Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2018 Volume 18 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2018 Volume 18 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling

  • Authors:
    • Xiaoyun Li
    • Bojia Peng
    • Yanbin Pan
    • Panpan Wang
    • Kehuan Sun
    • Xiaotong Lei
    • Ling Ou
    • Zhidi Wu
    • Xiaoguang Liu
    • Haixia Wang
    • Haibin He
    • Shu Mo
    • Ya Tian
    • Xunqian Peng
    • Xiaofeng Zhu
    • Ronghua Zhang
    • Li Yang
  • View Affiliations / Copyright

    Affiliations: Department of Traditional Chinese Pharmacology, College of Pharmacy, Jinan University, Guangzhou, Guangdong 510632, P.R. China, College of Traditional Chinese Medicine, Jinan University, Guangzhou, Guangdong 510632, P.R. China, Department of The First Affiliated Hospital, Jinan University, Guangzhou, Guangdong 510630, P.R. China
  • Pages: 3483-3489
    |
    Published online on: July 26, 2018
       https://doi.org/10.3892/mmr.2018.9325
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Icariin (ICA) is a major active ingredient in Herba epimedii, which is commonly used as a Chinese herbal medicine for the treatment of osteoporosis. Previous studies have revealed that ICA exerted a protective effect against bone loss and increased bone regeneration; however, the association between ICA and estrogen receptor (ER) signaling remains unclear. The aim of the present study was to determine the effect of ICA on rat bone marrow stromal cells (rBMSCs). Cell Counting Kit‑8 assays were conducted to measure proliferation, alkaline phosphatase (ALP) activity was evaluated to assess osteoblast differentiation, and reverse transcription‑quantitative polymerase chain reaction as well as western blotting were performed to detect the expression of cellular and molecular markers of osteogenic or adipogenic differentiation. The results demonstrated that treatment of rBMSCs with 10‑6 M ICA stimulated rBMSC proliferation and ALP activity. Furthermore, ICA treatment increased the expression of the osteogenic markers runt‑related transcription factor 2, collagen type 1 and bone morphogenetic Protein 2; however, it also decreased the expression of the adipogenic differentiation markers peroxisome proliferator‑activated receptor gamma and CCAAT/enhancer‑binding protein α. Treatment of rBMSCs with ICI182780, an ER antagonist, blocked the effects of ICA. Taken together, these findings indicated that ICA may stimulate osteoblast differentiation and inhibit adipogenic differentiation via the activation of the ER signaling pathway. Therefore, ICA has the potential to serve as a therapeutic alternative for the prevention and treatment of osteoporosis.

Introduction

There is a dynamic balance between osteoblast and adipocyte differentiation of bone marrow stromal cells (BMSCs). Under the action of signaling pathways, BMSCs have the potential to differentiate into osteoblasts or adipocytes (1). Postmenopausal osteoporosis (PMOP) is a skeletal disorder that results from osteoclastic bone resorption outpacing osteoblastic bone formation, is induced by estrogen deficiency, and characterized by decreased bone mass with an increased risk of fragility fracture (2). Current drugs available to treat PMOP aim to decrease osteoclastic activity or increase osteoblastic activity. Although estrogen replacement therapy is commonly used for PMOP prevention and treatment, it increases the risk of breast cancer and venous thromboembolism, and therefore, the risks outweigh the beneficial anti-resorptive effects of estrogen therapy (3). Denosumab, an androgen deprivation therapy, has reported side effects including sexual dysfunction, fatigue and metabolic syndrome (4). Bisphosphonates, the first-line anti-resorptive drug, have also been used to treat PMOP (5). However, due to the high incidence of osteonecrosis of the jaw and atypical femoral fractures in patients administered oral bisphosphonates for PMOP, such drugs cannot be routinely administered to patients in clinic (6). Therefore, there is a great need to seek novel therapeutic strategies and/or natural therapies that stimulate an anabolic effect on osteoporotic bone in PMOP patients.

The process of rat BMSC (rBMSC) differentiation involves various signaling pathways including MAPK and Notch pathway. Recently, plant-derived phytochemicals have received attention for their ability to induce osteoblast and osteoclast activity. Phytochemicals with promising therapeutic potential for osteoporosis include isoflavones, stilbenes and flavonoids (7). Icariin (ICA) is a major active flavonoid glycoside extracted from the Chinese herbal medicinal plant Epimedii, and it acts as a phytoestrogen. A study has shown that ICA protected against bone loss induced by ovariectomy or glucocorticoids (8). ICA treatment could increase osteogenic differentiation and bone formation of BMSCs in ovariectomized rat model of osteoporosis (9). In addition, ICA has recently been shown to play a vital role in the proliferation and osteogenic differentiation of rBMSCs and human BMSCs (10). Song et al (11) showed that ICA induced osteoblast differentiation through estrogen receptor (ER)-mediated activation of ERK and JNK signaling. Furthermore, this study showed that 17β-estradiol affects osteogenic and adipogenic differentiation through ER signaling (12). Therefore, we hypothesize that ICA may promote osteogenic differentiation of rBMSCs through an ER-mediated signaling pathway. ICI182780 (ICI) is a high affinity ER antagonist, which also acts as an agonist of the membrane-bound G-protein coupled ER (GPER).

In the experiments presented here, we used ICI as an ER antagonist. We investigate the effect of ICA on both osteogenic and adipogenic differentiation in rBMSCs, to further explore whether ICA regulates differentiation of rBMSCs via ER signaling.

Materials and methods

Cell culture

rBMSCs were purchased from Cyagen Biological Sciences (RASMX-01001; Santa Clara, CA, USA), and cultured in α-MEM (Hyclone, Pittsburg, PA, USA) containing 10% fetal bovine serum (Tbd, China) in a humidified chamber with 5% CO2 at 37°C. The medium was replaced every three days.

Cell-counting kit-8 (CCK8) assay

rBMSCs were seeded into 96-well plates at a density of 5×103 cells/well, then treated with different concentrations of ICA (10−4, 10−5, 10−6, 10−7, 10−8, 10−9 M). After culturing for 24 or 48 h, cell proliferation was measured using a CCK8 according to the manufacturer's instructions (Dojindo Laboratories, Kumamoto, Japan). Briefly, the culture medium was replaced with 100 µl α-MEM containing 10 µl CCK8, and the plates were incubated for 1 h at 37°C. Absorbance was measured at 450 nm using a multi-well spectrophotometer (BioTek, Synergy H4).

Alkaline phosphatase (ALP) activity

rBMSCs were seeded into 6-well plates at a density of 2×103 cells/well, and treated with different concentrations of ICA, as described in 2.2. Cells were treated with ICA for 3 and 7 days, and ALP activity assays were completed using ALP kits according to the manufacturer's instructions (Nanjing Jiancheng, Nanjing, China). Absorbance was measured at 520 nm using a multi-well spectrophotometer (BioTek, Synergy H4).

Alizarin red S staining

To determine calcium deposition, alizarin red staining was performed on day 7 of ICA treatment to evaluate the mineralized matrix. Cells were divided into control, 10−6 M ICA and β-estradiol (E2) treatment groups. After culturing for 7 days, the medium was removed, cells were washed three times with PBS and fixed in 95% ethanol for 10 min, then washed twice with PBS, and stained with 0.1% alizarin red at a pH of 7.2 (Sigma). After incubating for 5–10 min at room temperature, cells were again washed three times with PBS and examined via light microscopy.

Oil red O staining

rBMSCs were seeded into 6-well plates at a density of 2×103 cells/well, and divided into control, 10−6 M ICA and adipocyte-induced treatment groups. After rBMSCs were cultured for 14 days, oil red O staining was used to evaluate adipocyte differentiation of rBMSCs. Cells were rinsed twice with PBS, fixed with 4% paraformaldehyde for 15 min, then rinsed twice more with PBS. treated with 60% isopropanol for 1 min, and infusion with oil red O (Sigma-Aldrich) that was dissolved in 60% isopropanol for 20 min. This process was followed by three rinses with PBS. and then photographed.

Western blot analysis

rBMSCs were seeded into 10-cm culture dishes and divided into control, ICA, ICI and ICI+ICA treatment groups. Total protein was extracted with RIPA lysis buffer (P0013B, Beyotime, Haimen, China). Total protein was separated with sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes. The membranes were washed in TBST, blocked with 5% skim milk and incubated overnight with anti-ERα (1:1,000, ab133467, Abcam, USA) and anti-ERβ (1:1,000, ab32063, Abcam), anti-RUNX2 (1:1,000, 12556S, Cell Signaling Technology, Danvers, MA, USA), anti-BMP-2 (1:1,000, ab14933, Abcam), anti-PPARγ (1:1,000, C26H12, Cell Signaling Technology), anti-CEBP/α (1:1,000, 2295, Cell Signaling Technology). Anti-GAPDH (1:1,000, D16H11, Cell Signaling Technology) was used as a loading control. The following day, membranes were incubated with anti-rabbit IgG secondary antibody (1:4,000, 7074P2, Cell Signaling Technology). Immunoreactive bands were visualized with an electrochemiluminescence reagent (5312-1; DOCLAB, Guangzhou, China) and quantified using Image J (NIH).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

rBMSCs were seeded into 60-mm culture dishes, and divided into four groups, as aforementioned. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. cDNA was synthesized from mRNA using reverse transcriptase (AK4001; Takara, Shiga, Japan). After predenaturation at 95°C for 2 min, 40 RT-qPCR cycles were performed (95°C for 10 sec; and 60°C for 30 sec), followed by a final extension at 72°C for 10 min. Target gene expression was calculated using the formula 2−ΔΔCq (13). Gene expression was normalized to GAPDH. Gene primer sequences are shown in Table I.

Table I.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

GeneSequence (5′-3′)
ERαForward: CATCGATAAGAACCGGAGGA
Reserve: TCTGACGCTTGTGCTTCAAC
ERβForward: GAAGCTGAACCACCCAATGT
Reserve: CCAATCATGTGCACCAGTTC
RUNX2Forward: CCACCACTCACTACCACACG
Reserve: GGACGCTGACGAAGTACTAT
BMP-2Forward: GCCATCGAGGAACTTTCAGA
Reverse: TGTTCCCGAAAAATCTGGAG
PPARγForward: GGAATGCGTCATGAAAGGCG
Reserve: GCGAACTTCAGTCCAGGTCA
C/EBPαForward: TTACAACAGGCCAGGTTTCC
Reserve: CTCTGGGATGGATCGATTGT

[i] ER, estrogen receptor; RUNX2, runt-related transcription factor 2; BMP-2, bone morphogenetic Protein 2; FABP, fatty acid-binding protein; C/EBPα, CCAAT/enhancer-binding protein α; PPARγ, peroxisome proliferator-activated receptor γ.

Statistical analysis

Data were collected from three separate experiments and expressed as the mean ± standard deviation. The statistical differences were analyzed by one-way analysis of variance with Least Significant Difference and Student-Newman-Keuls post hoc tests using SPSS 19.0 software (IBM Corp., Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of different ICA concentrations on rBMSCs activity

CCK8 kits were used to measure cell activity. compared to control, treatment of rBMSCs with 10−6 M ICA resulted in significantly increased cell activity at 24 and 48 h (Fig. 1; *P<0.05).

Figure 1.

Effects of different concentrations of ICA on rBMSCs activity. rBMSCs were treated with different concentrations of ICA for (A) 24 or (B) 48 h. Data are presented as the mean ± standard deviation (n=3). *P<0.05 vs. control. ICA, icariin; rBMSCs, rat bone marrow stromal cells.

ICA promotes osteogenic differentiation of rBMSCs

ALP is a glycoprotein associated with the formation of calcified tissue, and it is the most widely recognized marker of the osteoblast phenotype. ALP activity is partially indicative of osteogenic differentiation. Treatment of cells with 10−6 M ICA resulted in an increase in ALP activity by day of 3 of treatment, and this increase persisted through day 7 of treatment. (Fig. 2; *P<0.05). ALP activity was also increased by 10−4 M ICA on the seventh day (Fig. 2; *P<0.05). These results, together with those detailed in section 3.1, led us to choose a concentration of 10−6 ICA for the following experiments.

Figure 2.

Effects of different concentration of ICA on ALP activity. Rat bone marrow stromal cells were treated with different concentrations of ICA for (A) 3 or (B) 7 days. Data are presented as the mean ± standard deviation (n=3). *P<0.05 vs. control. ICA, icariin; ALP, alkaline phosphatase.

ICA promotes osteogenic differentiation

The number of mineralized nodules can serve as measure of osteogenic differentiation. Compare to control, the number of mineralized nodules was increased in cells treated with ICA, and was also increased cells treated with E2 (Fig. 3A-C). Fat droplets were identified by oil red O staining, and there was a reduction in the number and size of fat droplets in cells treated with ICA. (Fig. 3D-F; *P<0.05).

Figure 3.

Alizarin red and Oil red O staining. Alizarin red staining of (A) control, (B) 10−6 M ICA and (C) E2 treated cells. Oil red O staining of (D) control, (E) 10−6 M ICA, and (F) adipocyte-induced cells (magnification, ×200). ICA, icariin

ICA promotes the expression of osteogenic differentiation marker proteins and inhibits the expression of adipose differentiation marker proteins

Runt-related transcription factor 2 (RUNX2) and collagen type 1 (COL1) are markers of osteogenic differentiation, whereas peroxisome proliferator-activated receptor gamma (PPARγ) and CCAAT/enhancer-binding protein alpha (C/EBPα) are important indicators of adipose differentiation. Compare with control group, the expression levels of ERα and ERβ proteins were significantly decreased with ICI treatment (Fig. 4). Treatment of cells with ICA, resulted in a significant decrease in PPARγ and C/EBPα protein expression, and a significant increase in ERα, ERβ, RUNX2 protein expression. However, compare to ICA treatment alone, when combined treatment of ICI+ICA, resulted in a significant increase in PPARγ protein expression and a significant decrease in RUNX2 and COL1 protein expression. While C/EBPα protein expression was not significantly different (Fig. 4; *P>0.05).

Figure 4.

Western blot analysis of ERα, ERβ, RUNX2, COL1, C/EBPα and PPARγ protein expression in rBMSCs treated with ICA and/or ICI. ICA treatment resulted in the downregulation of C/EBPα and PPARγ expression, and upregulation RUNX2 and COL1 expression. All of the observed effects were blocked by ICI treatment, except for C/EBPα expression. Data are presented as the mean ± standard deviation (n=3). *P<0.05 vs. control; #P<0.05 vs. ICA. ICA, icariin; ICI, ICI182780; ER, estrogen receptor; RUNX2, runt-related transcription factor 2; COL1, collagen type 1; PPARγ, peroxisome proliferator-activated receptor-γ; C/EBPα, CCAAT/enhancer-binding protein α; rBMSCs, rat bone marrow stromal cells; CON, control.

ICA promotes the expression of osteoblast-specific genes and inhibits the expression of adipose-specific genes

Treatment of cells with ICI resulted in a significant decrease in ERα and ERβ gene expression, (Fig. 5); treating cells with ICA resulted in a significant increase in the gene expression of bone morphogenic protein-2 (BMP-2) and runx2 compared to control (Fig. 5). These genes expression changes are in accordance with the changes of protein expression detected with Western-blot, suggesting that ICA stimulates osteogenic differentiation of rBMSCs by upregulating runx2 and bmp-2 expression. In addition, pparγ and c/ebpα mRNA expression were decreased following treatment with ICA, suggesting that ICA acts to inhibit adipogenic differentiation. However, compared with ICA treatment, pparγ and c/ebpα were significantly increased, whereas bmp-2 and runx2 expression were significantly decreased with combined treatment of ICI+ICA. (Fig. 5; *P<0.05).

Figure 5.

Reverse transcription-quantitative polymerase chain reaction analysis of ERα, ERβ, RUNX2, BMP-2, C/EBPα and PPARγ gene relative expression in rat bone marrow stromal cells treated with ICA or ICI. Data are presented as the mean ± standard deviation (n=3). *P<0.05 vs. control; #P<0.05 vs. ICA. ICA, icariin; ICI, ICI182780; ER, estrogen receptor; RUNX2, runt-related transcription factor 2; BMP-2, bone morphogenetic Protein 2; PPARγ, peroxisome proliferator-activated receptor-γ; C/EBPα, CCAAT/enhancer-binding protein α.

Discussion

ER regulates physiological functions in almost all tissues in both males and females. Recent studies have shown that ER signaling plays an important role in many bone metabolism diseases (14). The classic ERs include ERα and ERβ. ERα is predominantly expressed in cortical bone, whereas ERβ shows higher levels of expression in cancellous bone (15). ERα signaling activation regulates matrix mineralization in vitro, and its deficiency may lead to osteoporosis (16), ERβ signaling activation induces osteogenic differentiation of MC3T3-E1 cells and upregulates the expression of the osteogenesis-related factors including bone GLa protein and osteopontin. Previous study has indicated that ER signaling could regulate osteogenic and adipogenic differentiation (12). Therefore, in this study, we used ICI as an ER antagonist to determine whether ICA promotes osteogenic differentiation and inhibits adipogenic differentiation in an ER-dependent fashion. We demonstrated that ICI significantly downregulated ERα and ERβ protein and gene expression, suggesting that ICI successfully blocks ER-mediated signaling.

Bone metabolism is a balance between osteoblast-driven bone formation and osteoclast-mediated bone resorption. Osteogenic differentiation and adipogenic differentiation of rBMSCs are mutual inhibitory processes (11). Previous studies have demonstrated that ICA promotes osteogenic differentiation of MC3T3-E1 cells (17) and rBMSCs (18). Treatment with 10−6 M ICA significantly increased rBMSCs activity, demonstrating that ICA promotes rBMSCs proliferation. Alizarin red S staining was used to visualize mineral deposition, and adipocyte accumulation was assessed with oil red O staining. The number of mineralized nodules was significantly increased with ICA treatment; while the number of fat droplets was significantly decreased, suggesting that ICA induces osteogenic differentiation but inhibits adipogenic differentiation. ALP is an early marker of osteoblast differentiation, and a peak in ALP activity is indicative of osteogenic differentiation (19). Treatment of 10−6 M ICA significantly increased ALP activity by the third day of treatment, and ALP activity remained elevated on the seventh day of treatment. These findings correspond to those from a previous study, which showed that ICA stimulated osteogenic differentiation (20) and inhibited adipocyte differentiation of rBMSCs (21).

RUNX2 acts as a scaffold for nucleic acids and regulatory factor involved in skeletal gene expression, and shows significantly increased expression in osteogenic differentiation (22); RUNX2 along with COL1, another important molecular marker of bone formation and bone remodeling, represent the foundation for matrix mineralization and have been shown to have increased expression or synthesis during osteogenic differentiation (23). BMP-2 plays a pivotal role in growth and differentiation. Huang et al (24) demonstrated that BMP-2 overexpression significantly stimulated osteocalcin and ALP gene expression. ICA treatment significantly upregulated the protein expression of RUNX2 and COL1 and the gene expression of runx2 and bmp-2. Together, these data suggest that ICA can promotes osteogenic differentiation. C/EBPα and PPARγ are the two molecules mostly likely to influence the regulation of adipocytes (25). In this study, the protein expression of PPARγ was significantly downregulated, as well as the genes expression of pparγ and c/ebpα, suggesting that treatment with ICA can inhibit the adipogenic differentiation of rBMSCs.

Our previous study has shown that ICA can improve osteoporosis via the Notch signaling pathway (21), as well as the MAPK signaling pathway has also been shown to be involved in ICA-mediated osteogenic differentiation (26). In the present study, we use ICI as an ER signaling pathway antagonist, to investigate the correlation between ICA and the ER signaling pathway. The results showed that ICA treatment significantly upregulate the expression of ERα and ERβ, suggesting that ICA may function by regulating ER signaling. Compared with ICA treatment alone, combined treatment with ICI+ICA resulted in a significant decrease in RUNX2 and COL1 protein expression, and a significant increase in PPARγ, but there is no change in C/EBPα protein expression. Furthermore, genes expression of runx2 and bmp-2 were also significantly decreased, while pparγ and c/ebpα were significantly with combined treatment increased. Together, these data suggest that the effects of ICA are blocked by ICI. Tao et al (27) have shown that prenylated flavonols can act as ER modulators. Taken together, these data demonstrate that ICA stimulates osteogenic differentiation and inhibits adipogenic differentiation via activation of ER signaling.

In conclusion, ICA promotes proliferation of rBMSCs, stimulates the osteogenic differentiation and mineralization of rBMSCs by regulating RUNX2, COL1 and BMP-2 expression, and inhibits adipogenic differentiation of rBMSCs by decreasing the expression of PPARγ and C/EBPα. These effects can be blocked by ICI, which suggests that ICA stimulates osteogenic differentiation and inhibits adipocyte differentiation via activation of ER signaling.

Acknowledgements

The authors would like to thank the Cancer Research Institution of Jinan University (Shandong, China) for their contribution to the study.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 81473509 and 81673837), the National Natural Fund Youth Science Fund Project (no. 81503384) and the Fundamental Research Funds for the Central Universities.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

RZ and LY conceived and designed the present study. XyL and BP performed western blotting, reverse transcription-quantitative polymerase chain reaction and Alizarin S staining, and wrote the manuscript. YP completed CCK8 counting and data analysis. PW provided the cell line and performed cell culture. XtL and KS analyzed the western blotting data. LO and ZW performed the ALP activity experiments. XgL and HW conducted complete Oil red staining. HH, SM, YT, XP and XZ designed the structure of the article, performed the literature review, and critically revised the manuscript for important intellectual content.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Berendsen AD and Olsen BR: Osteoblast-adipocyte lineage plasticity in tissue development, maintenance and pathology. Cell Mol Life Sci. 71:493–497. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Devlin MJ and Rosen CJ: The bone-fat interface: Basic and clinical implications of marrow adiposity. Lancet Diabetes Endocrinol. 3:141–147. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Eriksen EF, Díez-Pérez A and Boonen S: Update on long-term treatment with bisphosphonates for postmenopausal osteoporosis: A systematic review. Bone. 58:126–135. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Nguyen PL, Alibhai SM, Basaria S, D'Amico AV, Kantoff PW, Keating NL, Penson DF, Rosario DJ, Tombal B and Smith MR: Adverse effects of androgen deprivation therapy and strategies to mitigate them. Eur Urol. 67:825–836. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Francis MD and Valent DJ: Historical perspectives on the clinical development of bisphosphonates in the treatment of bone diseases. J Musculoskelet Neuronal Interact. 7:2–8. 2007.PubMed/NCBI

6 

Gao B, Huang Q, Lin YS, Wei BY, Guo YS, Sun Z, Wang L, Fan J, Zhang HY, Han YH, et al: Dose-dependent effect of estrogen suppresses the osteo-adipogenic transdifferentiation of osteoblasts via canonical Wnt signaling pathway. PLoS One. 9:e991372014. View Article : Google Scholar : PubMed/NCBI

7 

Zhang YL, Jiang JJ, Shen H, Chai Y, Wei X and Xie YM: Total flavonoids from Rhizoma Drynariae (Gusuibu) for treating osteoporotic fractures: Implication in clinical practice. Drug Design Dev Ther. 11:1881–1890. 2017. View Article : Google Scholar

8 

Hu J, Mao Z, He S, Zhan Y, Ning R, Liu W, Yan B and Yang J: Icariin protects against glucocorticoid induced osteoporosis, increases the expression of the bone enhancer DEC1 and modulates the PI3K/Akt/GSK β/β-catenin integrated signaling pathway. Biochem Pharmacol. 136:109–121. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Wu Y, Cao L, Xia L, Wu Q, Wang J, Wang X, Xu L, Zhou Y, Xu Y and Jiang X: Evaluation of osteogenesis and angiogenesis of icariin in local controlled release and systemic delivery for calvarial defect in ovariectomized rats. Sci Rep. 7:50772017. View Article : Google Scholar : PubMed/NCBI

10 

Fu S, Yang L, Hong H and Zhang R: Wnt/β-catenin signaling is involved in the Icariin induced proliferation of bone marrow mesenchymal stem cells. J Tradit Chin Med. 36:360–368. 2016.(In Chinese). View Article : Google Scholar : PubMed/NCBI

11 

Song L, Zhao J, Zhang X, Li H and Zhou Y: Icariin induces osteoblast proliferation, differentiation and mineralization through estrogen receptor-mediated ERK and JNK signal activation. Eur J Pharmacol. 714:15–22. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Niada S, Giannasi C, Ferreira LM, Milani A, Arrigoni E and Brini AT: 17β-estradiol differently affects osteogenic differentiation of mesenchymal stem/stromal cells from adipose tissue and bone marrow. Differentiation. 92:291–297. 2016. View Article : Google Scholar : PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Martin A, Yu J, Xiong J, Khalid AB, Katzenellenbogen B, Kim SH, Katzenellenbogen JA, Malaivijitnond S, Gabet Y, Krum SA and Frenkel B: Estrogens and androgens inhibit association of RANKL with the pre-osteoblast membrane through post-translational mechanisms. J Cell Physiol. 232:3798–3807. 2017. View Article : Google Scholar : PubMed/NCBI

15 

Bord S, Horner A, Beavan S and Juliet C: Estrogen receptors alpha and beta are differentially expressed in developing human bone. J Clin Endocrinol Metab. 86:2309–2314. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Li X, Song QS, Wang JY, Leng HJ, Chen ZQ, Liu ZJ, Dang GT and Song CL: Simvastatin induces estrogen receptor-alpha expression in bone, restores bone loss, and decreases ERα expression and uterine wet weight in ovariectomized rats. J Bone Miner Metab. 29:396–403. 2011. View Article : Google Scholar : PubMed/NCBI

17 

An X, Ma K, Zhang Z, Zhao T, Zhang X, Tang B and Li Z: miR-17, miR-21, and miR-143 enhance adipogenic differentiation from porcine bone marrow-derived mesenchymal stem cells. DNA Cell Biol. 35:410–416. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Wei Q, Zhang J, Hong G, Chen Z, Deng W, He W and Chen MH: Icariin promotes osteogenic differentiation of rat bone marrow stromal cells by activating the ERα-Wnt/β-catenin signaling pathway. Biomed Pharmacother. 84:931–939. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Stucki U, Schmid J, Hämmerle CF and Lang NP: Temporal and local appearance of alkaline phosphatase activity in early stages of guided bone regeneration. A descriptive histochemical study in humans. Clin Oral Implants Res. 12:121–127. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Wei QS, He MC, Chen MH, Chen ZQ, Yang F, Wang HB, Zhang J and He W: Icariin stimulates osteogenic differentiation of rat bone marrow stromal stem cells by increasing TAZ expression. Biomed Pharmacother. 91:581–589. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Liu H, Xiong Y, Zhu X, Gao H, Yin S, Wang J, Chen G, Wang C, Xiang L, Wang P, et al: Icariin improves osteoporosis, inhibits the expression of PPARγ, C/EBPα, FABP4 mRNA, N1ICD and jagged1 proteins, and increases Notch2 mRNA in ovariectomized rats. Exp Ther Med. 13:1360–1368. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Wang H, Jiang Z, Zhang J, Xie Z, Wang Y and Yang G: Enhanced osteogenic differentiation of rat bone marrow mesenchymal stem cells on titanium substrates by inhibiting Notch3. Arch Oral Biol. 80:34–40. 2017. View Article : Google Scholar : PubMed/NCBI

23 

Kim J, Lee HW, Rhee DK, Paton JC and Pyo S: Pneumolysin-induced autophagy contributes to inhibition of osteoblast differentiation through downregulation of Sp1 in human osteosarcoma cells. Biochim Biophys Acta. 1861:2663–2673. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Huang W, Rudkin GH, Carlsen B, Ishida K, Ghasri P, Anvar B, Yamaguchi DT and Miller TA: Overexpression of BMP-2 modulates morphology, growth, and gene expression in osteoblastic cells. Exp Cell Res. 274:226–234. 2002. View Article : Google Scholar : PubMed/NCBI

25 

Li Y, Rong Y, Bao L, Nie B, Ren G, Zheng C, Amin R, Arnold RD, Jeganathan RB and Huggins KW: Suppression of adipocyte differentiation and lipid accumulation by stearidonic acid (SDA) in 3T3-L1 cells. Lipids Health Dis. 16:1812017. View Article : Google Scholar : PubMed/NCBI

26 

Wu Y, Xia L, Zhou Y, Xu Y and Jiang X: Icariin induces osteogenic differentiation of bone mesenchymal stem cells in a MAPK-dependent manner. Cell Prolif. 48:375–384. 2015. View Article : Google Scholar : PubMed/NCBI

27 

Tao ZR, Liu J, Jiang YM, Gong L and Yang B: Synthesis of prenylated flavonols and their potents as estrogen receptor modulator. Sci Rep. 7:124452017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li X, Peng B, Pan Y, Wang P, Sun K, Lei X, Ou L, Wu Z, Liu X, Wang H, Wang H, et al: Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling. Mol Med Rep 18: 3483-3489, 2018.
APA
Li, X., Peng, B., Pan, Y., Wang, P., Sun, K., Lei, X. ... Yang, L. (2018). Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling. Molecular Medicine Reports, 18, 3483-3489. https://doi.org/10.3892/mmr.2018.9325
MLA
Li, X., Peng, B., Pan, Y., Wang, P., Sun, K., Lei, X., Ou, L., Wu, Z., Liu, X., Wang, H., He, H., Mo, S., Tian, Y., Peng, X., Zhu, X., Zhang, R., Yang, L."Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling". Molecular Medicine Reports 18.3 (2018): 3483-3489.
Chicago
Li, X., Peng, B., Pan, Y., Wang, P., Sun, K., Lei, X., Ou, L., Wu, Z., Liu, X., Wang, H., He, H., Mo, S., Tian, Y., Peng, X., Zhu, X., Zhang, R., Yang, L."Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling". Molecular Medicine Reports 18, no. 3 (2018): 3483-3489. https://doi.org/10.3892/mmr.2018.9325
Copy and paste a formatted citation
x
Spandidos Publications style
Li X, Peng B, Pan Y, Wang P, Sun K, Lei X, Ou L, Wu Z, Liu X, Wang H, Wang H, et al: Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling. Mol Med Rep 18: 3483-3489, 2018.
APA
Li, X., Peng, B., Pan, Y., Wang, P., Sun, K., Lei, X. ... Yang, L. (2018). Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling. Molecular Medicine Reports, 18, 3483-3489. https://doi.org/10.3892/mmr.2018.9325
MLA
Li, X., Peng, B., Pan, Y., Wang, P., Sun, K., Lei, X., Ou, L., Wu, Z., Liu, X., Wang, H., He, H., Mo, S., Tian, Y., Peng, X., Zhu, X., Zhang, R., Yang, L."Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling". Molecular Medicine Reports 18.3 (2018): 3483-3489.
Chicago
Li, X., Peng, B., Pan, Y., Wang, P., Sun, K., Lei, X., Ou, L., Wu, Z., Liu, X., Wang, H., He, H., Mo, S., Tian, Y., Peng, X., Zhu, X., Zhang, R., Yang, L."Icariin stimulates osteogenic differentiation and suppresses adipogenic differentiation of rBMSCs via estrogen receptor signaling". Molecular Medicine Reports 18, no. 3 (2018): 3483-3489. https://doi.org/10.3892/mmr.2018.9325
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team