Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April 2013 Volume 7 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April 2013 Volume 7 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

IL-22 exacerbates the severity of CVB3-induced acute viral myocarditis in IL-17A-deficient mice

  • Authors:
    • Qing Kong
    • Yimin Xue
    • Weifeng Wu
    • Fan Yang
    • Yanli Liu
    • Mengsha Gao
    • Wenyin Lai
    • Xiaofen Pan
  • View Affiliations / Copyright

    Affiliations: Department of Cardiology, the First Affiliated Hospital of Guangxi Medical University, Guangxi Cardiovascular Institute, Nanning, Guangxi 530021, P.R. China
  • Pages: 1329-1335
    |
    Published online on: February 18, 2013
       https://doi.org/10.3892/mmr.2013.1323
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Interleukin (IL)-22 has either proinflammatory or tissue‑protective properties, depending on the nature of the affected tissue and the local cytokine milieu, including the presence or absence of IL-17A co-expression. We have previously demonstrated that IL-22 has critical anti-inflammatory and antiviral roles in mice with coxsackievirus B3 (CVB3)‑induced acute viral myocarditis (AVMC) in the presence of IL-17A. However, whether IL-17A determines the function of IL-22 in AVMC remains unknown. Therefore, the present study, in continuation of our previous investigations, aimed to determine whether IL-22 plays a distinctly different role in the absence of IL-17A in AVMC by using IL-17A-deficient mice. Results demonstrated that the neutralization of IL-22 in IL-17A‑deficient mice alleviated the severity of myocarditis. This was demonstrated by the lower pathological scores of heart sections and ratios of heart weight/body weight (HW/BW), reduced production of activator of transcription 3 (STAT3) and proinflammatory cytokines TNF-α and IL-6, followed by increased viral replication and decreased levels of the antiviral cytokine IFN-γ. Furthermore, the correlation between cardiac CVB3 RNA and IL-22 mRNA or IFN-γ mRNA was negative. In conclusion, IL-22 exacerbated the severity of AVMC and restrained viral replication in the absence of IL-17A. Spleen lymphocytes cultured with recombinant IL-17 (rIL-17) increased the production of IL-22. Combined with our previous data, these results indicate that IL-17A is not involved in regulating the antiviral role, however, may mediate the tissue-protective versus pathogenic properties of IL-22 in CVB3-induced AVMC in mice.

Introduction

Acute viral myocarditis (AVMC) is characterized by virus-triggered myocardial inflammation, followed by an autoimmune response, and leads to a significant minority of dilated cardiomyopathy (DCM) cases (1). Myocarditis causes 4–20% of sudden cardiovascular-associated deaths among young adults, the military and athletes (2).Viral infections, including coxsackievirus B3 (CVB3), are the most commonly identified cause of myocarditis in developed countries and are able to induce myocarditis and DCM in animal models (2,3). An excessively activated immune response triggered by the virus was considered to be the dominant cause of myocyte injury in AVMC, particularly T-cell activation and the secretion of numerous proinflammatory/protective cytokines. Cytokine-based therapy has been considered an important strategy in the treatment of AVMC (4–6). Recently, identification of the interleukin (IL)-23/Th17 axis in the pathophysiology of AVMC has shifted the cytokine paradigm from Th1 to Th17 cytokines and is mainly focused on IL-17A (5,6).

IL-17A, a cytokine predominantly produced by Th17 cells, was identified as important in the pathogenesis of AVMC. The critical proinflammatory role of this cytokine and its contribution to CVB3 replication in AVMC is well documented (5,6). IL-22, a member of the IL-10 family of cytokines, has received increasing amounts of attention and is currently widely investigated. IL-22 is an important cytokine, derived from multiple cells of the innate and adaptive immune system, including but not limited to Th22, Th1 and Th17 and CD8+T, γδT and NK cells (7,8). IL-22 stimulation of IL-22 receptor-expressing cells results in the activation of its downstream signals, including signal transducers and activator of transcription 3 (STAT3) signaling pathways, namely the IL-22/STAT3 pathway (8–10). A large number of murine and human studies have demonstrated that IL-22 provides a unique contribution to tissue inflammation, immune responses and viral infection and has proinflammatory and tissue-protective properties, depending on the context in which it is expressed (8,11–13). In different stages of disease development, IL-22 has shown opposing short- and long-term effects (14,15). The biological activities of IL-22 are complex and this has caused it to be described as ‘a sheep in wolf’s clothing’ (16). Furthermore, IL-22 is involved in IL-17-mediated diseases and the signaling pathways of these two cytokines may synergize to induce the expression of anti-inflammatory factors (8–16). More specifically, the proinflammatory properties and tissue-protective functions of IL-22 were regulated by IL-17A in airway damage and inflammation (17). These data indicate that the differential temporal and spatial co-expression of IL-17A and IL-22 may underlie the conflicting results for the biological effects of IL-22 in distinct disease models. This may offer selective therapeutic potential in the treatment of IL-17A and IL-22-associated inflammatory diseases.

IL-22 has been considered an ideal therapeutic candidate since it specifically affects tissue responses without having direct effects on the immune response (8). Our previous study conducted on wild-type (WT) mice demonstrated the existence of a specific pattern of IL-22 cytokines in CVB3-induced AVMC (18). Furthermore, neutralization of IL-22 in vivo exacerbated the severity of AVMC and promoted cardiac viral replication, which highlights the anti-inflammatory and antiviral roles of IL-22 in the pathogenesis of myocarditis in the presence of IL-17A. However, whether IL-17A contributes to the tissue-protective role of IL-22 in the development of AVMC remains to be elucidated. The present study, in continuation of our previous investigations, aimed to determine whether IL-22 plays a distinctly different role in the absence of IL-17A in AVMC by using IL-17A-deficient mice (IL-17A−/−).

Materials and methods

Mice

Specific pathogen-free male IL-17A-deficient mice on the BALB/c background (designated in the present study as IL-17A−/−), aged 6 weeks, were provided by Dr Yoichiro Iwakura (Center for Experimental Medicine and Systems Biology, the Institute of Medical Science, the University of Tokyo, Tokyo, Japan) (19). All animals were kept in a pathogen-free mouse room in the Experimental Animal Center (Guangxi Medical University, Nanning, China). Experiments were carried out in accordance with protocols approved by the Guangxi Medical University Animal Ethics Committee.

Virus

CVB3 (Nancy strain from the Institute of Immunology of Guangxi Medical University) was maintained by passage through HEp-2 cells. A plaque-forming unit (PFU) assay was used to determine that the virus titer was 1×108. CVB3 was diluted in PBS (Solarbio Science & Technology Co., Ltd., Beijing, China). BALB/c mice were infected by an intraperitoneal injection (i.p.) of 100 μl PBS containing ~106 PFU CVB3 to establish the AVMC models.

Neutralization of IL-22 in IL-17A−/− mice

For in vivo IL-22 neutralization, a total of 32 IL-17A−/− mice were randomly divided into four groups: Mice in the AVMC group were injected with CVB3 and PBS (50 μg per mouse, n=8); in the anti-IL-22 Ab group, mice were administered with CVB3 and anti-IL-22 Ab (AF582; 50 μg per mouse; R&D Systems, Inc., Minneapolis, MN, USA; n=8); IgG control group, mice were injected with CVB3 and normal IgG control (AB-108-C; 50 μg per mouse; R&D Systems; n=8); and in the normal group, IL-17A−/− mice received no treatments (n=8). The day of intraperitoneal injection was defined as day 0. All surviving animals were sacrificed on day 14 after CVB3 infection. The ratios for heart weight/body weight (HW/BW) were recorded. Blood was collected and the serum was prepared for analysis. Hearts and spleens were removed aseptically as fresh specimens for analysis.

Histopathology

The ventricular tissues of the hearts were fixed in 10% formalin and embedded in paraffin. After the entire length of the heart was sectioned (5 μm) and stained with hematoxylin and eosin (H&E), histopathological changes were observed using light microscopy (Nikon Eclipse E800 Microscope, Kawasaki, Kanagawa, Japan). The pathological scores of heart tissues were graded as follows: a score of 0 was assigned for no inflammatory infiltrates, 1 for a small foci of inflammatory cells between myocytes or inflammatory cells surrounding individual myocytes, 2 for a larger foci of 100 inflammatory cells or involving at least 30 myocytes, 3 when 10% of a myocardial cross-section was involved or 4 if 30% of a myocardial cross-section was involved (20). The assessment was separately scored by two independent pathologists in a blinded manner.

Preparation of spleen lymphocytes and cell cultures

Spleens from AVMC mice were collected aseptically. After mincing, splenic cells were gently dispersed through a nylon mesh into a single-cell suspension. The lymphocyte fractions of the splenic mononuclear cell suspensions were obtained by Ficoll-Paque (Solarbio Science & Technology Co., Ltd.) gradient centrifugation and washed twice with PBS. Lymphocytes from each spleen were divided into 2 groups and cultured in a total volume of 300 μl for 48 h in triplicate wells (5×105 cells/well) of a 96-well culture plate, in RPMI-1640 supplemented with penicillin (100 U/ml), streptomycin (100 μg/ml), 10% fetal bovine serum (Gibco-BRL, Carlsbad, CA, USA) and phytohaemafflutinin (PHA; 10 μg/ml; Sigma-Aldrich, St. Louis, MO, USA) at 37°C and 5% CO2, in the absence or presence of the recombinant mouse IL-17 (rIL-17; 25 ng/ml; R&D Systems). Cells were collected and used in real-time polymerase chain reaction (RT-PCR), while the culture supernatants were assayed by ELISA.

Plaque-forming assay

Viral titers were determined using a standard plaque formation assay and results were expressed per organ weight (g). A section of the heart tissue was weighed and homogenized in 2 ml PBS. The supernatant was absorbed and sequentially diluted 10-fold in RPMI-1640 medium after three freeze-thaw cycles and centrifugation at 500 × g for 10 min. The HeLa cell monolayers were incubated with the supernatant for 1 h at 37°C and 5% CO2 in six-well plates, washed in PBS and covered with 2 ml of 0.4% agar, DMEM and 5% FCS. The monolayers were fixed in paraformaldehyde and stained in crystal violet after cultivation for 72 h and the number of plaques were counted.

RT-PCR

The total RNA of homogenized heart tissue and cellular RNA of the cultured lymphocytes was extracted with TRIzol® reagent (Invitrogen, Carlsbad, CA, USA). Reverse transcription into cDNA was carried out using a Reverse Transcription kit (Fermentas, Vilnius, Lithuania), according to the manufacturer’s instructions. RT-PCR was performed with an ABI 7500 Sequence Detection System using SYBR-Green (Applied Biosystems, Foster City, CA, USA). An initial denaturation step for 3 min at 94°C, 35 cycles of denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 60 sec were carried out. The relative gene expression levels were normalized to the level of β-actin transcripts and quantified using the ΔΔCT method. Each reaction was carried out in triplicate. Primers for IL-22, IFN-γ, TNF-α, IL-6, CVB3, STAT3 and the housekeeping gene β-actin were designed by Primer Premier 5.0 (Table I).

Table I

Primer sequences for real-time RT-PCR.

Table I

Primer sequences for real-time RT-PCR.

MoleculeSequence (5′-3′)
TNF-αSense: AGTCCGGGCAGGTCTACTTT
Anti-sense: TTGGACCCTGAGCCATAATC
IL-6Sense: ACAGAAGGAGTGGCTAAGGACC
Anti-sense: TAGGCATAACGCACTAGGTTT
IL-22Sense: CGATTGGGGAACTGGACCTG
Anti-sense: GGACGTTAGCTTCTCACTTT
CVB3Sense: CGGTACCTTTGTGCGCCTGT
Anti-sense: CAGGCCGCCAACGCAGCC
IFN-γSense: CTCAAGTGGCATAGATGTGGAAG
Anti-sense: GCTGGACCTGTGGGTTGTTGA
STAT3Sense: CCCATATCGTCTGAAACTC
Anti-sense: TTGCTCCCTTCTGCTCT
β-actinSense: AATTCCATCATGAAGTGTGA
Anti-sense: ACTCCTGCTTGCTGATCCAC

[i] IL, interleukin; CVB3, coxsackievirus B3.

Western blot analysis

The total proteins were extracted according to the manufacturer’s instructions. Protein concentrations were determined using a BCA protein assay kit (Beyotime Institute of Biotechnology, Shanghai, China). Equal amounts of denatured sample protein (50 μg) were separated in 10% SDS-PAGE gel and transferred onto a nitrocellulose membrane. After blocking with 6% non-fat dry milk in Tris-buffered saline containing 0.1% Tween-20, the membranes were treated with anti-phospho-STAT3 (p-Y705-STAT3; 1:12,000; Abcam, Cambridge, MA, USA) and glyceraldehyde phosphate dehydrogenase (GAPDH; 1:10,000; Kang Chen Bio-tech, Shanghai, China) antibodies overnight at 4°C and exposed to the corresponding HRP-conjugated goat anti-rabbit IgG (1:5,000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) for 1 h at room temperature. Labeled bands were detected using an enhanced chemiluminescence detection kit (BestBio Inc., Shanghai, China) and analyzed using the Image Lab 2.0 analysis system (Bio-Rad Laboratory, Hercules, CA, USA). The intensity of phosphor-STAT3 (p-STAT3) bands was normalized to the levels of GAPDH.

Cytokine assay

ELISA was performed to determine the cytokine content in serum or cell culture supernatants. The Quantikine Mouse IL-22 Immunoassay (Cat. No. 436307, Biolegend, San Diego, CA, USA) was used to detect the levels of IL-22. The minimal detectable concentration was 5 pg/ml. No cross-reactivity was observed during detection. Samples were measured in triplicate.

Statistical analysis

Data were expressed as the mean ± standard deviation (SD). For statistical analysis, differences between the mean values were tested by Student’s t-test or ANOVA, using SPSS 17.0. Correlations were determined by Spearman’s rank correlation coefficients. The Mann-Whitney U test was carried out for the differences between pathological scores. P<0.05 was considered to indicate a statistically significant difference.

Results

Neutralization of IL-22 in IL-17A−/− mice alleviated the severity of myocarditis

No mice died in the normal, AVMC, anti-IL-22 Ab or IgG control groups until day 14. With the exception of the normal group, inflammatory cell infiltration or necrotic lesions and visible clinical signs of myocarditis were observed in the AVMC, anti-IL-22 Ab and IgG control groups (Fig. 1A and B). Data showed that injection of IL-22 neutralizing antibodies alleviated the severity of myocarditis. The pathological scores of heart sections from mice receiving anti-IL-22 Ab (1.48±0.18) were lower than those in mice in the AVMC (2.12±0.37) and IgG control (2.08±0.29) groups (all P<0.01). Compared with the AVMC and IgG control groups, significantly decreased values for HW/BW were observed in the anti-IL-22 Ab group (Fig. 1C; all P<0.01). With regard to the pathological scores and ratios of HW/BW, no significant difference was observed between the AVMC and IgG control groups (P>0.05).

Figure 1

Neutralization of IL-22 in IL-17A−/− mice alleviated the severity of myocarditis. (A) Representative histopathological images in heart tissues (H&E, original magnification ×400). (B) The pathological scores in the normal, AVMC, anti-IL-22 Ab and IgG control groups. *P<0.01, versus normal, AVMC and IgG groups. (C) The ratio of HW/BW in different groups. Eight mice in each group were analyzed. #P<0.05 versus the normal, AVMC and IgG groups. ##P<0.05 versus the AVMC, anti-IL-22 and IgG groups. IL, interleukin; AVMC, acute viral myocarditis; H&E, hematoxylin and eosin; HW/BW, heart weight/body weight.

Neutralization of IL-22 in IL-17A−/− mice promoted viral replication

On day 14, the levels of cardiac CVB3 titers (values expressed in PFU/g) were 0 in the normal, (9.17±2.22)x103 in the AVMC, (1.08±0.15)x105 in the anti-IL-22 Ab and (9.13±2.30)x103 in the IgG control groups. Data revealed that the levels of cardiac viral titers were elevated significantly in the anti-IL-22 Ab group compared with the normal, AVMC and IgG control groups (all P<0.01). At the same time-point, the relative expression levels of cardiac CVB3 RNA in the anti-IL-22 Ab group were higher than those in the normal, AVMC and IgG control groups (all P<0.01). Cardiac CVB3 RNA was not detected in the normal group. Differences in CVB3 titers and cardiac CVB3 RNA expression levels between the AVMC and IgG control groups were not statistically significant (Fig. 2A and B).

Figure 2

Neutralization of IL-22 in IL-17A−/− mice promoted viral replication and decreased the production of TNF-α, IL-6 and IFN-γ. (A) The levels of cardiac CVB3 titers on day 14. Data show the mean values of CVB3 PFU/g of heart. (B) The relative expression levels of cardiac CVB3 RNA in different groups. (C-E) The result of statistical analysis for the alterations in cardiac TNF-α, IL-6 and IFN-γ mRNA, as measured by RT-PCR. (F) The correlation analysis of cardiac CVB3 RNA, cardiac IL-22 mRNA and IFN-γ mRNA. Each point represents an individual mouse. *P<0.01 and #P<0.05 versus the normal, AVMC and IgG groups. **P<0.01 and ##P<0.05 versus the AVMC, anti-IL-22 and IgG groups. Values are presented as the mean ± SD. IL, interleukin; CVB3, coxsackievirus B3; RT-PCR, real-time polymerase chain reaction; AVMC, acute viral myocarditis; SD, standard deviation.

Neutralization of IL-22 in IL-17A−/− mice decreased the production of TNF-α, IL-6 and IFN-γ

Compared with the normal group, an increased production of TNF-α, IL-6 and IFN-γ was observed in the AVMC, IgG control and anti-IL-22 Ab groups (Fig. 2C-E). Compared with the AVMC and IgG control groups, lower expression levels of cardiac TNF-α, IL-6 and IFN-γ mRNA were observed in the anti-IL-22 Ab group (all P<0.05) on day 14 postinjection. With regard to the levels of TNF-α, IL-6 and IFN-γ genes, no significant changes were observed between the AVMC and IgG control groups (all P>0.05). It was determined that the cardiac IL-22 mRNA was correlated negatively with the CVB3 RNA (R=−0.805, P<0.01; Fig. 2F).

Neutralization of IL-22 in IL-17A−/− mice decreased the levels of IL-22 and STAT3

Compared with the normal group, an increased production of serum IL-22 and cardiac IL-22 mRNA was observed in the AVMC, anti-IL-22 Ab and IgG control groups (all P<0.01; Fig. 3A and B). However, compared with the AVMC and IgG control groups, anti-IL-22 Ab markedly decreased the expression levels of circulating IL-22 and cardiac IL-22 (all P<0.05) on day 14 postinjection. A negative correlation was established between cardiac IL-22 mRNA and CVB3 RNA (R=−0.825, P<0.01; Fig. 3C). Furthermore, decreased expression levels of cardiac STAT3 mRNA and p-STAT3, analyzed by RT-PCR and western blot analysis, respectively, were observed in the anti-IL-22 Ab group (all P<0.05; Fig. 3D-F). For IL-22 and STAT3, no significant difference was observed between the AVMC and IgG control groups.

Figure 3

Neutralization of IL-22 in IL-17A−/− mice decreased the levels of IL-22 and STAT3. (A) Results of the statistical analysis for the alteration of serum IL-22 protein levels, as investigated by ELISA. (B) The relative cardiac expression levels of IL-22, as analyzed by RT-PCR. (C) The correlation analysis of cardiac CVB3 RNA and cardiac IL-22 mRNA. (D and E) Results of the statistical analysis for the levels of cardiac STAT3 mRNA and STAT3 proteins, as measured by RT-PCR and western blot analysis, respectively. (F) Representative images for the levels of cardiac STAT3 proteins from each treated group. #P<0.05 versus the normal, AVMC and IgG groups. *P<0.01 versus the AVMC, anti-IL-22 and IgG groups. Values are presented as the mean ± SD. IL, interleukin; STAT3, activator of transcription 3; RT-PCR, real-time polymerase chain reaction; CVB3, coxsackievirus B3; SD, standard deviation; GAPDH, glyceraldehyde phosphate dehydrogenase.

rIL-17 increased the production of IL-22 and IL-6

To assess the effect of IL-17 on IL-22 production, spleen lymphocytes of AVMC from IL-17A−/− mice were incubated for 24 h with PHA and 25 ng/ml rIL-17 (R&D Systems). Compared with those cultured with PHA only, data showed that the addition of rIL-17A to spleen lymphocyte cultures resulted in a significantly increased level of the IL-22 protein in culture supernatants and an upregulation of IL-22 mRNA in spleen lymphocytes (Fig. 4A and B; all P<0.01). Furthermore, a significant increase in the mRNA expression levels of IL-6 was observed in the rIL-17A + PHA group in comparison with the PHA only group (Fig. 4C; P<0.01).

Figure 4

rIL-17 increased the production of IL-22 and IL-6. (A) The levels of IL-22 protein in culture supernatants, as measured by ELISA. (B and C) Results of IL-22 and IL-6 mRNA in cultured spleen lymphocytes, as analyzed by RT-PCR. *P<0.01 versus PHA groups only. Values are presented as the mean ± SD. rIL-17, recombinant interleukin-17; RT-PCR, real-time polymerase chain reaction; PHA, phytohaemafflutinin; SD, standard deviation.

Discussion

The secretion of numerous proinflammatory or protective cytokines is important in the pathogenesis of AVMC (4–6). Our previous study demonstrated that IL-17A and IL-22 responses were developed in CVB3-induced AVMC and characterized the myocardium-protective and antiviral roles of IL-22 in the presence of IL-17A (18). Enhanced co-expression of these two cytokines suggested that they may have a functional interaction. Studies conducted on the mouse model of intestinal intracellular parasites showed that the concurrent neutralization of IL-17A and IL-22 resulted in a reduction in infection-induced body weight loss, while the neutralization of IL-22 alone had no effect on body weight loss (21). Furthermore, Liang et al and Aujla et al observed synergy between IL-22 and IL-17A after infection with the pulmonary pathogen K. pneumonia, which promoted the production of inflammatory mediators and antimicrobial peptides (22) and contributed to the host defense after pulmonary infection (23). However, administration of exogenous IL-22 alone was not enough to promote neutrophil recruitment to the airway (24). On the basis of these results, it is possible that IL-17A contributes to the tissue-protective and antiviral properties of IL-22 in AVMC, therefore, we carried out the present study using IL-17A knockout mice.

Notably, in the present study, neutralization of IL-22 in the absence of IL-17A improved measures of the severity of AVMC, which was verified by lower values of HW/BW and pathological scores of heart sections and the decreased production of cardiac proinflammatory cytokines IL-6 and TNF-α. These results and those from our previous studies (18) indicate that IL-22 appears to confer anti-inflammatory properties in a murine model of AVMC in the presence of IL-17A, whereas in the absence of IL-17A, IL-22 was no longer protective and instead conferred a proinflammatory and pathological outcome. By contrast, previous observations have shown that bleomycin induces acute tissue damage and airway inflammation (17), which indicates that IL-17A and IL-22 acted synergistically to promote inflammation, while IL-22 had tissue-protective functions in the absence of IL-17A. Our experiment demonstrates opposite data, where IL-17A prevented the proinflammatory properties and promoted the tissue-protective functions of IL-22, adding another layer of complexity to these cytokines. The first possible explanation for these observations may be that IL-17R and IL-22R expression are not overlapped. IL-17R is expressed in the tissues and cells of immune system (25,26) and IL-17 activates T cells and other immune cells to produce a variety of cytokines, chemokines and cell adhesion molecules (27). By contrast, IL-22R is expressed in the tissues but is absent from cells of a hematopoetic origin. Thus, IL-22 acts as a middle-man between the immune system and its environment (8). The presence or absence of direct immune response activation by IL-17 may determine whether IL-22 alleviates or exacerbates the severity of AVMC. Secondly, STAT3, the important downstream signal protein of IL-22 (8–10), regulates a wide range of biological processes (28). In addition to our published data (6), the detection of enhanced levels of IL-22 and STAT3 in mice infected with CVB3 and the blockade of IL-22 causing a decrease in the amount of STAT3 in the present study suggests the importance of the IL-22/STAT3 pathway in the pathogenesis of AVMC. A number of studies have demonstrated the complex interactions between STAT3 and the downstream signal molecules of IL-17, including NF-κB (29). This interplay between IL-17A and IL-22 signaling pathways may regulate the production of inflammatory cytokines, including IL-6 and TNF-α, to determine the balance between pathological versus tissue-protective outcomes. Therefore, although further investigation is required, cytokine receptors and the signaling pathways of IL-17A and IL-22 may affect the functional properties of IL-22 and provide possible explanations for the distinct roles of IL-22 in murine models of AVMC.

Notably, cardiac CVB3 RNA was correlated negatively with the cardiac IFN-γ and IL-22 mRNA and the upregulation of viral replication was observed in the anti-IL-22 Ab group. Additionally, we identified a lower amount of cardiac IFN-γ, the vital Th1 cell cytokine, in the anti-IL-22 Ab group, which is consistent with our earlier observation that the number of IL-22-producing Th22 cells was correlated positively with the number of IFN-γ-producing Th1 cells in mice infected with CVB3 (18). Th1 responses have been demonstrated to protect against viral replication and prevent chronic myocarditis/DCM and increase acute inflammation, particularly in males (30). Thus, the decreased production of the IFN-γ gene, which may be modulated by the IL-22/STAT3 pathway, is a possible explanation for our observation that the enhancement of viral replication is followed by a decrease in acute cardiac inflammation, rather than an increase in myocarditis. These results also suggest that cardiac inflammation is not positively correlated with viral replication, since either virus-specific or immune responses also contribute to myocarditis. For instance, T-cell-deficient mice develop minimal cardiac injury despite high virus titers in the heart (30,31). Together with our earlier studies, results of the present study indicate that IL-22 has an important antiviral function in AVMC microenvironmental conditions, independent of IL-17A.

Our published studies have demonstrated a positive correlation between IL-22-producing Th22 and IL-17-producing Th17 cells in WT mice (18). With regard to the serum levels of IL-22 in mice infected with CVB3, we observed lower amounts of IL-22 in IL-17A−/− mice compared with WT mice (18). Data indicated that IL-17 may contribute to the production of IL-22 in AVMC in vivo. Therefore, we investigated the contribution of IL-17 to IL-22 in vitro and demonstrated that rIL-17 was able to enhance the mRNA expression and protein secretion of IL-22 in spleen lymphocytes, in addition to IL-6. The main explanation for this observation was that IL-17 induces the expression of IL-6, which is important for the differentiation and proliferation of IL-22-producing Th22 cells (32). Pertinent to our data, previous studies have observed increased IL-22 mRNA levels in the absence of IL-17A in mouse models of colitis (33) or decreased IL-22 mRNA levels in splenocyte cultures with the addition of exogenous IL-17A (34,35). This discrepancy may be explained by a disease-specific difference in the role of IL-17A in regulating the production of IL-22.

A number of limitations should be noted in the present study. Firstly, the biological activity, affinity and/or potency of IL-22 antibodies in vivo are uncertain. The administered dose of anti-IL-22 Ab may not be able to completely antagonize the circulating IL-22 in vivo. Secondly, the exact mechanisms by which IL-17A regulates the proinflammatory or anti-inflammatory properties of IL-22 in AVMC remain unclear. Further studies with regard to this may be conducted in the future to clarify the complicated interactions among their downstream signaling pathways.

In conclusion, the present study furthers our previous findings and provides preliminary evidence for demonstrating the critical pathological and antiviral roles of IL-22 in AVMC, in the absence of IL-17A. To the best of our knowledge, in combination with our previous studies, our data provide the first demonstration that IL-17A is unable to govern the antiviral role of IL-22, although it is able to regulate the proinflammatory or tissue-protective properties and expression levels of IL-22, thereby determining the functional consequences of IL-22 in the pathogenesis of CVB3-induced AVMC. Our observation indicates that elucidation of the roles of IL-22 and the mechanisms of local cytokine dependency, including IL-17A, is likely to aid the understanding of the pathophysiology of IL-22-associated infections, inflammation and immune responses.

Acknowledgements

The study described in this manuscript was supported by grants from the National Natural Science Foundations of China (nos. 30960129 and 81260045). We would like to thank Dr Jiao Lan, Zoujiu Liang and Qiguang Huang for their technical assistance.

References

1 

Dennert R, Crijns HJ and Heymans S: Acute viral myocarditis. Eur Heart J. 29:2073–2082. 2008. View Article : Google Scholar

2 

Gupta S, Markham DW, Drazner MH and Mammen PP: Fulminant myocarditis. Nat Clin Pract Cardiovasc Med. 5:693–706. 2008. View Article : Google Scholar

3 

Cooper LT Jr: Myocarditis. N Engl J Med. 360:1526–1538. 2009. View Article : Google Scholar : PubMed/NCBI

4 

Fairweather D and Rose NR: Coxsackievirus-induced myocarditis in mice: a model of autoimmune disease for studying immunotoxicity. Methods. 41:118–122. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Yuan J, Yu M, Lin QW, Cao AL, Yu X, Dong JH, Wang JP, Zhang JH, Wang M, Guo HP, Cheng X and Liao YH: Th17 cells contribute to viral replication in coxsackievirus B3-induced acute viral myocarditis. J Immunol. 185:4004–4010. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Yang F, Wu WF, Yan YL, Pang Y, Kong Q and Huang YL: Expression of IL-23/Th17 pathway in a murine model of Coxsackie virus B3-induced viral myocarditis. Virol J. 8:3012011. View Article : Google Scholar : PubMed/NCBI

7 

Trifari S, Kaplan CD, Tran EH, Crellin NK and Spits H: Identification of a human helper T cell population that has abundant production of interleukin 22 and is distinct from T(H)-17, T(H)1 and T(H)2 cells. Nat Immunol. 10:864–871. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Sonnenberg GF, Fouser LA and Artis D: Border patrol: regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22. Nat Immunol. 12:383–390. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Radaeva S, Sun R, Pan HN, Hong F and Gao B: Interleukin 22 (IL-22) plays a protective role in T cell-mediated murine hepatitis: IL-22 is a survival factor for hepatocytes via STAT3 activation. Hepatology. 39:1332–1342. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Ziesché E, Bachmann M, Kleinert H, Pfeilschifter J and Mühl H: The interleukin-22/STAT3 pathway potentiates expression of inducible nitric-oxide synthase in human colon carcinoma cells. J Biol Chem. 282:16006–16015. 2007.PubMed/NCBI

11 

Takahashi K, Hirose K, Kawashima S, Niwa Y, Wakashin H, Iwata A, Tokoyoda K, Renauld JC, Iwamoto I, Nakayama T and Nakajima H: IL-22 attenuates IL-25 production by lung epithelial cells and inhibits antigen-induced eosinophilic airway inflammation. J Allergy Clin Immunol. 128:1067–1076. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Wang P, Bai F, Zenewicz LA, Dai J, Gate D, Cheng G, Yang L, Qian F, Yuan X, Montgomery RR, Flavell RA, Town T and Fikrig E: IL-22 signaling contributes to West Nile encephalitis pathogenesis. PLoS One. 7:e441532012. View Article : Google Scholar : PubMed/NCBI

13 

Missé D, Yssel H, Trabattoni D, Oblet C, Lo Caputo S, Mazzotta F, Pène J, Gonzalez JP, Clerici M and Veas F: IL-22 participates in an innate anti-HIV-1 host-resistance network through acute-phase protein induction. J Immunol. 178:407–415. 2007.PubMed/NCBI

14 

Zenewicz LA, Yancopoulos GD, Valenzuela DM, Murphy AJ, Karow M and Flavell RA: Interleukin-22 but not interleukin-17 provides protection to hepatocytes during acute liver inflammation. Immunity. 27:647–659. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Huber S, Gagliani N, Zenewicz LA, Huber FJ, Bosurgi L, Hu B, Hedl M, Zhang W, O’Connor W Jr, Murphy AJ, Valenzuela DM, Yancopoulos GD, Booth CJ, Cho JH, Ouyang W, Abraham C and Flavell RA: IL-22BP is regulated by the inflammasome and modulates tumorigenesis in the intestine. Nature. 491:259–263. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Laurence A, O’Shea JJ and Watford WT: Interleukin-22: a sheep in wolf’s clothing. Nat Med. 14:247–249. 2008.

17 

Sonnenberg GF, Nair MG, Kirn TJ, Zaph C, Fouser LA and Artis D: Pathological versus protective functions of IL-22 in airway inflammation are regulated by IL-17A. J Exp Med. 207:1293–1305. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Kong Q, Wu W, Yang F, Liu Y, Xue Y, Gao M, Lai W, Pan X, Yan Y, Pang Y and Deng Y: Increased expressions of IL-22 and Th22 cells in the coxsackievirus B3-Induced mice acute viral myocarditis. Virol J. 9:2322012. View Article : Google Scholar : PubMed/NCBI

19 

Nakae S, Komiyama Y, Nambu A, Sudo K, Iwase M, Homma I, Sekikawa K, Asano M and Iwakura Y: Antigen-specific T cell sensitization is impaired in IL-17-deficient mice, causing suppression of allergic cellular and humoral responses. Immunity. 17:375–387. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Eriksson U, Ricci R, Hunziker L, Kurrer MO, Oudit GY, Watts TH, Sonderegger I, Bachmaier K, Kopf M and Penninger JM: Dendritic cell-induced autoimmune heart failure requires cooperation between adaptive and innate immunity. Nat Med. 9:1484–1490. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Stange J, Hepworth MR, Rausch S, Zajic L, Kühl AA, Uyttenhove C, Renauld JC, Hartmann S and Lucius R: IL-22 mediates host defense against an intestinal intracellular parasite in the absence of IFN-γ at the cost of Th17-driven immunopathology. J Immunol. 188:2410–2418. 2012.PubMed/NCBI

22 

Liang SC, Tan XY, Luxenberg DP, Karim R, Dunussi-Joannopoulos K, Collins M and Fouser LA: Interleukin (IL)-22 and IL-17 are coexpressed by Th17 cells and cooperatively enhance expression of antimicrobial peptides. J Exp Med. 203:2271–2279. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Aujla SJ, Chan YR, Zheng M, Fei M, Askew DJ, Pociask DA, Reinhart TA, McAllister F, Edeal J, Gaus K, Husain S, Kreindler JL, Dubin PJ, Pilewski JM, Myerburg MM, Mason CA, Iwakura Y and Kolls JK: IL-22 mediates mucosal host defense against Gram-negative bacterial pneumonia. Nat Med. 14:275–281. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Liang SC, Long AJ, Bennett F, Whitters MJ, Karim R, Collins M, Goldman SJ, Dunussi-Joannopoulos K, Williams CM, Wright JF and Fouser LA: An IL-17F/A heterodimer protein is produced by mouse Th17 cells and induces airway neutrophil recruitment. J Immunol. 179:7791–7799. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Yao Z, Fanslow WC, Seldin MF, Rousseau AM, Painter SL, Comeau MR, Cohen JI and Spriggs MK: Herpesvirus Saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity. 3:811–821. 1995. View Article : Google Scholar

26 

Gaffen SL: Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9:556–567. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Komiyama Y, Nakae S, Matsuki T, Nambu A, Ishigame H, Kakuta S, Sudo K and Iwakura Y: IL-17 plays an important role in the development of experimental autoimmune encephalomyelitis. J Immunol. 177:566–573. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Dauer DJ, Ferraro B, Song L, Yu B, Mora L, Buettner R, Enkemann S, Jove R and Haura EB: Stat3 regulates genes common to both wound healing and cancer. Oncogene. 24:3397–3408. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Bollrath J and Greten FR: IKK/NF-kappaB and STAT3 pathways: central signalling hubs in inflammation-mediated tumour promotion and metastasis. EMBO Rep. 10:1314–1319. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Fairweather D, Stafford KA and Sung YK: Update on coxsackievirus B3 myocarditis. Curr Opin Rheumatol. 24:401–407. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Woodruff JF and Woodruff JJ: Involvement of T lymphocytes in the pathogenesis of coxsackievirus B3 heart disease. J Immunol. 113:1726–1734. 1974.PubMed/NCBI

32 

Duhen T, Geiger R, Jarrossay D, Lanzavecchia A and Sallusto F: Production of interleukin 22 but not interleukin 17 by a subset of human skin-homing memory T cells. Nat Immunol. 10:857–863. 2009. View Article : Google Scholar : PubMed/NCBI

33 

O’Connor W Jr, Kamanaka M, Booth CJ, Town T, Nakae S, Iwakura Y, Kolls JK and Flavell RA: A protective function for interleukin 17A in T cell-mediated intestinal inflammation. Nat Immunol. 10:603–609. 2009.PubMed/NCBI

34 

Smith E, Stark MA, Zarbock A, Burcin TL, Bruce AC, Vaswani D, Foley P and Ley K: IL-17A inhibits the expansion of IL-17A-producing T cells in mice through ‘short-loop’ inhibition via IL-17 receptor. J Immunol. 181:1357–1364. 2008.

35 

von Vietinghoff S and Ley K: IL-17A controls IL-17F production and maintains blood neutrophil counts in mice. J Immunol. 183:865–873. 2009.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kong Q, Xue Y, Wu W, Yang F, Liu Y, Gao M, Lai W and Pan X: IL-22 exacerbates the severity of CVB3-induced acute viral myocarditis in IL-17A-deficient mice. Mol Med Rep 7: 1329-1335, 2013.
APA
Kong, Q., Xue, Y., Wu, W., Yang, F., Liu, Y., Gao, M. ... Pan, X. (2013). IL-22 exacerbates the severity of CVB3-induced acute viral myocarditis in IL-17A-deficient mice. Molecular Medicine Reports, 7, 1329-1335. https://doi.org/10.3892/mmr.2013.1323
MLA
Kong, Q., Xue, Y., Wu, W., Yang, F., Liu, Y., Gao, M., Lai, W., Pan, X."IL-22 exacerbates the severity of CVB3-induced acute viral myocarditis in IL-17A-deficient mice". Molecular Medicine Reports 7.4 (2013): 1329-1335.
Chicago
Kong, Q., Xue, Y., Wu, W., Yang, F., Liu, Y., Gao, M., Lai, W., Pan, X."IL-22 exacerbates the severity of CVB3-induced acute viral myocarditis in IL-17A-deficient mice". Molecular Medicine Reports 7, no. 4 (2013): 1329-1335. https://doi.org/10.3892/mmr.2013.1323
Copy and paste a formatted citation
x
Spandidos Publications style
Kong Q, Xue Y, Wu W, Yang F, Liu Y, Gao M, Lai W and Pan X: IL-22 exacerbates the severity of CVB3-induced acute viral myocarditis in IL-17A-deficient mice. Mol Med Rep 7: 1329-1335, 2013.
APA
Kong, Q., Xue, Y., Wu, W., Yang, F., Liu, Y., Gao, M. ... Pan, X. (2013). IL-22 exacerbates the severity of CVB3-induced acute viral myocarditis in IL-17A-deficient mice. Molecular Medicine Reports, 7, 1329-1335. https://doi.org/10.3892/mmr.2013.1323
MLA
Kong, Q., Xue, Y., Wu, W., Yang, F., Liu, Y., Gao, M., Lai, W., Pan, X."IL-22 exacerbates the severity of CVB3-induced acute viral myocarditis in IL-17A-deficient mice". Molecular Medicine Reports 7.4 (2013): 1329-1335.
Chicago
Kong, Q., Xue, Y., Wu, W., Yang, F., Liu, Y., Gao, M., Lai, W., Pan, X."IL-22 exacerbates the severity of CVB3-induced acute viral myocarditis in IL-17A-deficient mice". Molecular Medicine Reports 7, no. 4 (2013): 1329-1335. https://doi.org/10.3892/mmr.2013.1323
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team