high‑magnitude compression. Molecular Medicine Reports, 17, 2879-2884. https://doi.org/10.3892/mmr.2017.8239
MLA
Niu, M., Ma, F., Qian, J., Li, J., Wang, T., Gao, Y., Jin, J."N‑cadherin attenuates nucleus pulposus cell senescence under high‑magnitude compression". Molecular Medicine Reports 17.2 (2018): 2879-2884.
Chicago
Niu, M., Ma, F., Qian, J., Li, J., Wang, T., Gao, Y., Jin, J."N‑cadherin attenuates nucleus pulposus cell senescence under high‑magnitude compression". Molecular Medicine Reports 17, no. 2 (2018): 2879-2884. https://doi.org/10.3892/mmr.2017.8239
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team