Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
September-2019 Volume 20 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2019 Volume 20 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

The role of Zeb1 in the pathogenesis of morbidly adherent placenta

Retraction in: /10.3892/mmr.2025.13493
  • Authors:
    • Na Li
    • Tian Yang
    • Wenqian Yu
    • Hao Liu
    • Chong Qiao
    • Caixia Liu
  • View Affiliations / Copyright

    Affiliations: Department of Obstetrics and Gynecology, Shengjing Hospital of China Medical University, Shenyang, Liaoning 110004, P.R. China
    Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 2812-2822
    |
    Published online on: July 12, 2019
       https://doi.org/10.3892/mmr.2019.10490
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Zinc finger E‑box‑binding homeobox 1 (Zeb1) is a promoter of epithelial‑mesenchymal transformation, which may serve an important role in morbidly adherent placenta (MAP). In the present study, the protein expression levels of Zeb1 were examined in the placenta tissues of 60 patients, including 20 patients with placenta accreta (PA) and 20 patients with placenta previa without PA (UPA) and 20 patients in late pregnancy that delivered by cesarean section (normal). The expression levels of Zeb1, N‑cadherin, vascular endothelial growth factor (VEGF), Tumor necrosis factor‑related apoptosis‑inducing ligand‑receptor 2 (TRAIL‑R2), and tumor necrosis factor‑related apoptosis‑inducing ligand‑receptor 3 (TRAIL‑R3) were higher in PA tissues compared with in normal control tissues. The expression levels of E‑cadherin and TRAIL‑R2 were decreased in PA tissues compared with in normal control tissues. These findings indicated that Zeb1 may serve an important role in placental attachment, thus promoting the development of dangerous PA. Overexpression of Zeb1 may upregulate the expression levels of N‑cadherin, VEGF, TRAIL‑R3, cyclin D1 and Bcl‑2, and downregulate the expression levels of E‑cadherin and TRAIL‑R2. In addition, Zeb1 regulated the viability, apoptosis and migration of HTR‑8/SV neo cells and human umbilical vein endothelial cells by regulating the Akt pathway. In conclusion, these findings indicated that Zeb1 may promote placental implantation by activating the Akt signaling pathway, thus providing a theoretical basis for investigating the causes of MAP.

Introduction

Morbidly adherent placenta (MAP) refers to abnormal attachment of the placenta to the uterus. This includes abnormal placenta attachment depth, including placenta accreta (PA), but not placenta previa (PP), which is a condition caused by a low lying placenta (1). PA refers to a pathological condition where abnormal placental villi implant into the uterine wall, due to the partial or total absence of the decidual basal layer. Placental villi may not only invade the uterine muscular layer, but may also penetrate the uterine wall into the outer serosa layer, extending even to the bladder, making dissection of the placenta from the uterus impossible (2). A previous study reported that the incidence rate of PA has increased in the past 50 years (3). For patients with PA, dissection of the entire placenta during delivery is difficult, which may lead to intrapartum and postpartum hemorrhage. The average hemorrhage size is large, and it is the main cause of perinatal emergency hysterectomy (4). The maternal mortality rate associated with PA is a serious obstetric complication (5,6). It is necessary to identify key proteins and pathways affecting placental implantation for further prediction and treatment.

Zinc finger E-box-binding protein (ZEB) serves an important role in cell differentiation and embryonic development (7). It has been reported that ZEB is associated with biological processes, including tumor invasion and metastasis (8). Although embryo implantation into the endometrium is similar to the invasion mechanism of tumors, limited research has been conducted on ZEB in pernicious PP (9). Zeb1 is a nuclear transcription factor of zinc finger proteins. It can bind to the E2 box on the promoter region of the E-cadherin-coding gene, thus inhibiting E-cadherin transcription, inducing epithelial-mesenchymal transition (EMT), and enhancing cell invasion and metastasis; therefore, it may serve an important role in cell differentiation and embryonic development, which are important developmental processes (10,11). There is also the process of EMT during embryo implantation and development. Cell invasion of the endometrial layer is an important factor that determines the success of embryo implantation. Previous studies have reported that the expression of EMT markers, including Zeb1, Zeb2, Twist family BHLH transcription factor and Snail family transcriptional repressor 1 in the outer cell layer of trophoblasts is increased at 22 days gestation (12). Therefore, it may be speculated that Zeb1 is involved in regulation of trophoblastic invasion (13). However, to the best of our knowledge, research into human chorionic villi is limited.

The present study used immunohistochemical methods to detect the protein expression levels of Zeb1 in chorionic tissues from 60 patients, including 20 patients with pernicious PP and PA, 20 patients without PA (UPA) and 20 patients in late pregnancy that delivered by cesarean section, in order to examine the association between Zeb1 and PA, and to analyze the effects of Zeb1 on PA.

Materials and methods

Sample collection

The placental samples were obtained from patients at the Shengjing Hospital of China Medical University between January 2015 and January 2017 (Table I). Among the patients, 20 had pernicious PP with PA (PA group). The PA group consisted of patients with abnormal placental villi invading the myometrium of the uterus, according to the International Diagnostic Criteria of PA (14). Pathological diagnosis was determined by observation of placental villi having directly invaded the uterine myometrium on the excised uterine specimens. The average age of the PA group was 27.38±3.98 years. The UPA group comprised 20 patients without PA. The UPA group consisted of patients in which invasion of abnormal placental villi into the myometrium of the uterus was not observed, according to the International Diagnostic Criteria of PA. The average age of the UPA group was 28.12±2.56 years. Furthermore, 20 placental samples were obtained from patients in late pregnancy that delivered by cesarean section (normal group); their average age was 26.99±3.31.

Table I.

Patient characteristics.

Table I.

Patient characteristics.

CharacteristicPAUPANormal
Number202020
Age (mean ± standard deviation), years27.38±3.9828.12±2.5626.99±3.31
BMI, kg/m2 (mean ± standard deviation)22.56±4.2422.01±5.0121.47±3.31
History of cesarean section20 (100%)20 (100%)5 (25%)

[i] BMI, body mass index; PA, placenta accreta; UPA, placenta previa without PA.

The selection criteria were as follows: i) Patients had not entered labor; and ii) had not had a history of cesarean section. The exclusion criteria for the three groups were as follows: i) History of hypertension; ii) history of nephropathy and diabetes; iii) history of anemia or other blood diseases; iv) the current pregnancy was via vaginal delivery; v) fetal distress or intrauterine growth retardation; and vi) a history of blood transfusion and immunotherapy.

Tissue samples were obtained from patients undergoing surgery at Shengjing Hospital of China Medical University. Part of the excised tissue was fixed in 10% buffered formalin (4°C, overnight) and part of the sample was snap-frozen at −80°C for western blotting. Clinical samples were collected after written informed consent was obtained from patients, and the study was approved by the Ethics Committee at the Academic Medical Center of Shengjing Hospital of China Medical University.

Immunohistochemical evaluation

Tissue sections were immunohistochemically stained for Zeb1, vascular endothelial growth factor (VEGF) and E-cadherin. Samples were fixed in 10% buffered formalin (4°C, overnight). Serial 5 µm sections were cut using a microtome and affixed onto positively charged slides. Tissues were deparaffinized and rehydrated through graded xylene and in descending alcohol series. The paraffin sections were subsequently de-waxed in water and incubated with 3% H2O2 for 10 min at room temperature. The sections were incubated with 3% goat serum (cat. no. 16210064; Thermo Fisher Scientific, Inc.) at room temperature for 10 min. Immunohistochemistry (IHC) was conducted using rabbit primary antibodies against Zeb1 (1:800; sc-515797), VEGF (1:800; sc-53462) and E-cadherin (1:500; sc-71007) (Santa Cruz Biotechnology, Inc.) at 4°C overnight. An avidin-biotin-horseradish peroxidase complex immunodetection kit (D110073-0500; Shanghai Shenggong Biology Engineering Technology Services, Ltd.) was used to detect the reaction according to the manufacturer's instructions. Finally, the slides were dried, mounted with Canada balsam, covered and were examined using a light microscope (magnifications, ×100 and ×400). Staining intensity was scored on a scale of 0–4, as follows: 0, no staining; 1, weak staining in 5–25% of areas; 2, weak staining in 25–50% of areas; 3, moderate staining in 51–75% of areas and 4, strong staining in >75% of areas.

Cell culture

HTR-8/sv neo cells and human umbilical vein endothelial cells (HUVECs) were supplied by the China Center for Type Culture Collection. The cells were cultured in DMEM (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C in an atmosphere containing 5% CO2.

Transfection

To overexpress and silence Zeb1, 1×106 HTR-8/sv neo cells or HUVECs were plated into 6-well plates and transfected with 2 µg pcDNA3.1 vector encoding Zeb1 or with 5 µl Zeb1-targeted small interfering (si)RNA (si-Zeb1; 10 µmol/l; 5′-CCTCTCTGAAAGAACACATTA-3′; both Shanghai GeneChem Co., Ltd.) using HiGene transfection reagent (Beyotime Institute of Biotechnology), according to the manufacturer's instructions. The 2 µg pcDNA3.1 vector and 5 µl non-targeted siRNA (10 µmol/l; 5′-GCAGTTATCTGGAAGATCAGG-3′) were transfected into cells as respective controls (Shanghai GeneChem Co., Ltd.). Further experiments were carried out 24 h after transfection.

Cell viability assay

The MTT assay was employed to assess cell viability. HTR-8/sv neo cells and HUVECs were cultured in 96-well plates at a concentration of 1×104 cells/ml and were transfected with a Zeb1 vector or si-Zeb1 for 12, 24, 36 or 48 h. A total of 0.01 ml MTT solution (5 mg/ml) was added to each well. After 4 h of incubation at 37°C, the medium was replaced with 0.2 ml DMSO for 15 min. Subsequently, optical density was measured at a wavelength of 490 nm.

Cell cycle assay

In total, 1×106 HTR-8/sv neo cells or HUVECs were seeded into 6-well plates and transfected with a Zeb1 vector or si-Zeb1 for 24 h. Cells were fixed in 75% ethanol at 4°C overnight. Following staining using 10 µg/ml propidium iodide (PI) and 100 µl RNase A (100 µg/ml; Beyotime Institute of Biotechnology) for 20 min at room temperature, cell cycle progression was analyzed by flow cytometry within 1 h. The cell cycle was then analyzed using a flow cytometer (BD FACSCalibur; BD Biosciences) and FlowJo V10 (FlowJo, LLC).

Apoptosis assay

In total, 1×106 HTR-8/sv neo cells or HUVECs were seeded into 6-well plates and transfected with a Zeb1 vector or si-Zeb1 for 24 h. Cells were washed twice with cold PBS, and stained with 5 µl Annexin V-fluorescein isothiocyanate (FITC)/10 µl PI which were included in the Annexin V-FITC/PI apoptosis kit (Beyotime Institute of Biotechnology). Cells were incubated for 15 min at room temperature. Subsequently, 400 µl binding buffer (Beyotime Institute of Biotechnology) was added to each tube and the apoptosis rate was measured by flow cytometry within 1 h. Apoptosis was then detected using a flow cytometer and analyzed using FlowJo.

Transwell migration assay

In total, 1×105 HTR-8/sv neo cells or HUVECs in 200 µl DMEM were transfected with Zeb1 vector or si-Zeb1 for 24 h in 100 µl FBS-free DMEM. Cells were then placed in the upper chamber of a Transwell system, whereas the lower compartment was filled with 600 µl DMEM containing 10% FBS. After 8 h of incubation at 37°C, cells were fixed in 75% ethanol at 4°C overnight. The cells that had migrated to the lower surface of the filter were stained with 4% trypan blue (Beyotime Institute of Biotechnology) for 20 min at room temperature and counted under a light microscope (magnification, ×400).

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from HTR-8/sv neo cells, HUVECs or tissues using the RNA Isolation kit (Tiangen Biotech Co., Ltd.), according to the manufacturer's protocol, and samples were stored at −80°C until subsequent use. The RNA Reverse Transcription kit (Beyotime Institute of Biotechnology) was used for the RT of RNA into cDNA using the following conditions: 37°C for 15 min, and followed by 85°C for 5 sec. RT-qPCR was subsequently performed using a SYBR® Green Real-time PCR Master Mix (Toyobo Co., Ltd.). RT-qPCR was performed using MX3000P Real-time PCR instrument (Agilent Technologies, Inc.), according to the manufacturer's protocol, using the following conditions: 94°C for 5 min, and followed by 30 cycles of 94°C for 30 sec, 58–61°C for 30 sec. Primer sequences for detection of mRNA expression are shown in Table II. The relative gene expression levels were calculated using the 2−ΔΔCq method (15). All experiments were performed in triplicate.

Table II.

Primers used for reverse transcription-quantitative PCR.

Table II.

Primers used for reverse transcription-quantitative PCR.

NameForward primer (5′-3′)Reverse primer (5′-3′)
Zeb1 GCACAACCAAGTGCAGAAG CATTTGCAGATTGAGGCTG
E-cadherin GGGGTCTGTCATGGAAGGTG CGACGTTAGCCTCGTTCTCA
N-cadherin CGGCCCGCTATTTGTCATCA TGCGATTTCACCAGAAGCCT
VEGF GCAAAAACGAAAGCGCAAG GGAGGCTCCAGGGCATTAGA
TRAIL-R2 CCACAAAGAATCAGGCATCA CCAGGTCGTTGTGAGCTTCT
TRAIL-R3 GATCGTCCCATCCCCACATC CTGCTCTGACCAAGGCTGAA
Cyclin D1 CCGAGGAGCTGCTGCAAATG CGTGCGGGGTCATTGCGGC
Bcl-2 CTTTGAGTTCGGTGGGGTCA GAAATCAAACAGAGGCCGC
GAPDH GAAGGCTGGGGCTCATTTG AGGGGCCATCCACAGTCTTC

[i] All experiments were repeated at least in triplicate. mRNA expression levels were normalized to the internal reference gene GAPDH. Zeb1, zinc finger E-box-binding homeobox 1; VEGF, vascular endothelial growth factor; TRAIL-R, TNF receptor superfamily member.

Western blot analysis

Tissues, HTR-8/sv neo cells and HUVECs were lysed in lysis buffer [25 mM Tris (pH 7.6), 150 mM NaCl, 1% Nonidet P-40, 1 mM EDTA]. The cell lysates were collected by centrifugation at 12,000 × g for 10 min at 4°C. Total protein concentration was quantified using a bicinchoninic acid protein assay kit (Applygen Technologies, Inc.), and western blot analysis was performed. A total of 30 µg protein were separated by 10% SDS-PAGE and were transferred to a polyvinylidene difluoride membrane (Shanghai Shenggong Biology Engineering Technology Service, Ltd.). Following blocking with 3% BSA in TBS containing 0.1% Tween-20 for 3 h at room temperature, the membranes were incubated overnight at 4°C with primary antibodies. The following primary antibodies were used: Zeb1 (1:1,000; cat. no. sc-515797; Santa Cruz Biotechnology, Inc.), E-cadherin (1:1,000; cat. no. sc-71007; Santa Cruz Biotechnology, Inc.), N-cadherin (1:1,000; cat. no. sc-393933; Santa Cruz Biotechnology, Inc.), VEGF (1:1,000; cat. no. sc-53462; Santa Cruz Biotechnology, Inc.), TRAIL-R2 (1:800; cat. no. ab8416; Abcam), TRAIL-R3 (1:800; cat. no. ab2087; Abcam), Akt (1:1,000; cat. no. sc-135829; Santa Cruz Biotechnology, Inc.), phosphorylated AktSer473 (Aktp-Ser473; 1:1,000; cat. no. sc-293125; Santa Cruz Biotechnology, Inc.), phosphorylated AktTyr308 (Aktp-Tyr308; 1:1,000; cat. no. sc-135650; Santa Cruz Biotechnology, Inc.), cyclin D1 (1:1,000; cat. no. sc-4074; Santa Cruz Biotechnology, Inc.), Bcl-2 (1:1,000; cat. no. sc-23960; Santa Cruz Biotechnology, Inc.) and GAPDH (1:1,000; cat. no. sc-32233; Santa Cruz Biotechnology, Inc.) at 4°C overnight. After several washes, the membranes were incubated with an appropriate horseradish peroxidase-conjugated secondary antibody (goat anti-mouse; 1:5,000; sc-2031; goat anti-rabbit; 1:5,000; sc-2030; Santa Cruz Biotechnology, Inc.) for 1 h at room temperature. Proteins bands were visualized using enhanced chemiluminescence kits (GE Healthcare). After Akt/E-cadherin/TRAIL-R2 antibodies were detected, the membrane was stripped for 30 min at 55°C with a wash solution (50 mM Tris, 2% SDS, 100 mM 2-mercaptoethanol), washed three times with TBS-10% Tween-20, re-blocked and incubated with Aktp-Ser473/pAktp-Tyr308/N-cadherin/TRAIL-R3/GAPDH antibodies. All reactions were repeated at least in triplicate.

Cell treatment

The Akt activator insulin like growth factor 1 (IGF1; 0.1 µg; cat. no. ab9573; Abcam) (16–18) was added to HTR-8/sv neo cells for 24 h to active Akt. The Akt kinase inhibitor (cat. no. ab142088; Abcam; 0.5 µg) was added to HTR-8/sv neo cells for 24 h to inhibit Akt. After 24 h of treatment, western blot and RT-qPCR were carried out.

Statistical analysis

All reactions were repeated a minimum of three times. All data are presented as the mean ± standard deviation. Statistical analysis (two-tailed) of more than two groups was performed by one-way analysis of variance, followed by Tukey's post-hoc test for multiple comparisons. A Student's t-test was used to compare differences between two groups. Statistical analyses were conducted using GraphPad Prism 6 for Windows (version 6.05; GraphPad Software, Inc.) P<0.05 was considered to indicate a statistically significant difference.

Results

Zeb1 expression in placenta tissues

The expression of Zeb1 in placenta tissues was assessed by IHC (Fig. 1A). The results demonstrated that Zeb1 expression was highest in the PA group, and was higher in the UPA group compared with in the normal group. In addition, IHC revealed that VEGF expression was higher, whereas E-cadherin expression was lower in the PA group compared with in the normal group (Fig. 1B and C). Western blot analysis and RT-qPCR demonstrated that the expression levels of Zeb1, N-cadherin, VEGF and TRAIL-R3 (P<0.05) were higher in the PA group compared with in the control group, whereas E-cadherin and TRAIL-R2 expression were lower (P<0.05; Fig. 1D and E)

Figure 1.

Zeb1 expression in placenta tissues. Immunohistochemical staining for the expression of (A) Zeb1 and (B) VEGF in placenta tissues (magnification, ×100 and ×400). **P<0.05 vs. PA tissues. E-cad, E-cadherin; N-cad, N-cadherin; PA, placenta accrete; TRAIL-R, TNF receptor superfamily member; UPA, placenta previa without PA; VEGF, vascular endothelial growth factor; Zeb1, zinc finger E-box-binding homeobox 1. Zeb1 expression in placenta tissues. Immunohistochemical staining for the expression of (C) E-cad in placenta tissues (magnification, ×100 and ×400). **P<0.05 vs. PA tissues. (D and E) Expression of Zeb1, E-cad, N-cad, VEGF, TRAIL-R2 and TRAIL-R3 in placenta tissues was detected by western blot analysis and reverse transcription-quantitative PCR **P<0.05 vs. PA tissues; ##P<0.05 vs. UPA tissues. E-cad, E-cadherin; N-cad, N-cadherin; PA, placenta accrete; TRAIL-R, TNF receptor superfamily member; UPA, placenta previa without PA; VEGF, vascular endothelial growth factor; Zeb1, zinc finger E-box-binding homeobox 1.

Si-Zeb1 inhibits the viability and migration of HTR-8/sv neo cells

The MTT assay revealed that Zeb1-silencing [depletion was confirmed using western blotting and RT-qPCR (Fig. 2E and F)] inhibited the viability of HTR-8/sv neo cells (P<0.05; Fig. 2A). Flow cytometry was used to evaluate cell cycle progression of HTR-8/sv neo cells previously exposed to si-Zeb1 for 24 h. si-Zeb1 induced a decrease in the percentage of cells in S phase, and increased the number of cells in G1 phase, compared with in the control group (P<0.05; Fig. 2B). In order to assess whether Zeb1 can inhibit apoptosis, flow cytometry was used to assess HTR-8/sv neo cells. The results demonstrated there was an increase in si-Zeb1-transfected apoptotic cells (P<0.05; Fig. 2C). The effects of Zeb1 on HTR-8/sv neo cell migration were assessed using Transwell assays. The results showed that si-Zeb1 significantly inhibited migration of HTR-8/sv neo cells (P<0.05; Fig. 2D). Western blot analysis and RT-qPCR revealed that transfection with si-Zeb1 for 24 h decreased the expression levels of N-cadherin, VEGF, TRAIL-R3, cyclin D1 and Bcl-2 (P<0.05), and promoted the expression levels of E-cadherin and TRAIL-R2 in HTR-8/sv neo cells (P<0.05; Fig. 2E and F).

Figure 2.

si-Zeb1 inhibits the growth and migration of HTR-8/sv neo cells. (A) Viability of HTR-8/sv neo cells transfected with scrambled siRNA or si-Zeb1 was assessed at different time points. (B) Flow cytometric analysis of cell cycle progression of HTR-8/sv neo cells transfected with scrambled siRNA or si-Zeb1 for 24 h. (C) Flow cytometric analysis of apoptosis of HTR-8/sv neo cells transfected with scrambled siRNA or si-Zeb1 for 24 h. The Q3 region contains early apoptotic cells; these data were used for statistical analysis. (D) Migration of HTR-8/sv neo cells transfected with scrambled siRNA or si-Zeb1 for 24 h (magnification, ×400). (E and F) Expression levels of Zeb1, E-cad, N-cad, VEGF, TRAIL-R2, TRAIL-R3, cyclin D1 and Bcl-2, as detected by western blot analysis and reverse transcription-quantitative PCR, in HTR-8/sv neo cells transfected with scrambled siRNA or si-Zeb1 for 24 h. All experiments were repeated in triplicate **P<0.05 compared with scrambled control. E-cad, E-cadherin; N-cad, N-cadherin; OD, optical density; si/siRNA, small interfering RNA; TRAIL-R, TNF receptor superfamily member; VEGF, vascular endothelial growth factor; Zeb1, zinc finger E-box-binding homeobox 1.

HUVEC viability and migration are inhibited by si-Zeb1

The results demonstrated that si-Zeb1 [depletion was confirmed using western blotting and RT-qPCR (Fig. 3E and F)] inhibited the viability of HUVECs by inhibiting G1/S transformation and promoting apoptosis (P<0.05; Fig. 3A-C). The results of a Transwell assay revealed that si-Zeb1 could significantly inhibit the migration of HUVECs (Fig. 3D). Western blot analysis and RT-qPCR showed that si-Zeb1 could inhibit the expression of N-cadherin, VEGF, TRAIL-R3, cyclin D1 and Bcl-2 (P<0.05), and promote the expression of E-cadherin and TRAIL-R2 in HUVECs (P<0.05; Fig. 3E and F).

Figure 3.

HUVEC viability and migration are inhibited by si-Zeb1. (A) Results of MTT viability assays in HUVECs transfected with scrambled siRNA or si-Zeb1 at different time points. (B) Flow cytometric analysis of cell cycle progression of HUVECs transfected with scrambled siRNA or si-Zeb1 for 24 h. (C) Flow cytometric analysis of apoptosis of HUVECs transfected with scrambled siRNA or si-Zeb1 for 24 h. The Q3 region contains early apoptotic cells; these data were used for statistical analysis. (D) Migration of HUVECs transfected with scrambled siRNA or si-Zeb1 for 24 h (magnification, ×400). (E and F) Expression of Zeb1, E-cad, N-cad, VEGF, TRAIL-R2, TRAIL-R3, cyclin D1 and Bcl-2, as detected by western blot analysis and reverse transcription-quantitative PCR, in HUVECs transfected with scrambled siRNA or si-Zeb1 for 24 h. All experiments were repeated in triplicate **P<0.05 compared with scrambled control. E-cad, E-cadherin; HUVECs, human umbilical vein endothelial cells; N-cad, N-cadherin; OD, optical density; si/siRNA, small interfering RNA; TRAIL-R, TNF receptor superfamily member; VEGF, vascular endothelial growth factor; Zeb1, zinc finger E-box-binding homeobox 1.

Zeb1 promotes cell growth and migration through the Akt pathway

Since Zeb1 is involved in regulation of the Akt pathway (19), this study examined whether the role of Zeb1 in PA was partly mediated by the Akt pathway. To achieve this, si-Zeb1 cells were treated with an Akt activator and Zeb1 overexpressing cells were treated with an Akt inhibitor. Western blot analysis and RT-qPCR revealed that IGF1 reversed the effects of si-Zeb1 on Aktp-Ser473, Aktp-Tyr308, N-cadherin, VEGF, TRAIL-R3, cyclin D1, Bcl-2, E-cadherin and TRAIL-R2 in HTR-8/sv neo cells (P<0.05; Fig. 4A-D). Similar results were observed in HUVECs, as determined by western blotting and RT-qPCR (P<0.05; Fig. 5A-D).

Figure 4.

Zeb1 promotes cell growth and migration through the Akt pathway. (A and B) Western blotting and reverse transcription-quantitative PCR analysis of Zeb1, E-cad, N-cad, VEGF, TRAIL-R2, TRAIL-R3, Akt, Aktp-Ser473, Aktp-Tyr308, cyclin D1 and Bcl-2 expression in HTR-8/sv neo cells in the si-Zeb1, si-Zeb1 + IGF1 or scrambled groups. **P<0.05 compared with scrambled group; ##P<0.05 compared with si-Zeb1 group. (C and D) Western blotting and reverse transcription-quantitative PCR analysis of Zeb1, E-cad, N-cad, VEGF, TRAIL-R2, TRAIL-R3, Akt, Aktp-Ser473, Aktp-Tyr308, cyclin D1 and Bcl-2 expression in HTR-8/sv neo cells in the Zeb1, Zeb1 + Akt kinase inhibitor and vector groups **P<0.05 compared with vector group; ##P<0.05 compared with Zeb1 group. Aktp-Ser473, phosphorylated AktSer473; Aktp-Tyr308, phosphorylated AktTyr308; E-cad, E-cadherin; IGF1, insulin like growth factor 1; N-cad, N-cadherin; si, small interfering; TRAIL-R, TNF receptor superfamily member; VEGF, vascular endothelial growth factor; Zeb1, zinc finger E-box-binding homeobox 1.

Figure 5.

Zeb1 promotes cell growth and migration through the Akt pathway. (A and B) Western blotting and reverse transcription-quantitative PCR analysis of Zeb1, E-cad, N-cad, VEGF, TRAIL-R2, TRAIL-R3, Akt, Aktp-Ser473, Aktp-Tyr308, cyclin D1 and Bcl-2 expression in HUVECs in the si-Zeb1, si-Zeb1 + IGF1 or scrambled groups. **P<0.05 compared with scrambled group; ##P<0.05 compared with si-Zeb1 group. (C and D) Western blotting and reverse transcription-quantitative PCR analysis of, E-cad, N-cad, VEGF, TRAIL-R2, TRAIL-R3, Akt, Aktp-Ser473, Aktp-Tyr308, cyclin D1 and Bcl-2 expression in HUVECs in the Zeb1, Zeb1 + Akt kinase inhibitor or vector groups **P<0.05 compared with vector group; ##P<0.05, compared with Zeb1 group. Aktp-Ser473, phosphorylated AktSer473; Aktp−Tyr308, phosphorylated AktTyr308; E-cad, E-cadherin; HUVECs, human umbilical vein endothelial cells; IGF1, insulin like growth factor 1; N-cad, N-cadherin; si, small interfering; TRAIL-R, TNF receptor superfamily member; VEGF, vascular endothelial growth factor; Zeb1, zinc finger E-box-binding homeobox 1.

Discussion

PA is a complex process, the underlying mechanism of which remains unclear. The balance between normal placental villus infiltration and decidual tissue reaction is the basis for a normal pregnancy and a smooth delivery (1). It has been suggested that decidual defects, excessive invasion of trophoblasts and abnormal neovascularization of the uterus and placenta can lead to PA (20). When PA occurs, placental villi adhere tightly to the basal plate of the decidua basalis and invade the myometrium of the uterus, indicating that the migratory and invasive ability of trophoblasts outside villi is enhanced (1,21). In the present study, it was demonstrated that the expression of Zeb1 was significantly higher in PA tissues compared with in the control and UPA groups. Zeb1 can promote the proliferation and migration of trophoblasts and umbilical vein endothelial cells (22). Therefore, it may be concluded that Zeb1 serves an important role in PA.

PA is a process of tissue migration, in which EMT and mesenchymal-epithelial transition (MET) serve important roles, and the migratory ability of cells is greatly improved (23). Zeb1 may serve an important role in placental implantation as a regulator of EMT. The process of EMT involves several changes in protein expression (24). It has previously been reported that Zeb1 can regulate E-cadherin gene expression to participate in the regulation of EMT (7). When PA occurs, the invasive ability of trophoblasts is increased and the MET process cannot be completed, which is manifested by an increase in the number and volume of invasive trophoblasts during PA (9). In the present study, the expression levels of Zeb1 and E-cad were detected in the three patient groups: PA, UPA and normal. The results revealed that the expression levels of Zeb1 were significantly upregulated, whereas the expression levels of E-cadherin were downregulated in the PA group. These results are consistent with previous studies (25,26), which reported that Zeb1 and E-cadherin can participate in the occurrence and development of placental implantation.

It has been suggested Zeb1 can induce angiogenesis and promote the expression of VEGF, thereby promoting angiogenesis (27). VEGF is involved in the occurrence of preeclampsia. PA is also associated with vascular abnormalities, and the process of PA can be regulated by Zeb1 (28). In this study, it was indicated that the expression levels of Zeb1 and VEGF were significantly upregulated in the PA group, thus indicating that Zeb1 and VEGF may promote PA.

The Akt signaling pathway serves an important role in embryogenesis (29). Overactivation of the Akt signaling pathway has been shown to be associated with macrosomia and embryonic development (30). In addition, overactivation of the Akt signaling pathway can induce cell overproliferation and enhance migratory abilities, which has been widely demonstrated in various cells (31). EMT is the basic process of embryonic development, tissue remodeling and wound healing (30). In recent years, EMT has gained increasing attention in cancer progression, invasiveness and metastasis (31). Through the EMT process, cells may acquire an invasive phenotype, which may contribute to tissue invasion (32). Zeb1 has been reported to activate a variety of downstream pathways, including PI3K, Smads and MAPK, which are involved in Zeb1-induced EMT (33). In this study, the expression of Zeb1, Akt, Aktp-Ser473, Aktp-Tyr308, E-cadherin, N-cadherin, VEGF, TRAIL-R2, TRAIL-R3, cyclin D1 and Bcl-2 were detected following the addition of the Akt activator IGF1 to Zeb1-silenced cells. The results indicated that Zeb1 silencing could decrease the phosphorylation levels of Akt without affecting the total protein levels of Akt, whereas IGF1 could counteract the change in protein expression induced by Zeb1 silencing. In addition, treatment with an Akt kinase inhibitor weakened the effects of Zeb1 overexpression on protein production to some extent. These findings suggested that the regulatory effect of Zeb1 on cellular biological function may be achieved through the Akt signaling pathway to some extent.

In the present study, the sample size was limited, and other possible signaling pathways that Zeb1 may regulate were not screened; therefore, further examination is required. In addition, there are further limitations to this study. Notably, SC79, which is more specific than IGF-1, was not used as an Akt activator. Therefore, in future studies, a more specific activator of Akt should be used. Furthermore, IGF-1 can produce off-target effects that do not involve Akt. Further analysis should be conducted in a follow-up study.

In conclusion, this study demonstrated that Zeb1 may promote placental implantation by activating the Akt signaling pathway. The present findings support the potential of Zeb1 as a novel diagnostic and treatment target for PA.

Acknowledgements

Not applicable.

Funding

This work was supported by the National Key Research and Development Program of Reproductive Health & Major Birth Defects Control and Prevention (grant no. 2016YFC1000404 to Chong Qiao) and he Science and Technology Project of Liaoning Provincial Education Department (grant no. LS201611 for Na Li).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

NL, TY, HL and WY performed the majority of the experiments, and contributed to the writing of the manuscript. CQ and CL designed the study and wrote the manuscript.

Ethics approval and consent to participate

For the use of clinical materials for research purposes, written consent and approval from patients were obtained from the Shengjing Hospital of China Medical University. Patient consent was obtained in writing according to institutional regulations. Research involving human subjects, human material, or human data was performed in accordance with the Declaration of Helsinki and this study was approved by the Ethics Committee at the Academic Medical Center of Shengjing Hospital of China Medical University.

Patient consent to publication

Consent to publish was obtained from the participants.

Competing interests

The authors declare that they have no competing interests.

References

1 

Roziana R, Kamarul Azhar K, Lau JH, Aina MAA, Nadia R, Siti Nordiana A and Mohd Zulkifli K: Morbidly adherent placenta: One-year case series in a tertiary hospital. Med J Malaysia. 74:128–132. 2019.PubMed/NCBI

2 

Balachandar K and Inglis E: The management of severe pre-eclampsia and HELLP syndrome in a twin pregnancy with a known morbidly adherent placenta: A case report. Case Rep Womens Health. 22:e001142019. View Article : Google Scholar : PubMed/NCBI

3 

Bamber JH and Sobers S: The Need to Consider the Women's Perspective: Neuraxial anesthesia and cesarean delivery for morbidly adherent placenta. Anesth Analg. 128:e56–e57. 2019. View Article : Google Scholar : PubMed/NCBI

4 

Lopes ES, Feitosa FEL, Brazil AV, de Castro JDV, da Costa JIF, Araujo Júnior E, Peixoto AB and Carvalho FHC: Assessment of sensitivity and specificity of ultrasound and magnetic resonance imaging in the diagnosis of placenta accreta. Rev Bras Ginecol Obstet. 41:17–23. 2019. View Article : Google Scholar : PubMed/NCBI

5 

Furukawa S, Fujisaki M, Maki Y, Oohashi M, Doi K and Sameshima H: Manual removal of placenta in women having unpredictable adherent placenta. J Obstet Gynaecol Res. 45:141–147. 2019. View Article : Google Scholar : PubMed/NCBI

6 

Katzman PJ, Blitman J and Metlay LA: Basal chronic villitis and disorders of the placental basal plate: A possible immunological link between hypertensive disorders of pregnancy and morbidly adherent placenta. Pediatr Dev Pathol. Jan 21–2019.(Epub ahead of print). doi: 10.1177/1093526619825708. View Article : Google Scholar

7 

Wang Y, Wu Z and Hu L: The regulatory effects of metformin on the [SNAIL/miR-34]:[ZEB/miR-200] system in the epithelial-mesenchymal transition(EMT) for colorectal cancer (CRC). Eur J Pharmacol. 834:45–53. 2018. View Article : Google Scholar : PubMed/NCBI

8 

Egger JV, Lane MV, Antonucci LA, Dedi B and Krucher NA: Dephosphorylation of the retinoblastoma protein (Rb) inhibits cancer cell EMT via Zeb. Cancer Biol Ther. 17:1197–1205. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Mooney SM, Talebian V, Jolly MK, Jia D, Gromala M, Levine H and McConkey BJ: The GRHL2/ZEB Feedback Loop-A Key Axis in the regulation of EMT in breast cancer. J Cell Biochem. 118:2559–2570. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Noman MZ, Janji B, Abdou A, Hasmim M, Terry S, Tan TZ, Mami-Chouaib F, Thiery JP and Chouaib S: The immune checkpoint ligand PD-L1 is upregulated in EMT-activated human breast cancer cells by a mechanism involving ZEB-1 and miR-200. Oncoimmunology. 6:e12634122017. View Article : Google Scholar : PubMed/NCBI

11 

Ohashi S, Natsuizaka M, Naganuma S, Kagawa S, Kimura S, Itoh H, Kalman RA, Nakagawa M, Darling DS, Basu D, et al: A NOTCH3-mediated squamous cell differentiation program limits expansion of EMT-competent cells that express the ZEB transcription factors. Cancer Res. 71:6836–6847. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Rhodes LV, Tate CR, Segar HC, Burks HE, Phamduy TB, Hoang V, Elliott S, Gilliam D, Pounder FN, Anbalagan M, et al: Suppression of triple-negative breast cancer metastasis by pan-DAC inhibitor panobinostat via inhibition of ZEB family of EMT master regulators. Breast Cancer Res Treat. 145:593–604. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Shu H, Chen H, Yang B, Chang Z, Xiong M and Chen W: Aberrant expression of E-cadherin and integrin β-1 in trophoblasts is associated with malignant gestational trophoblastic diseases. Int J Gynecol Cancer. 23:749–754. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Al-Khan A, Bulmer JN, Chantraine F, Chen CP, Chen Q, Collins S, Cotechini T, Fitzgerald JS, He M, Holland O, et al: IFPA Meeting 2012 Workshop Report III: Trophoblast deportation, gestational trophoblastic disease, placental insufficiency and fetal growth restriction, trophoblast over-invasion and accreta-related pathologies, placental thrombosis and fibrinolysis. Placenta. 34 (Suppl):S11–S16. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Wang Y, Jia L, Wang B, Diao S, Jia R and Shang J: MiR-495/IGF-1/AKT Signaling as a novel axis is involved in the Epithelial-to-Mesenchymal transition of oral squamous cell carcinoma. J Oral Maxillofac Surg. 77:1009–1021. 2019. View Article : Google Scholar : PubMed/NCBI

17 

Hu T, Lu MN, Chen B, Tong J, Mao R, Li SS, Dai P, Tan YX and Xiyang YB: Electro-acupuncture-induced neuroprotection is associated with activation of the IGF-1/PI3K/Akt pathway following adjacent dorsal root ganglionectomies in rats. Int J Mol Med. 43:807–820. 2019.PubMed/NCBI

18 

Kuang WH, Dong ZQ, Tian LT and Li J: IGF-1 defends against chronic-stress induced depression in rat models of chronic unpredictable mild stress through the PI3K/Akt/FoxO3a pathway. Kaohsiung J Med Sci. 34:370–376. 2018. View Article : Google Scholar : PubMed/NCBI

19 

Zhang Q, Zhou L, Guan Y, Cheng Y and Han X: BENC-511, a novel PI3K inhibitor, suppresses metastasis of non-small cell lung cancer cells by modulating β-catenin/ZEB1 regulatory loop. Chem Biol Interact. 294:18–27. 2018. View Article : Google Scholar : PubMed/NCBI

20 

Matsubara S: Balloon uterine tamponade device after peripartum hysterectomy for morbidly adherent placenta. Obstet Gynecol. 133:1882019. View Article : Google Scholar : PubMed/NCBI

21 

Shmakov RG, Vinitskiy AA, Chuprinin VD, Yarotskaya EL and Sukhikh GT: Alternative approaches to surgical hemostasis in patients with morbidly adherent placenta undergoing fertility-sparing surgery. J Matern Fetal Neonatal Med. 32:2042–2048. 2019. View Article : Google Scholar : PubMed/NCBI

22 

Shin JO, Nakagawa E, Kim EJ, Cho KW, Lee JM, Cho SW and Jung HS: miR-200b regulates cell migration via Zeb family during mouse palate development. Histochem Cell Biol. 137:459–470. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Kokkinos MI, Murthi P, Wafai R, Thompson EW and Newgreen DF: Cadherins in the human placenta-epithelial-mesenchymal transition (EMT) and placental development. Placenta. 31:747–755. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Bottalico B, Larsson I, Brodszki J, Hernandez-Andrade E, Casslén B, Marsál K and Hansson SR: Norepinephrine transporter (NET), serotonin transporter (SERT), vesicular monoamine transporter (VMAT2) and organic cation transporters (OCT1, 2 and EMT) in human placenta from pre-eclamptic and normotensive pregnancies. Placenta. 25:518–529. 2004. View Article : Google Scholar : PubMed/NCBI

25 

Duzyj CM, Buhimschi IA, Motawea H, Laky CA, Cozzini G, Zhao G, Funai EF and Buhimschi CS: The invasive phenotype of placenta accreta extravillous trophoblasts associates with loss of E-cadherin. Placenta. 36:645–651. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Incebiyik A, Kocarslan S, Camuzcuoglu A, Hilali NG, Incebiyik H and Camuzcuoglu H: Trophoblastic E-cadherin and TGF-beta expression in placenta percreta and normal pregnancies. J Matern Fetal Neonatal Med. 29:126–129. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Guimaraes GC, Alves LA, Betarelli RP, Guimarães CSO, Helmo FR, Pereira Júnior CD, Corrêa RRM and Zangeronimo MG: Expression of vascular endothelial growth factor (VEGF) and factor VIII in the gilt placenta and its relation to fetal development. Theriogenology. 92:63–68. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Klettner A, Kaya L, Flach J, Lassen J, Treumer F and Roider J: Basal and apical regulation of VEGF-A and placenta growth factor in the RPE/choroid and primary RPE. Mol Vis. 21:736–748. 2015.PubMed/NCBI

29 

Mathew S, Sundararaj S, Mamiya H and Banerjee I: Regulatory interactions maintaining self-renewal of human embryonic stem cells as revealed through a systems analysis of PI3K/AKT pathway. Bioinformatics. 30:2334–2342. 2014. View Article : Google Scholar : PubMed/NCBI

30 

Lv WM, Zhao Y, Yang G, Dong SY, Zhang GH, Zhang Y, Li GZ and Cheng Y: Role of Ras, ERK, and Akt in glucocorticoid-induced differentiation of embryonic rat somatotropes in vitro. Mol Cell Biochem. 391:67–75. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Godoy-Parejo C, Deng C, Liu W and Chen G: Insulin stimulates PI3K/AKT and cell adhesion to promote the survival of individualized human embryonic stem cells. Stem Cells. Apr 25–2019.(Epub ahead of print). doi: 10.1002/stem.3026. View Article : Google Scholar : PubMed/NCBI

32 

Park JH and Han HJ: Caveolin-1 plays important role in EGF-induced migration and proliferation of mouse embryonic stem cells: Involvement of PI3K/Akt and ERK. Am J Physiol Cell Physiol. 297:C935–C944. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Tan Y, Xin X, Coffey FJ, Wiest DL, Dong LQ and Testa JR: Appl1 and Appl2 are expendable for mouse development but are essential for HGF-Induced akt activation and migration in mouse embryonic fibroblasts. J Cell Physiol. 231:1142–1150. 2016. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li N, Yang T, Yu W, Liu H, Qiao C and Liu C: The role of Zeb1 in the pathogenesis of morbidly adherent placenta Retraction in /10.3892/mmr.2025.13493. Mol Med Rep 20: 2812-2822, 2019.
APA
Li, N., Yang, T., Yu, W., Liu, H., Qiao, C., & Liu, C. (2019). The role of Zeb1 in the pathogenesis of morbidly adherent placenta Retraction in /10.3892/mmr.2025.13493. Molecular Medicine Reports, 20, 2812-2822. https://doi.org/10.3892/mmr.2019.10490
MLA
Li, N., Yang, T., Yu, W., Liu, H., Qiao, C., Liu, C."The role of Zeb1 in the pathogenesis of morbidly adherent placenta Retraction in /10.3892/mmr.2025.13493". Molecular Medicine Reports 20.3 (2019): 2812-2822.
Chicago
Li, N., Yang, T., Yu, W., Liu, H., Qiao, C., Liu, C."The role of Zeb1 in the pathogenesis of morbidly adherent placenta Retraction in /10.3892/mmr.2025.13493". Molecular Medicine Reports 20, no. 3 (2019): 2812-2822. https://doi.org/10.3892/mmr.2019.10490
Copy and paste a formatted citation
x
Spandidos Publications style
Li N, Yang T, Yu W, Liu H, Qiao C and Liu C: The role of Zeb1 in the pathogenesis of morbidly adherent placenta Retraction in /10.3892/mmr.2025.13493. Mol Med Rep 20: 2812-2822, 2019.
APA
Li, N., Yang, T., Yu, W., Liu, H., Qiao, C., & Liu, C. (2019). The role of Zeb1 in the pathogenesis of morbidly adherent placenta Retraction in /10.3892/mmr.2025.13493. Molecular Medicine Reports, 20, 2812-2822. https://doi.org/10.3892/mmr.2019.10490
MLA
Li, N., Yang, T., Yu, W., Liu, H., Qiao, C., Liu, C."The role of Zeb1 in the pathogenesis of morbidly adherent placenta Retraction in /10.3892/mmr.2025.13493". Molecular Medicine Reports 20.3 (2019): 2812-2822.
Chicago
Li, N., Yang, T., Yu, W., Liu, H., Qiao, C., Liu, C."The role of Zeb1 in the pathogenesis of morbidly adherent placenta Retraction in /10.3892/mmr.2025.13493". Molecular Medicine Reports 20, no. 3 (2019): 2812-2822. https://doi.org/10.3892/mmr.2019.10490
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team