Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November 2013 Volume 8 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November 2013 Volume 8 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

The role of CD133 expression in the carcinogenesis and prognosis of patients with lung cancer

  • Authors:
    • Hanbo Le
    • Fang Zeng
    • Liyun Xu
    • Xiaoguang Liu
    • Yanyan Huang
  • View Affiliations / Copyright

    Affiliations: Department of Cardio‑Thoracic Surgery, Zhoushan Hospital of Zhejiang Province, Zhoushan, Zhejiang 316004, P.R. China, Joint Laboratory of Immunogenomics, Zhoushan Hospital‑BIG/CAS, Zhoushan, Zhejiang 316004, P.R. China
  • Pages: 1511-1518
    |
    Published online on: September 4, 2013
       https://doi.org/10.3892/mmr.2013.1667
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Cancer stem cells (CSCs) are a small population of undifferentiated cancer cells within tumors, which contribute to tumorigenicity and relapse. In the current study, CD133 (also termed prominin‑1), a CSC marker, was investigated to determine its involvement in predicting carcinogenesis and prognosis in patients with non‑small cell lung carcinoma (NSCLC). CD133‑positive lung cancer cells were isolated to analyze self‑renewal, differentiation and tumorigenic abilities in vitro and in vivo. Quantitative polymerase chain reaction was used to detect the expression of CD133 and three other CSC‑associated markers, octamer‑binding transcription factor 4 (OCT4A), Nanog homeobox (NANOG) and multidrug resistance protein 1 (MDR1), in primary NSCLC and adjacent non‑cancer tissues. A series of statistical methods were used to analyze the correlation between mRNA expression levels, clinicopathological features and patient survival. The results showed that CD133‑positive NSCLC cells demonstrated clonogenic, tumorigenic and drug‑resistance properties compared with their CD133‑negative counterparts or parental cells. In addition, compared with the adjacent normal lung tissue, the levels of CSC‑associated biomarkers CD133, OCT4A, NANOG and MDR1 were significantly increased in NSCLC tissue. Elevated expression of CD133 was associated with stage, tumor size and differentiation of NSCLC; however, the cox hazard regression analysis showed no significant association between CD133 expression and overall patient survival. The present study supports the hypothesis that the stem cell population can be enriched in cells expressing the CD133 cell surface marker and that highly expressed CD133 is involved in the occurrence of NSCLC. However, CD133 may not be considered as an independent factor in predicting the prognosis of patients with NSCLC. Further studies are required to investigate the association between CD133 expression and overall patient survival.

Introduction

Lung cancer is the most common cause of cancer-related mortality worldwide, and a poor five-year survival rate (15%) highlights the importance of gaining an improved understanding of this malignancy to improve prevention, diagnosis and treatment (1). A previous study showed that tumor initiation and propagation is induced by a specific population of self-renewing tumor cells, termed cancer stem cells (CSCs) or tumor propagating cells (2). Previous studies have indicated that similar to a number of solid tumors, human lung cancers, particularly non-small cell lung carcinoma (NSCLC), harbor CSC populations (3–5).

Certain molecules are being investigated as putative markers of CSCs in malignancies, including lung cancer (6). CD133 (also termed prominin-1), a cell-surface glycoprotein comprising five transmembrane domains and two large glycosylated extracellular loops, has been previously used as a biomarker to separate cancer stem cells from a variety of solid human tumors, including brain (7), breast (8), liver (9), pancreas (10), colon (11) and lung (12,13) tumors. Although CD133 has been used to enrich lung cancer CSCs in several studies, the potential for the use of CD133 as a key marker remains unclear (14–16). In addition, the use of CD133 as a prognostic marker in lung cancer has not yet been confirmed due to conflicting studies (17–22). To investigate these divergent observations, the involvement of CD133 was analyzed using NSCLC cells and clinical specimens to evaluate a possible correlation between CD133 expression and clinical-pathological variables in patients with NSCLC. To the best of our knowledge, this was the first study to investigate NSCLC tumor and non-tumor tissue, with respect to CSC-marker expression profiles and their relevance to the clinicopathological parameters of lung cancer. The current results demonstrated that elevated expression of CD133 was associated with early clinical stages, larger tumor size and poor differentiation of NSCLC.

Materials and methods

Cell lines and isolation of CD133-positive cells

NSCLC cells, A549, H1299, SPC-A1, SK-MES-1 and a human bronchial epithelial cell line (HBE), were cultured separately in RPMI-1640 medium (Gibco, Invitrogen Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS), 100 IU/ml penicillin and 100 mg/ml streptomycin in a 5% CO2 humidified atmosphere at 37°C. For isolation of CD133-positive cells, the parental H1299 cells were labeled with 1 ml CD133 per liter micromagnetic beads per million cells, using a CD133 cell isolation kit (CD133 MicroBead kit; Miltenyi Biotec, Auburn, CA, USA). The isolated CD133-positive cells were cultured in medium consisting of serum-free Dulbecco’s modified Eagle’s medium (DMEM)/F-12 medium (Gibco, Invitrogen Life Technologies) supplemented with 20 ng/ml human epidermal growth factor (EGF) (PeproTech, Rocky Hill, NJ, USA), 10 ng/ml human basic fibroblast growth factor (bFGF; PeproTech) and 2% B-27 serum-free supplements (Invitrogen Life Technologies). The medium was replaced or supplemented with fresh growth factors twice weekly until floating aggregates formed.

To determine the percentage of single cells capable of regenerating novel spheres, cells were plated at a density of 1,000 cells/ml in ultralow-attachment 6-well plates (Corning Life Sciences, Union City, CA, USA) to obtain the novel spheres. The total number of tumor spheres was counted following 10 days of culture. Efficiency of sphere formation was calculated by the following equation: (Total number of spheres formed / total number of living cells seeded) × 100.

Patients and tissue samples

NSCLC and matched adjacent normal biopsies were obtained from 30 patients (see supplementary Table I) undergoing pulmonary resection at the Zhoushan Hospital of Zhejiang province (Zhoushan, Zhejiang, China) between January 2009 and May 2010. All samples were collected with informed consent obtained at an internal review. The ethics board committees of the Zhoushan Hospital of Zhejiang province approved the current study. Patients recruited into the study had not undergone chemotherapy or radiotherapy prior to surgery. Surgical specimens of the resected tumors were collected following the confirmation of diagnosis by pathological examination. Tumor sections and matched adjacent noncancerous tissues, were placed in separated cryovials and snap-frozen in liquid nitrogen until analysis. All cases were reviewed by two pathologists and diagnosis was confirmed according to criteria previously established by the National Comprehensive Cancer Network (23).

Table I

Primer sequences of CSC-associated genes for qPCR.

Table I

Primer sequences of CSC-associated genes for qPCR.

Gene (accession no.)Primers sequence (5′-3′)Product size (bp)Tm (°C)
OCT4A (NM_002701)F: GTGGAGAGCAACTCCGATG8660
R: TGCTCCAGCTTCTCCTTCTC
SOX2 (NM_003106)F: CGAGTGGAAACTTTTGTCGGA7460
R: TGTGCAGCGCTCGCAG
NANOG (NM_024865)F: ATTCAGGACAGCCCTGATTCTTC7660
R: TTTTTGCGACACTCTTCTCTGC
MDR1 (NM_000927)F: TGGCAAAGAAATAAAGCGACTGA7660
R: CAGGATGGGCTCCTGGG
ABCG2 (NM_004827)F: CCCCAGGCCTCTATAGCTCAGATCA16460
R: TCCACGGCTGAAACACTGCTGA
CD133 (NM_006017)F: CACTACCAAGGACAAGGCGT13460
R: TCCTTGATCGCTGTTGCCAT
GAPDH (NM_002046)F: CATCATCCCTGCCTCTACTG18060
R: GCCTGCTTCACCACCTTC

[i] CSC, cancer stem cell; qPCR, quantitative polymerase chain reaction; Tm, melting temperature; bp, base pair; OCT4A, octamer-binding transcription factor 4; F, forward; R, reverse; SOX2, sex determining region Y-box 2; NANOG, Nanog homeobox; MDR1, multidrug resistance protein 1; ABCG2, ATP-binding cassette subfamily G, member 2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Flow cytometry and fluorescence-activated cell sorting (FACS) analyses

For flow cytometry analysis, cells (106/100 μl) were dissociated using non-enzymatic solution Cellstripper (Mediatech, Herndon, VA, USA) and incubated with the appropriate dilution of control or specific Phycoerythrin (PE)-conjugated anti-CD133/2 antibody (Miltenyi Biotec) at 4°C for 10 min. All samples were measured using a FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) and analyzed with CellQuest software (BD Biosciences).

RNA extraction and quantitative polymerase chain reaction (qPCR)

Total RNA from specimens or cells was extracted using TRIzol (Invitrogen Life Technologies), according to the manufacturer’s instructions and the concentration was determined using a Bioanalyzer UV spectrophotometer Q3000 (Quawell Technology, Inc., San Jose, CA, USA). Complementary DNA (cDNA) was reverse transcribed by 3 μg total RNA in a 20 μl reaction using 0.5 μg Oligo(dT)18 primer and 200 units of RevertAid™ M-MuLV Reverse Transcriptase (Fermentas, Burlington, ON, Canada) and treated with RNase-Free DNase (Qiagen, Valencia, CA, USA). The primers of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and target genes CD133, octamer-binding transcription factor 4 (OCT4A), sex determining region Y-box 2 (SOX2) and Nanog homeobox (NANOG), multidrug resistance protein 1 (MDR1) and ATP-binding cassette subfamily G member 2 (ABCG2) are shown in Table I. The cDNA amplification was performed in a final reaction volume of 20 μl containing 0.5 μM concentrations of each primer, 8 μl 2.5X Real Master mix, 1 μl 20X SYBR solution (Tiangen Biotech, Shanghai, China) and 2 μl 1:10 diluted cDNA. PCR was prepared in triplicate and heated to 95°C for 10 min, followed by 40 cycles of the following sequences: Denaturation at 95°C for 15 sec, annealing at 60°C for 20 sec and extension at 68°C for 35 sec. The expression of genes was detected by qPCR using Applied Biosystems 7500 Real-Time RT-PCR system (Applied Biosystems, Carlsbad, CA, USA). The cycle threshold (Ct) values were calculated with the SDS 2.0.1 software (Applied Biosystems). All target gene Ct values were determined in reference to GAPDH using the 2−ΔΔCt method (24).

Chemotherapy resistance studies

Parental H1299 cells and sorted cells (5×103) were plated in 96-well plates. Cisplatin and paclitaxel (Sigma-Aldrich, St. Louis, MO, USA) were added to the culture medium at a final concentration of 25 μg/ml and 20 μM, respectively, for 24 h. Subsequently, cell viability was analyzed by an MTT assay.

In vivo analysis of tumor growth

Female nude mice (strain, BALB/c; age, 4 weeks) were obtained from the Shanghai Laboratory Animal Center (Shanghai, China). Specific numbers of parental and sorted cells (103, 104 or 106 cells) were subcutaneously injected into the flank of the nude mice. Tumor growth was monitored and volume was measured weekly using a caliper (volume = width × length2 × π/6) for a maximum of 8 weeks. Subsequently, mice were euthanized by cervical vertebra dislocation and the tumors were collected, fixed in formalin and embedded in paraffin for further use.

Statistical analysis

Statistical analyses were performed with the GraphPad Prism 5.0 statistical software (GraphPad Software, Inc., La Jolla, CA, USA). The paired t-test, unpaired t-test and Mann-Whitney U test were used to analyze the correlation between mRNA expression levels and the clinicopathological features. The paired sample t-test was used to compare the differences of mRNA expression between lung tumors and the surrounding normal tissue. Survival analysis was estimated by the Kaplan-Meier method and the log-rank test was used to compare the survival between groups. The Cox proportional hazard regression model was used to analyze the risk factors for lung cancer. P<0.05 was considered to indicate a statistically significant difference.

Results

Isolation and characterization of CD133-positive cells from lung cancer cell lines

To investigate the involvement of CD133 in the link between CSCs and lung cancer biology, CD133-positive cells were isolated from lung cancer cell lines using the magnetic bead method to determine the expression levels of CD133. CD133 was shown to be highly expressed in, 95C, SPC-A1, A549 and H1299 NSCLC lines. The highest expression levels were observed in the H1299 cells (Fig. 1A). Thus, H1299 cells were used for all subsequent experiments.

Figure 1

Isolation and characterization of CD133-positive and CD133-negative cells from the H1299 cell line. (A) Expression levels of CD133 were detected by qPCR in a normal bronchial epithelial cell line and a number of non-small cell lung carcinoma cell lines (HBE, SK-MES-1, 95C, SPC-A1, A549 and H1299). The average Ct value from triplicate assessment in the candidate mRNAs was calculated. *P<0.05, vs. HBE cells. (B) Using a magnetic bead method, CD133-positive cells isolated from H1299 cells were identified by flow cytometry. The image shows spheroid-like bodies formed by CD133-positive and CD133-negative cells in serum-free medium containing bFGF and EGF. The differentiated cells, which were identified to be CD133-positive cells, were grown in adherent conditions in differentiating culture medium for 4 days. Scale bar, 100 μm. (C) mRNA expression levels of cancer stem cell association genes: OCT4A, SOX2, NANOG, MDR1 and ABCG2 in CD133-positive, CD133-negative and H1299 parental cells were determined by qPCR. The fold changes in the target mRNAs were normalized with that of GAPDH. *P<0.05, vs. CD133-negative and H1299 parental cells. (D) An analysis of the ability of different cell groups to form spheroid-like bodies in the serum-free medium containing bFGF and EGF at the indicated days. *P<0.05, vs. CD133-negative and H1299 parental cells. (E) Effect of cisplatin and paclitaxel on the proliferation of parental H1299, CD133-positive or CD133-negative cells. The cells (5×103) were plated in a 96-well plate and treated with the indicated concentrations of cisplatin and paclitaxel for 24 h. The survival rate was determined by a cell counting kit-8 assay. Data are presented as the mean ± SD of three independent experiments. *P<0.05, vs. CD133-negative and H1299 parental cells. qPCR, quantitative polymerase chain reaction; Ct, cycle threshold; bFGF, basic fibroblast growth factor; EGF. epidermal growth factor; OCT4A, octamer-binding transcription factor 4; SOX2, sex determining region Y-box 2; NANOG, Nanog homeobox; MDR1, multidrug resistance protein 1; ABCG2, ATP-binding cassette subfamily G member 2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

The isolated CD133-positive cells identified by flow cytometry formed floating sphere-like bodies in DMEM/F-12 serum-free medium with bFGF and EGF. When CD133-positive cells were grown under adherent conditions in culture medium supplemented with 10% FBS, the cells acquired the typical morphological features of parental H1299 cells with the loss of CD133 expression (decrease in expression from 94.9 to 4.9%; Fig. 1B). qPCR results demonstrated that the expression of stemness genes (OCT4A, SOX2 and NANOG) and drug resistant genes (MDR1 and ABCG2) in CD133-positive cells were higher compared with those in the CD133-negative cells (Fig. 1C). The ability to form spheroid-like bodies was significantly higher in the CD133-positive cells compared with the parental or CD133-negative cells (P<0.05; Fig. 1D). The multidrug chemotherapy resistant abilities of the CD133-positive cells and CD133-negative cells were then investigated. Compared with the CD133-negative and parental cells, CD133-positive cells sorted from H1299 cells were more resistant to cisplatin and paclitaxel (P<0.05; Fig. 1E).

To analyze the tumorigenic potential of CD133-positive cells grown under sphere-forming conditions, during which this property of stem cells may be maintained, specific numbers of H1299 CD133-positive, CD133-negative and parental cells were subcutaneously implanted into the flanks of nude mice (BALB/c strain). As shown in Table II, tumor growth was observed in all groups in which mice were inoculated with 103–106 CD133-positive cells, whereas no tumor growth was observed following inoculation with 103 H1299 parental or CD133-negative cells (Fig. 2A). Tumor growth curves showed that tumors that had developed from the CD133-positive cells grew at a faster rate compared with those that had developed from the parental or CD133-negative cells (Fig. 2B). These observations indicated that CD133-positive lung cancer cells may be used to enrich tumor-initiating cells under sphere-forming conditions.

Figure 2

Tumorigenic potential of CD133-positive cells in vivo. (A) Cells (103 cells in the CD133-positive cell and parental cell group) were simultaneously injected into the right and left flank of the same mouse and the image was captured 2 months following tumor cell implantation. The image represents the relative tumorigenic potential of the CD133-positive cells compared with parental cells in vivo. The arrows indicate the injected tumor formation. (B) Tumor growth curves were generated from isolated CD133-positive, CD133-negative and H1299 parental cells (106 cells in each group). Cells were subcutaneously injected into nude mice and tumor growth was monitored over time (n=4). *P<0.05, vs. H1299 parental cells.

Table II

Tumor formation derived from parental and sorted H1299 cells.

Table II

Tumor formation derived from parental and sorted H1299 cells.

Cells103 cells105 cells106 cells
Parental0/41/43/4
CD133-positive2/44/44/4
CD133-negative0/40/41/4

[i] Specific number (103, 104 and 106 cells) of the parental and sorted cells H1299 cells were subcutaneously injected into the flanks of nude mice for a maximum of 8 weeks. Tumor formation was analyzed two months following implantation. Four mice per group.

Patient information

Tumor specimens from 30 patients (19 paired samples of lung adenocarcinomas and 11 paired samples of lung squamous-cell carcinomas) with previously untreated NSCLC were recruited into the current study. The patients consisted of 23 males and 7 females. The median age was 61.1 years, with nine cases (30%) aged >65 years. Based on the World Health Organization criteria, 15 patients (50%) presented with stage I disease, six patients (20%) with stage II disease and 9 patients (30%) with stage III/IV disease. Of the 30 patients, 14 (46.67%) had tumors with nodal metastasis and 15 (30%) had a primary tumor >3 cm in diameter. The majority of the patients (22; 73.33%) were smokers.

Cancer stem cell-associated gene expression in lung tissue

A primary aim of the current study was to determine whether there was a difference in the frequency of CSC-associated gene expression between paired lung carcinoma and the corresponding noncancerous lung tissue. The results from the qPCR analysis showed that, compared with the adjacent normal lung tissues, the levels of CSC-associated biomarkers, such as OCT4A, CD133, NANOG and MDR1, were significantly increased in lung cancer tissues (P<0.05; Fig. 3). The mRNA levels of CD133 (Fig. 3A) and MDR1 (Fig. 3D) were observed to be significantly higher in the tumor tissue (CD133, P=0.0131 and MDR1, P=0.0159) compared with that in adjacent normal lung tissue. In addition, compared with the normal counterpart, higher NANOG and OCT4A expression was observed in the malignant tissue (P=0.0012 and P=0.0076) in 23 and 19 of 30 pairs (76.67 and 63.33%, respectively; Fig. 3C and B).

Figure 3

CSC-associated gene expression in lung tissue. Total RNA was isolated from the 30 paired tumors and normal lung tissue and qPCR was performed to detect CSC-associated gene expression of (A) CD133, (B) OCT4A, (C) NANOG and (D) MDR1. Expression of mRNA levels were measured using the 2-ΔΔCt method. CSC, cancer stem cell; OCT4A, octamer-binding transcription factor 4; NANOG, nanog homeobox; MDR1, multidrug resistance protein 1.

Correlation between the expression of cancer stem cell-associated genes and clinical-pathological features of NSCLC

The correlation between the expression of CSC-associated genes and clinicopathological features of NSCLC was investigated to gain an improved understanding of the potential involvement of these genes in NSCLC development and progression using the Mann-Whitney U test (Table III). No substantial correlation between the expression of NANOG or MDR1 and the tumor stage, nodal status, tumor size and histological type was observed, with the exception of tumor differentiation. However, overexpression of CD133 in lung tumors was observed to be markedly associated with clinical stage, tumor size and differentiation of NSCLC (P=0.0334, 0.0238 and 0.0376, respectively; Fig. 4A–C). In addition, patients with squamous-cell lung carcinoma or a tumor ≥3 cm in diameter exhibited higher expression levels of CD133. Notably, overexpression of OCT4A in tumors was positively associated with a tumor stage I or II and moderate-well differentiated tumors (P=0.0417 and 0.0396, respectively; Fig. 4D and E). In addition, patients with poor differentiation had higher levels of CD133 and OCT4A.

Figure 4

Correlation between the expression of CSC-associated genes and clinicopathological features of NSCLC. The correlation between the expression of mRNA levels of relevant CSC-associated genes and clinical-pathological features of the patients with NSCLC were analyzed by the Mann-Whitney U test. The association of CD133 with (A) stage, (B) tumor size and (C) tumor differentiation and the OCT4A correlation with (D) stage and (E) tumor differentiation were determined. *P<0.05, vs. two groups. CSC, cancer stem cell; NSCLC, non-small cell lung carcinoma; OCT4A, octamer-binding transcription factor 4.

Table III

Correlation between the expression of CSC-associated genes and the clinicopathological factors in patients with NSCLC.

Table III

Correlation between the expression of CSC-associated genes and the clinicopathological factors in patients with NSCLC.

OCT4ANANOGMDR1CD133




Variablesn=30Mean ± SEMP-valueMean ± SEMP-valueMean ± SEMP-valueMean ± SEMP-value
Gender0.12850.0470a0.05580.1224
 Male236.049±2.1849.195±4.36211.75±8.495.821±1.829
 Female71.081±0.14061.461±0.39301.310±0.30041.235±0.2130
Age (years)0.43850.0388a0.24520.2917
 ≤60115.485±4.1126.080±4.85119.26±17.884.816±3.389
 >60194.546±1.4128.149±4.6323.550±0.67454.713±1.262
Histological type0.0034a0.64980.11380.0024a
 Squamous carcinoma1111.17±4.0999.460±4.63122.93±17.5310.19±3.336
 Adenocarcinoma191.256±0.21406.192±4.6901.429±0.21781.604±0.4545
Pathological stage0.0417a0.15390.11320.0334a
 I, II216.009±2.2729.769±4.76712.47±9.3015.800±1.976
 III, IV92.280±1.1251.841±0.46461.944±0.6082.302±1.125
Smoking status0.07100.05160.0292a0.0827
 Nonsmokers81.046±0.12651.472±0.34051.264±0.26411.201±0.1875
 Current smokers226.288±2.2729.542±4.55112.24±8.8706.041±1.900
Tumor size (cm)0.06800.09700.17760.0238a
 <3151.838±0.50742.435±0.81692.090±0.5541.865±0.5416
 ≥3157.942±3.24712.35±6.57616.53±12.997.636±2.669
Grade of differentiation0.0396a0.0142a0.0248a0.0376a
 Moderate-well161.611±0.48882.257±0.87981.877±0.57411.761±0.5459
 Poor147.759±3.04311.88±6.16615.82±12.177.366±2.516
Lymph node status0.19040.39400.32370.2530
 N0165.645±2.79611.64±6.21315.14±12.215.565±2.329
 N+144.028±1.8922.535±0.64272.782±0.80213.820±1.629

a P<0.05 indicates a statistically significant difference.

{ label (or @symbol) needed for fn[@id='tfn4-mmr-08-05-1511'] } NSCLC, non-small cell lung carcinoma; CSC, cancer stem cell; OCT4A, octamer-binding transcription factor 4; NANOG, Nanog homeobox; MDR1, multidrug resistance protein 1.

Correlation between cancer stem cell-associated gene expression and overall survival of NSCLC patients

The expression of CSC-associated genes and its correlation with overall survival of NSCLC patients was investigated (fold change >2 was considered as high expression). The results showed that higher levels of expression of CD133 in NSCLC was independently correlated with shorter overall survival (log-rank test: P=0.0258, Fig. 5). However, no significant correlation between the expression of OCT4A and the overall survival was observed (log-rank test: P=0.1395). In addition, tumor size >3 cm was observed to be associated with decreased overall survival (log-rank test: P=0.015, data not shown).

Figure 5

The Kaplan-Meier method and the log-rank test were used to compare the overall survival in high and low CD133 expression groups. Kaplan-Meier survival curves for NSCLC patients were plotted for expression, which was based on CD133 cut-off values. The P-value was calculated using the log-rank test between patients with high- and low-fold changes. The overall survival of patients with high vs. low expression levels of CD133 is shown. P<0.05, vs. the two groups. CD133, prominin-1; NSCLC, non-small cell lung carcinoma.

The Kaplan-Meier survival curve showed a trend for an improved outcome in patients with lower CD133 mRNA signals; however, the Cox hazard regression analysis indicated that CD133 was not considered to be an independent factor in predicting the prognosis of patients with NSCLC (hazard ratio: 0.179; 95% confidence interval: 0.010–3.205; P=0.243).

Discussion

Lung cancer is characterized by the difficulty surrounding early diagnosis, high rates of metastasis, recurrence and poor prognosis. Thus, investigating novel diagnostic strategies and novel prognostic markers is urgently required to improve the clinical outcome of this malignancy (1). Increased numbers of CD133-positive cancer stem cells have been observed in NSCLC (13). In the current study, isolated CD133-positive cells were shown to harbor stem cell-like characteristics, as they readily form anchorage-independent floating spheres, possess greater proliferative potential and exhibit enhanced tumor regenerating capacity compared with their CD133-negative counterparts. In addition, CD133-positive, but not CD133-negative or parental NSCLC cells formed tumors in the nude mice xenograft model. These results demonstrated the CSC status of CD133-positive cells in NSCLC.

The correlation of CSC-associated gene expression (CD133, OCT4A, NANOG and MDR1) in NSCLC samples, with patient characteristics, tumor pathology and overall survival was investigated. The current results indicated the presence of CSCs in NSCLC tissue, as self-renewal and multipotency are critical characteristics of CSCs (4). Based on the present observations, the correlation between increased CD133 expression and early stage tumors, larger tumor size and poorly differentiated NSCLC tumors may be to be due to the self-renewal properties of aberrant CSCs. This implicated the importance of CD133-positive cells in the initiation of NSCLC. The reduced levels of CD133 in the later stages of NSCLC may be explained by the hypothesis that cells expressing CD133 undergo asymmetric division, generating a diverse phenotype and therefore resulting in reduced CD133 positivity. However, further studies are required to confirm this.

Previous studies have shown that the expression of CSC antigens was associated with a poor prognosis (20–22,25,26). However, the current observations, which are consistent with the results of other studies (17–19), demonstrated that while the expression of CD133 in the surgically resected specimens was involved in NSCLC carcinogenesis, CD133 alone may not be used as an independent biomarker in the prediction of the prognosis of NSCLC. The origin of these discrepancies remains unclear; however, specific NSCLC samples may be the reason for variability between the results. Notably, the present specimens were obtained from patients with all stages of NSCLC and contained various histological types (adenocarcinoma and squamous carcinoma).

Studies in human embryonic stem cells indicated that OCT4A and the homeobox protein NANOG were two key transcription factors that cooperatively maintained pluripotency (27,28). The present results indicated that OCT4A was significantly associated with the clinical stage and differentiation of NSCLC. Consistent with this, Chen et al(29) observed that knockdown of the OCT4A gene in CD133-positive stem-like lung cancer cells significantly diminished the ability of tumor invasion and colony formation, and increased apoptotic activities. The aforementioned observations indicate that the expression of OCT4A was involved in maintaining the stem cell-like properties of lung cancer cells. Whether the combination of the two CSC markers, OCT4 and CD133, may enhance the predictive validity of patient progression and survival remains to be elucidated.

In conclusion, the results of the present study show that CD133-positive NSCLC cells exhibit clonogenic, tumorigenic and drug-resistant properties. The elevated expression of CD133 was associated with early stage tumors, larger tumor size and poor differentiation of NSCLC, indicating that highly expressed CD133 is involved in the carcinogenesis of NSCLC. However, expression of CD133 in CSCs is not considered to be an independent factor in the prediction of the prognosis of patients with NSCLC. Further studies are required to determine the association between CD133 expression and overall survival in NSCLC patients, with or without other CSC-associated genes.

Acknowledgements

This study was supported by grants from the Zhejiang Provincial Natural Science Foundation of China (grant no. Y2101395) and the Medical Bureau of Zhoushan (grant no. 2010G02).

References

1 

Spira A and Ettinger DS: Multidisciplinary management of lung cancer. N Engl J Med. 350:379–392. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Reya T, Morrison SJ, Clarke MF and Weissman IL: Stem cells, cancer, and cancer stem cells. Nature. 414:105–111. 2001. View Article : Google Scholar : PubMed/NCBI

3 

van Klaveren RJ, van’t Westeinde SC, de Hoop BJ and Hoogsteden HC: Stem cells and the natural history of lung cancer: implications for lung cancer screening. Clin Cancer Res. 15:2215–2218. 2009.PubMed/NCBI

4 

Sullivan JP, Minna JD and Shay JW: Evidence for self-renewing lung cancer stem cells and their implications in tumor initiation, progression, and targeted therapy. Cancer Metastasis Rev. 29:61–72. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Kim CF, Jackson EL, Woolfenden AE, Lawrence S, Babar I, Vogel S, Crowley D, Bronson RT and Jacks T: Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell. 121:823–835. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Rosen JM and Jordan CT: The increasing complexity of the cancer stem cell paradigm. Science. 324:1670–1613. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, Henkelman RM, Cusimano MD and Dirks PB: Identification of human brain tumour initiating cells. Nature. 432:396–401. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Zhao P, Lu Y, Jiang X and Li X: Clinicopathological significance and prognostic value of CD133 expression in triple-negative breast carcinoma. Cancer Sci. 102:1107–1111. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Yin S, Li J, Hu C, Chen X, Yao M, Yan M, Jiang G, Ge C, Xie H, Wan D, Yang S, Zheng S and Gu J: CD133 positive hepatocellular carcinoma cells possess high capacity for tumorigenicity. Int J Cancer. 120:1444–1450. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Hermann PC, Huber SL, Herrler T, Aicher A, Ellwart JW, Guba M, Bruns CJ and Heeschen C: Distinct populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer. Cell Stem Cell. 1:313–323. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Ricci-Vitiani L, Lombardi DG, Pilozzi E, Biffoni M, Todaro M, Peschle C and De Maria R: Identification and expansion of human colon-cancer-initiating cells. Nature. 445:111–115. 2007. View Article : Google Scholar : PubMed/NCBI

12 

Giangreco A, Groot KR and Janes SM: Lung cancer and lung stem cells: strange bedfellows? Am J Respir Crit Care Med. 175:547–553. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Eramo A, Lotti F, Sette G, Pilozzi E, Biffoni M, Di Virgilio A, Conticello C, Ruco L, Peschle C and De Maria R: Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Differ. 15:504–514. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Meng X, Li M, Wang X, Wang Y and Ma D: Both CD133+ and CD133− subpopulations of A549 and H446 cells contain cancer-initiating cells. Cancer Sci. 100:1040–1046. 2009.

15 

Qiu X, Wang Z, Li Y, Miao Y, Ren Y and Luan Y: Characterization of sphere-forming cells with stem-like properties from the small cell lung cancer cell line H446. Cancer Lett. 323:161–170. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Akunuru S, James Zhai Q and Zheng Y: Non-small cell lung cancer stem/progenitor cells are enriched in multiple distinct phenotypic subpopulations and exhibit plasticity. Cell Death Dis. 3:e3522012. View Article : Google Scholar : PubMed/NCBI

17 

Salnikov AV, Gladkich J, Moldenhauer G, Volm M, Mattern J and Herr I: CD133 is indicative for a resistance phenotype but does not represent a prognostic marker for survival of non-small cell lung cancer patients. Int J Cancer. 126:950–958. 2010.PubMed/NCBI

18 

Herpel E, Jensen K, Muley T, Warth A, Schnabel PA, Meister M, Herth FJ, Dienemann H, Thomas M and Gottschling S: The cancer stem cell antigens CD133, BCRP1/ABCG2 and CD117/c-KIT are not associated with prognosis in resected early-stage non-small cell lung cancer. Anticancer Res. 31:4491–4500. 2011.PubMed/NCBI

19 

Shien K, Toyooka S, Ichimura K, Soh J, Furukawa M, Maki Y, Muraoka T, Tanaka N, Ueno T, Asano H, et al: Prognostic impact of cancer stem cell-related markers in non-small cell lung cancer patients treated with induction chemoradiotherapy. Lung Cancer. 77:162–167. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Cortes-Dericks L, Galetta D, Spaggiari L, Schmid RA and Karoubi G: High expression of octamer-binding transcription factor 4A, prominin-1 and aldehyde dehydrogenase strongly indicates involvement in the initiation of lung adenocarcinoma resulting in shorter disease-free intervals. Eur J Cardiothorac Surg. 41:e173–e181. 2012. View Article : Google Scholar

21 

Woo T, Okudela K, Mitsui H, Yazawa T, Ogawa N, Tajiri M, Yamamoto T, Rino Y, Kitamura H and Masuda M: Prognostic value of CD133 expression in stage I lung adenocarcinomas. Int J Clin Exp Pathol. 4:32–42. 2010.PubMed/NCBI

22 

Li F, Zeng H and Ying K: The combination of stem cell markers CD133 and ABCG2 predicts relapse in stage I non-small cell lung carcinomas. Med Oncol. 28:1458–1462. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Ettinger DS, Akerley W, Borghaei H, et al: Non-Small Cell Lung Cancer, Version 2.2013. J Natl Compr Canc Netw. 11:645–653. 2013.PubMed/NCBI

24 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method. Methods. 25:402–408. 2001.

25 

Zeppernick F, Ahmadi R, Campos B, Dictus C, Helmke BM, Becker N, Lichter P, Unterberg A, Radlwimmer B and Herold-Mende CC: Stem cell marker CD133 affects clinical outcome in glioma patients. Clin Cancer Res. 14:123–129. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Sullivan JP, Spinola M, Dodge M, Raso MG, Behrens C, Gao B, Schuster K, Shao C, Larsen JE, Sullivan LA, et al: Aldehyde dehydrogenase activity selects for lung adenocarcinoma stem cells dependent on notch signaling. Cancer Res. 70:9937–9948. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, Chambers I, Schöler H and Smith A: Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4. Cell. 95:379–391. 1998. View Article : Google Scholar : PubMed/NCBI

28 

Chiou SH, Yu CC, Huang CY, Lin SC, Liu CJ, Tsai TH, Chou SH, Chien CS, Ku HH and Lo JF: Positive correlations of Oct-4 and Nanog in oral cancer stem-like cells and high-grade oral squamous cell carcinoma. Clin Cancer Res. 14:4085–4095. 2008. View Article : Google Scholar : PubMed/NCBI

29 

Chen YC, Hsu HS, Chen YW, Tsai TH, How CK, Wang CY, Hung SC, Chang YL, Tsai ML, Lee YY, Ku HH and Chiou SH: Oct-4 expression maintained cancer stem-like properties in lung cancer-derived CD133-positive cells. PLoS One. 3:e26372008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Le H, Zeng F, Xu L, Liu X and Huang Y: The role of CD133 expression in the carcinogenesis and prognosis of patients with lung cancer. Mol Med Rep 8: 1511-1518, 2013.
APA
Le, H., Zeng, F., Xu, L., Liu, X., & Huang, Y. (2013). The role of CD133 expression in the carcinogenesis and prognosis of patients with lung cancer. Molecular Medicine Reports, 8, 1511-1518. https://doi.org/10.3892/mmr.2013.1667
MLA
Le, H., Zeng, F., Xu, L., Liu, X., Huang, Y."The role of CD133 expression in the carcinogenesis and prognosis of patients with lung cancer". Molecular Medicine Reports 8.5 (2013): 1511-1518.
Chicago
Le, H., Zeng, F., Xu, L., Liu, X., Huang, Y."The role of CD133 expression in the carcinogenesis and prognosis of patients with lung cancer". Molecular Medicine Reports 8, no. 5 (2013): 1511-1518. https://doi.org/10.3892/mmr.2013.1667
Copy and paste a formatted citation
x
Spandidos Publications style
Le H, Zeng F, Xu L, Liu X and Huang Y: The role of CD133 expression in the carcinogenesis and prognosis of patients with lung cancer. Mol Med Rep 8: 1511-1518, 2013.
APA
Le, H., Zeng, F., Xu, L., Liu, X., & Huang, Y. (2013). The role of CD133 expression in the carcinogenesis and prognosis of patients with lung cancer. Molecular Medicine Reports, 8, 1511-1518. https://doi.org/10.3892/mmr.2013.1667
MLA
Le, H., Zeng, F., Xu, L., Liu, X., Huang, Y."The role of CD133 expression in the carcinogenesis and prognosis of patients with lung cancer". Molecular Medicine Reports 8.5 (2013): 1511-1518.
Chicago
Le, H., Zeng, F., Xu, L., Liu, X., Huang, Y."The role of CD133 expression in the carcinogenesis and prognosis of patients with lung cancer". Molecular Medicine Reports 8, no. 5 (2013): 1511-1518. https://doi.org/10.3892/mmr.2013.1667
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team