Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
2014-April Volume 9 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-April Volume 9 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of TCIRG1 and CLCN7 gene mutations in a patient with autosomal recessive osteopetrosis

  • Authors:
    • Tingting Yu
    • Yongguo Yu
    • Jian Wang
    • Lei Yin
    • Yunfang Zhou
    • Daming Ying
    • Rongkui Huang
    • Huijin Chen
    • Shenmei Wu
    • Yongnian Shen
    • Qihua Fu
    • Fuxiang Chen
  • View Affiliations / Copyright

    Affiliations: Department of Laboratory Medicine, Shanghai Ninth People's Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200011, P.R. China, Institute of Pediatric Translational Medicine, Shanghai Children's Medical Center, Shanghai Jiaotong University School of Medicine, Shanghai 200127, P.R. China, Department of Laboratory Medicine, Shanghai Children's Medical Center, Shanghai Jiaotong University School of Medicine, Shanghai 200127, P.R. China, Department of Internal Medicine, Shanghai Children's Medical Center, Shanghai Jiaotong University School of Medicine, Shanghai 200127, P.R. China, Rare Diseases Outpatient Clinic, Shanghai Children's Medical Center, Shanghai Jiaotong University School of Medicine, Shanghai 200127, P.R. China
  • Pages: 1191-1196
    |
    Published online on: February 17, 2014
       https://doi.org/10.3892/mmr.2014.1955
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Osteopetrosis is a heritable bone disorder that exhibits highly clinical and genetical heterogeneity, and is caused by defective osteoclastic resorption. The three main forms are the autosomal recessive severe (ARO), the intermediate autosomal and the autosomal dominant benign osteopetrosis forms. In the present study, the clinical, biochemical and radiological manifestations were described in a patient with osteopetrosis. Sequence analysis identified the compound heterozygous mutations, c.909C>A (p.Tyr303X) and c.2008C>T (p.Arg670X), in TCIRG1, and a heterozygous splicing mutation, c.1798‑1G>T, in the chloride channel 7 gene (CLCN7). Two aberrant forms of the CLCN7 transcripts, c.1798_1883 (exon 20) deletion predicted to cause p.Leu601GlyfsX13, and the c.1798_1821 deletion, the first 24 bp of the exon 20, predicted to cause p.Gly600_Gln607del, were detected by further analysis of the splicing patterns in the leukocytes. The patient's asymptomatic mother carried the TCIRG1 c.909C>A (p.Tyr303X) and CLCN7 c.1798‑1G>T mutations, while the asymptomatic father carried the TCIRG1 c.2008C>T (p.Arg670X) mutation only. The patient was finally diagnosed with ARO on the basis of clinical and biochemical parameters, radiological changes and genetic defects. To the best of our knowledge, this is the first reported case of a patient with osteopetrosis who carries TCIRG1 and CLCN7 mutations. In addition, among the three mutations, TCIRG1 c.909C>A and CLCN7 c.1798‑1G>T were novel mutations.

Introduction

Bone development and homeostasis is achieved by a strict balance between bone formation by osteoblasts and resorption by osteoclasts. Defective bone resorption results in osteopetrosis, an inherited disorder encompassing a clinical and genetical heterogenous group of conditions. Three main forms are classified on the basis of inheritance patterns, age of onset and severity. These are the autosomal recessive severe (ARO; MIM 259700), intermediate autosomal (IAO) and autosomal dominant benign osteopetrosis (ADO) forms (1). All these forms are characterized by an increased bone density, which may result in various phenotypical features, including fractures, osteomyelitis, deformity, dental abnormalities, bone marrow impairment and cranial nerve compression. (2). Osteopetrosis is a rare condition, and the estimated incidence of ARO is 1 in 250,000 births, while that of ADO is 1 in 20,000 births (3,4).

Mutations in at least 10 genes have been identified as causative in various types of osteopetrosis cases in humans (2). However, the majority of the osteopetrosis cases reported thus far are caused by defects in gene products involved in the regulation of the intra- and extracellular pH of osteoclasts. Two significant molecules that are involved in the acidification machinery are the proton pump, vacuolar ATPase (V-ATPase), and the chloride-specific ion channel, CLCN7. Defects in TCIRG1, which encodes the V-ATPase a3 subunit, have been reported to be responsible for ARO in >50% of patients (5–7). However, mutations in the CLCN7 gene give rise to the complete spectrum of osteopetrosis, underlying ~15% of all ARO cases, almost all known cases of IAO and 75% of ADO type II cases (ADO II; Albers-Schönberg disease; MIM 166600) (8–10).

Materials and methods

Patient

A 21-month-old male was admitted to Shanghai Children’s Medical Center (Shanghai, China) due to persistent anemia and a lack of dentition. The patient was full-term at birth, with a normal weight and length, and a subsequent weight and length of 12 kg (50th percentile) and 84.8 cm (between 25th and 50th percentile), respectively, at 21 months. A prominent forehead, enlarged abdomen with moderate hepatosplenomegaly and visual disturbance were noted during the physical examination. Laboratory tests revealed that the patient had moderate anemia, elevated levels of serum alkaline phosphatase, parathyroid hormone, creatine kinase and MB isoenzyme, and decreased serum Ca2+ levels. The levels of phosphonium, 1,25-dihydroxy vitamin D3, lactate dehydrogenase, thyroid hormone and thyroid stimulating hormone were within the normal ranges. Imaging examinations consisting of computerized tomography (CT) scans (LightSpeed 16 Slice CT; GE Healthcare, Fairfield, CT, USA) and X-rays (AMX IV Plus Portable X-Ray, GE Healthcare) revealed a general increase of bone density involving the skull, vertebrae and limbs (Fig. 1). The diagnosis of osteopetrosis was based on the skeletal radiographs along with the clinical and laboratory data. The patient was scheduled to undergo a bone marrow transplant; however, died of an infection following intensive chemotherapy. The patient was the only son of a non-related couple. No clinical abnormalities were noted in the parents, and further biochemical and radiological examinations of the patient’s mother also appeared normal.

Figure 1

Imaging examinations consisting of a CT scan and X-rays of the proband. A generalized increase in bone density involving (A) the skull, (B) the limbs and (C) the vertebrae was observed. CT, computed tomography.

Molecular analysis

Ethylenediaminetetraacetic acid-peripheral blood samples were obtained from the patient, his parents and 100 healthy individuals. Genomic DNA was isolated from the peripheral blood leukocytes using the QIAmp DNA Blood kit (Qiagen, Hilden, Germany). All the exons and exon-intron boundaries of the TCIRG1 and CLCN7 genes from the patient’s genomic DNA were amplified by PCR, and the primer sequences are listed in Tables I and II. The PCR products were analyzed by direct DNA sequencing on an ABI 3700 sequencer (Applied Biosystems, Foster City, CA, USA). Only genomic fragments containing the mutations identified in the patient were amplified and sequenced for the parents and the normal controls. Several polymorphisms, including single-nucleotide polymorphisms (SNPs), rs12926089, rs12926669 and rs960467, and the variable number tandem repeat (VNTR) in intron 8 of CLCN7 were also analyzed in the pedigree.

Table I

PCR primers used for amplification of TCIRG1 gene.

Table I

PCR primers used for amplification of TCIRG1 gene.

PrimerSequence (5′ to 3′)Size (bp)
EXON1 F TCAACCTCTCCCAGACTTCC320
EXON1 R CTGAGCTGCATTCACGGAG
EXON2 F TCAGTGAGTGAAGGTGCACAG319
EXON2 R GTTCAAATGGGGCCAGG
EXON3 F TCCACACCTTTCTGGAGGAG266
EXON3 R TTTCAGATCAAACTTGGCCC
EXON4+EXON5 F GAGTTTGGGGCAGCAGG564
EXON4+EXON5 R CACTGGACAAGGAGTCGGAG
EXON6+EXON7 F GAGGCCTCCTGCCTTCC561
EXON6+EXON7 R GGCCAGAAGGACACAGCTAC
EXON8 F CCTATCGTGACTCCTCCCC262
EXON8 R ACCTCCTGCACCCACCTC
EXON9 F GAGGTGGGTGCAGGAGG372
EXON9 R CTGGAAGTGAGGCAGAAACG
EXON10 F ATCTCCAGCTGGGCCTG301
EXON10 R CCTCAGGCTCACACCCAC
EXON11+EXON12 F AAGTGATGGGTTCTTGACTGC570
EXON11+EXON12 R AGGAATGCATCACTGCGG
EXON13 F AGTCTGGCTGGAGGTGAGG291
EXON13 R CACACAGGAGTGCTCAGCG
EXON14+EXON15 F GGGAAAACAGGGTGGTGAG597
EXON14+EXON15 R GATCTTGCAGCTCCCAGTG
EXON16+EXON17 F CGTGACTGCTGTGACTCAGG604
EXON16+EXON17 R GCAGAACTCGATGGTGTGG
EXON18 F GCCTGGATGATGAAGAGGAG307
EXON18 R AACTGAGGCCCAGAGAGAAG
EXON19+EXON20 F AAGTGGGACTGTCCAAGGAG613
EXON19+EXON20 R TCCCAGATCCTACACCATGC

[i] PCR, polymerase chain reaction; F, forward; R, reverse.

Table II

PCR primers used for amplification of CLCN7 gene.

Table II

PCR primers used for amplification of CLCN7 gene.

PrimerSequence (5′ to 3′)Size (bp)
Promoter F (rs960467) GGAAGCCTCCACTCCGACCC475
Promoter R (rs960467) GTGATGAGCGACGGCGACCA
Exon1 F CGTTGCAGGTCACATGGTC470
Exon1 R GCCTCCGAAGACTCCAGAC
Exon2 F CGGATCAGTTCTGCTTCCAG511
Exon2 R CATGCTGTCACTGCTGTCCT
Exon3+Exon4 F TGCTGGGATTGTAGGTGTCA629
Exon3+Exon4 R GAGCAGCCTTCTTGGTTACG
Exon5+Exon6 F CACACTGGGCCCTTCATAAT810
Exon5+Exon6 R TCTGCTCCTCCTGAGGTTGT
Exon7 F GTGTCTGCTGCTCTCCTCAG243
Exon7 R GCTCCTGAACCAGCAAAGAG
Exon8+Exon9 F (VNTR in intron 8) GCTTGGCTGCTGTTTAGCTC764
Exon8+Exon9 R (VNTR in intron 8) AAGCCCATCTCCCTGAGTG
Exon10+Exon11 F GTGCTGACCCTGCTGTCTCT797
Exon10+Exon11 R AGGACCAAGGCCTGACAGA
Exon12 F CACTGGCAAGTCCAGAGAGG559
Exon12 R GCAGCAACTGTGTGACATCC
Exon13 F CCAGTGTGTTTCTCCCCTGT443
Exon13 R CTGTGGTTTTTGCCAACAGA
Exon14 F ATTGCTCTGCTGGACACCTT551
Exon14 R GCAGGGCCTCACTTCCTAC
Exon15 F (rs12926089, rs12926669) CAGTGTCCTCCATCAGGGACT401
Exon15 R (rs12926089, rs12926669) CTCTGAGATCTGGGTGGACAG
Exon16 F CTCCCAACGTGTGCTCTCTC306
Exon16 R ATCCTCCTGCCTTGGTCTCT
Exon17 F TGAGAACAGGGAGCCTTCTG432
Exon17 R AGGTGCGACACTTTTGTCCT
Exon18+Exon19 F GGTGACTGTGCCCTCTGC730
Exon18+Exon19 R CCCAGAAACCCTGAGCCTAC
Exon20+Exon21 F CTGTGAGCCTCCAAACAGC717
Exon20+Exon21 R GTCCACACAGCCCTCCAT
Exon22+Exon23 F AGGCTGGTGTGAGCAGGTAG638
Exon22+Exon23 R GCCCCTTGACTTCAGCTCTA
Exon24+Exon25 F CTGAAGTCAAGGGGCTGAGG806
Exon24+Exon25 R AGACCACTGCCCACAACAG

[i] PCR, polymerase chain reaction; CLCN7, chloride channel 7 gene; F, forward; R, reverse.

Reverse transcription-polymerase chain reaction (RT-PCR)

The total RNA of the patient and the parents was isolated from their peripheral leukocytes using the QIAmp RNA Blood kit (Qiagen). The first-strand cDNA was synthesized using random primers, oligo primers and PrimeScript Reverse Transcriptase (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China). The synthesized products were amplified with primer P1, 5′-TACGGGCTCACGGTGTCTG-3′, which is located in exon 17, and primer P2, 5′-GGTAGGCGTCTCGGAAGTC-3′, which is located in exon 23 of CLCN7. The PCR products were further amplified using semi-nested oligonucleotide primers P1 and P3, 5′-TTGTGCTTTAGGAGAACGA-3′, which is located in exon 22 of CLCN7. The products were cloned into the pMD 18-T vector (Takara Biotechnology (Dalian) Co., Ltd.) and 30 clones were selected and sequenced.

Ethics statement

The study was approved by the Ethics Committee of Shanghai Children’s Medical Center, Shanghai Jiao Tong University School of Medicine. Written informed consent was obtained from the parents and the 100 healthy individuals prior to blood sampling and DNA analysis.

Results

Molecular analysis of the TCIRG1 and CLCN7 genes

Direct genomic DNA sequencing of the patient revealed compound heterozygous mutations, c.909C>A (p.Tyr303X) and c.2008C>T (p.Arg670X), in TCIRG1 and a heterozygous splice site mutation, c.1798-1G>T, in the CLCN7 gene (Fig. 2). The patient’s mother carried the TCIRG1 c.909C>A (p.Tyr303X) and CLCN7 c.1798-1G>T mutations, while the patient’s father carried the TCIRG1 c.2008C>T (p.Arg670X) mutation. The CLCN7 c.1798-1G>T variation was not detected in the 100 healthy individuals. In addition, several SNPs, including rs12926089, rs12926669 and rs960467, and the intron 8 VNTR in the CLCN7 gene were investigated. However, no differences in the investigated polymorphisms were identified between the patient and his mother (Table III).

Figure 2

Molecular analysis of the TCIRG1 and CLCN7 genes. A genetic analysis showing (A) the TCIRG1 c.909C>A (p.Y303X), (C) TCIRG1 c.2008C>T (p.R670X) and (E) CLCN7 c.1798-1G>T mutations in the proband and (B, D, and F) the corresponding sequencing of the normal control. The arrow indicates the site of heterozygous mutation.

Table III

Molecular analysis of the TCIRG1 and CLCN7 genes.

Table III

Molecular analysis of the TCIRG1 and CLCN7 genes.

SubjectNucleotide change of TCIRG1aNucleotide change of CLCN7bGenotypesc

rs960467rs12926089rs12926669Intron 8 VNTR
Patientc.909C>Ac.1798-1G>TG/AGTThree repeat units
c.2008C>T
Motherc.909C>Ac.1798-1G>TG/AGTThree repeat units
Fatherc.2008C>T-dGGTThree repeat units

a Accession number of the TCIRG1 cDNA, NM_006019.3. The numbering used starts with nucleotide +1 for the A of the ATG-translation initiation codon.

b Accession number of the CLCN7 cDNA, NM_001287.5. The numbering used starts with nucleotide +1 for the A of the ATG-translation initiation codon.

c rs960467, CLCN7 NG_007567.1:g.4907G>A; rs12926089, CLCN7 NM_001287.5:c. 1252G>A, NP_001278.1:p.Val418Met; rs12926669, CLCN7 NM_001287.5:c.1245T>C, NP_001278.1:p.Ile415=; Intron 8 VNTR, a 50-bp VNTR residing in intron 8 of CLCN7.

d No nucleotide change. VNTR, variable number tandem repeat.

Transcription experiment of the CLCN7 c.1798-1G>T mutation

RT-PCR performed on the RNA extracted from the father enabled the detection of one band of the expected 560 bp (from exon 17 to exon 22 of the CLCN7 gene; Fig. 3A, lane 1). However, the same amplification conducted using RNA extracted from the mother and the patient, resulted in two different PCR fragments (Fig. 3A; lanes 2 and 3). In the patient, cloning and sequencing revealed the presence of the normal transcript corresponding to the 560-bp fragment and of two aberrant forms of the transcripts. The majority of transcripts resulted from the entire deletion of exon 20 (c.1798_1883del; Fig. 3B), which was detected in 11 out of the 30 clones selected. The minority of transcripts resulted from the deletion of the first 24 bp of exon 20 (c.1798_1821del; Fig. 3C), which was detected in three out of the 30 clones picked. Similar deletions were also identified in the patient’s mother, while no aberrant transcripts were detected in the father.

Figure 3

Transcription experiment of the CLCN7 c.1798-1G>T mutation (A) agarose-gel (1%) electrophoresis of CLCN7 RT-PCR products. RT-PCR performed on the RNA extracted from the father allowed detection of one band of the expected 560 bp, from exon 17 to exon 22 of the CLCN7 gene (lane 1). The same amplification conducted using RNA extracted from the mother (lane 2) and the proband (lane 3) resulted in two different PCR fragments. M, 2,000-bp DNA ladder. Cloning and sequencing of the pMD 18-T vectors containing CLCN7 RT-PCR products revealed two aberrant splicing forms, including (B) c.1798_1883 (exon 20) deletion and (C) c.1798_1821, the first 24 bp of the exon 20 deletion. The horizontal solid and dashed arrows indicate the areas of the two different exons. RT-PCR, reverse transcription polymerase chain reaction.

Discussion

In the present study, the case of a patient with osteopetrosis was investigated. Molecular analysis of the patient revealed compound heterozygous nonsense mutations in TCIRG1 and a heterozygous splice site mutation in CLCN7. Among the three mutations, TCIRG1 c.909C>A (p.Tyr303X) and CLCN7 c.1798-1G>T were novel mutations. CLCN7 encodes the chloride-specific ion channel, CLCN7, which cooperates with the gene product of TCIRG1, the a3 subunit of V-ATPase (11). CLCN7 is essential for efficient proton pumping due to its role in neutralizing current, and is involved in the secretion of acid into the resorption lacuna, a specialized acidic compartment for mineral bone matrix degradation (12,13). To the best of our knowledge, this is the first reported case of osteopetrosis that carried the TCIRG1 and CLCN7 gene mutations.

In order to determine the effect of CLCN7 c.1798-1G>T, a transcription experiment was subsequently conducted. The mutations that affect mRNA splicing have been revealed to account for a number of hereditary disorders (14–16). Three splicing mutations of CLCN7 have been reported in osteopetrosis thus far, including c.916+57A>T, c.1617+6_1617+7delTG and c.2250+1G>A (9,17). The splicing mutation, CLCN7 c.1798-1G>A, reported in the present study has eradicated the invariant G of the AG splice acceptor site of intron 19. The most common consequence of splicing mutations is exon skipping, followed by the activation of aberrant splice sites and intron retention (18,19). In the present study, two aberrant patterns of transcripts were detected with different proportions. The most common transcript was the skipping of exon 20 (c.1798_1883), which was predicted to cause a frameshift and a premature termination codon (p.Leu601GlyfsX13). The least common was the activation of aberrant splice sites (c.1798_1821 deletion), which was predicted to cause the in-frame deletion of eight amino acid residues (p.Gly600_Gln607del). Notably, aberrant splicing is predicted to affect only the C-terminal cytosolic portion of the ClCN7 protein and not its transmembrane portion.

Mutations in the CLCN7 gene have been demonstrated to be involved in the pathogenesis of various forms of osteopetrosis since 2001 (12). Heterozygous mutations in CLCN7 may lead to ADO II, which is associated with less severe clinical features and late onset. To further investigate whether the CLCN7 c.1798-1G>T mutation was pathogenic, a thorough biochemical and radiological examination was performed on the 29-year-old mother who harbored the heterozygous CLCN7 splicing and TCIRG1 p.Tyr303X mutations. However, no abnormal clinical, biochemical or radiological manifestations were observed. Previous studies have reported several polymorphisms in the CLCN7 gene, including rs960467, rs12926089 (Val418Met) and rs12926669, and a VNTR in intron 8, which were associated with the penetrance of the ADO phenotype and the variation in bone mineral density (20–22). To determine whether these polymorphisms were associated with the different severities of the osteopetrosis in the pedigree, the SNPs and the VNTR were genotyped. No difference was revealed between the patient and the mother. The CLCN7 c.1798-1G>T mutation appeared to be a non-pathogenic variation in the present case, although it was associated with aberrant splicing. However, completely excluding the pathogenicity of CLCN7 c.1798-1G>T is inappropriate due to the incomplete penetrance of ADO II. The factors involved in the phenotypic variability remain unknown.

According to previous studies, the compound heterozygous nonsense mutations of TCIRG1 were enough to cause malignant osteopetrosis (5–7). Biallelic mutations in the TCIRG1 gene are well known to be responsible for ARO, and the absence of symptoms in the mother together with the characteristic ARO phenotype (early postnatal onset, generalized increased bone density and severe clinical course, including anemia, hypodontia and visual impairment) of the patient may indicate a diagnosis of classic TCIRG1-dependent ARO in this case.

In conclusion, a patient with ARO was studied. The compound heterozygous mutations, c.909C>A (p.Tyr303X) and c.2008C>T (p.Arg670X), in TCIRG1 and a heterozygous splicing mutation, c.1798-1G>T, in the CLCN7 gene were identified in the patient. Among the three mutations, TCIRG1 c.909C>A (p.Tyr303X) and CLCN7 c.1798-1G>T were novel mutations. This study highlights that TCIRG1 and CLCN7 should be sequenced in order to gain a comprehensive molecular diagnosis of osteopetrosis.

Acknowledgements

The authors would like to thank all the members of the family for their participation in this study. This study was supported by the National Natural Science Foundation of China (grant nos. 81000207 and 81000346) and a foundation grant from Shanghai Science and Technology Commission for major issues (grant no. 11dz1950300).

References

1 

Tolar J, Teitelbaum SL and Orchard PJ: Osteopetrosis. N Engl J Med. 351:2839–2849. 2004. View Article : Google Scholar

2 

Stark Z and Savarirayan R: Osteopetrosis. Orphanet J Rare Dis. 4:52009. View Article : Google Scholar

3 

Loría-Cortés R, Quesada-Calvo E and Cordero-Chaverri C: Osteopetrosis in children: a report of 26 cases. J Pediatr. 91:43–47. 1977.

4 

Bollerslev J and Andersen PE Jr: Radiological, biochemical and hereditary evidence of two types of autosomal dominant osteopetrosis. Bone. 9:7–13. 1988. View Article : Google Scholar : PubMed/NCBI

5 

Frattini A, Orchard PJ, Sobacchi C, Giliani S, Abinun M, Mattsson JP, Keeling DJ, Andersson AK, Wallbrandt P, Zecca L, et al: Defects in TCIRG1 subunit of the vacuolar proton pump are responsible for a subset of human autosomal recessive osteopetrosis. Nat Genet. 25:343–346. 2000. View Article : Google Scholar : PubMed/NCBI

6 

Kornak U, Schulz A, Friedrich W, Uhlhaas S, Kremens B, Voit T, Hasan C, Bode U, Jentsch TJ and Kubisch C: Mutations in the a3 subunit of the vacuolar H(+)-ATPase cause infantile malignant osteopetrosis. Hum Mol Genet. 9:2059–2063. 2000.

7 

Sobacchi C, Frattini A, Orchard P, Porras O, Tezcan I, Andolina M, Babul-Hirji R, Baric I, Canham N, Chitayat D, et al: The mutational spectrum of human malignant autosomal recessive osteopetrosis. Hum Mol Genet. 10:1767–1773. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Cleiren E, Bénichou O, Van Hul E, Gram J, Bollerslev J, Singer FR, Beaverson K, Aledo A, Whyte MP, Yoneyama T, et al: Albers-Schönberg disease (autosomal dominant osteopetrosis, type II) results from mutations in the ClCN7 chloride channel gene. Hum Mol Genet. 10:2861–2867. 2001.

9 

Frattini A, Pangrazio A, Susani L, Sobacchi C, Mirolo M, Abinun M, Andolina M, Flanagan A, Horwitz EM, Mihci E, et al: Chloride channel ClCN7 mutations are responsible for severe recessive, dominant, and intermediate osteopetrosis. J Bone Miner Res. 18:1740–1747. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Del Fattore A, Peruzzi B, Rucci N, Recchia I, Cappariello A, Longo M, Fortunati D, Ballanti P, Iacobini M, Luciani M, et al: Clinical, genetic, and cellular analysis of 49 osteopetrotic patients: implications for diagnosis and treatment. J Med Genet. 43:315–325. 2006.

11 

Supanchart C and Kornak U: Ion channels and transporters in osteoclasts. Arch Biochem Biophys. 473:161–165. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Kornak U, Kasper D, Bösl MR, Kaiser E, Schweizer M, Schulz A, Friedrich W, Delling G and Jentsch TJ: Loss of the ClC-7 chloride channel leads to osteopetrosis in mice and man. Cell. 104:205–215. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Väänänen HK, Zhao H, Mulari M and Halleen JM: The cell biology of osteoclast function. J Cell Sci. 113:377–381. 2000.

14 

Ars E, Serra E, García J, Kruyer H, Gaona A, Lázaro C and Estivill X: Mutations affecting mRNA splicing are the most common molecular defects in patients with neurofibromatosis type 1. Hum Mol Genet. 9:237–247. 2000. View Article : Google Scholar : PubMed/NCBI

15 

López-Bigas N, Audit B, Ouzounis C, Parra G and Guigó R: Are splicing mutations the most frequent cause of hereditary disease? FEBS Lett. 579:1900–1903. 2005.PubMed/NCBI

16 

Yu T, Wang X, Ding Q, Fu Q, Dai J, Lu Y, Xi X and Wang H: Using a minigene approach to characterize a novel splice site mutation in human F7 gene causing inherited factor VII deficiency in a Chinese pedigree. Haemophilia. 15:1262–1266. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Pangrazio A, Pusch M, Caldana E, Frattini A, Lanino E, Tamhankar PM, Phadke S, Lopez AG, Orchard P, Mihci E, et al: Molecular and clinical heterogeneity in CLCN7 dependent osteopetrosis report of 20 novel mutations. Hum Mutat. 31:E1071–E1080. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Krawczak M, Reiss J and Cooper DN: The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum Genet. 90:41–54. 1992. View Article : Google Scholar

19 

Nakai K and Sakamoto H: Construction of a novel database containing aberrant splicing mutations of mammalian genes. Gene. 141:171–177. 1994. View Article : Google Scholar : PubMed/NCBI

20 

Chu K, Koller DL, Snyder R, Fishburn T, Lai D, Waguespack SG, Foroud T and Econs MJ: Analysis of variation in expression of autosomal dominant osteopetrosis type 2: searching for modifier genes. Bone. 37:655–661. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Pettersson U, Albagha OM, Mirolo M, Taranta A, Frattini A, McGuigan FE, Vezzoni P, Teti A, van Hul W, Reid DM, Villa A and Ralston SH: Polymorphisms of the CLCN7 gene are associated with BMD in women. J Bone Miner Res. 20:1960–1967. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Kornak U, Ostertag A, Branger S, Benichou O and de Vernejoul MC: Polymorphisms in the CLCN7 gene modulate bone density in postmenopausal women and in patients with autosomal dominant osteopetrosis type II. J Clin Endocrinol Metab. 91:995–1000. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yu T, Yu Y, Wang J, Yin L, Zhou Y, Ying D, Huang R, Chen H, Wu S, Shen Y, Shen Y, et al: Identification of TCIRG1 and CLCN7 gene mutations in a patient with autosomal recessive osteopetrosis. Mol Med Rep 9: 1191-1196, 2014.
APA
Yu, T., Yu, Y., Wang, J., Yin, L., Zhou, Y., Ying, D. ... Chen, F. (2014). Identification of TCIRG1 and CLCN7 gene mutations in a patient with autosomal recessive osteopetrosis. Molecular Medicine Reports, 9, 1191-1196. https://doi.org/10.3892/mmr.2014.1955
MLA
Yu, T., Yu, Y., Wang, J., Yin, L., Zhou, Y., Ying, D., Huang, R., Chen, H., Wu, S., Shen, Y., Fu, Q., Chen, F."Identification of TCIRG1 and CLCN7 gene mutations in a patient with autosomal recessive osteopetrosis". Molecular Medicine Reports 9.4 (2014): 1191-1196.
Chicago
Yu, T., Yu, Y., Wang, J., Yin, L., Zhou, Y., Ying, D., Huang, R., Chen, H., Wu, S., Shen, Y., Fu, Q., Chen, F."Identification of TCIRG1 and CLCN7 gene mutations in a patient with autosomal recessive osteopetrosis". Molecular Medicine Reports 9, no. 4 (2014): 1191-1196. https://doi.org/10.3892/mmr.2014.1955
Copy and paste a formatted citation
x
Spandidos Publications style
Yu T, Yu Y, Wang J, Yin L, Zhou Y, Ying D, Huang R, Chen H, Wu S, Shen Y, Shen Y, et al: Identification of TCIRG1 and CLCN7 gene mutations in a patient with autosomal recessive osteopetrosis. Mol Med Rep 9: 1191-1196, 2014.
APA
Yu, T., Yu, Y., Wang, J., Yin, L., Zhou, Y., Ying, D. ... Chen, F. (2014). Identification of TCIRG1 and CLCN7 gene mutations in a patient with autosomal recessive osteopetrosis. Molecular Medicine Reports, 9, 1191-1196. https://doi.org/10.3892/mmr.2014.1955
MLA
Yu, T., Yu, Y., Wang, J., Yin, L., Zhou, Y., Ying, D., Huang, R., Chen, H., Wu, S., Shen, Y., Fu, Q., Chen, F."Identification of TCIRG1 and CLCN7 gene mutations in a patient with autosomal recessive osteopetrosis". Molecular Medicine Reports 9.4 (2014): 1191-1196.
Chicago
Yu, T., Yu, Y., Wang, J., Yin, L., Zhou, Y., Ying, D., Huang, R., Chen, H., Wu, S., Shen, Y., Fu, Q., Chen, F."Identification of TCIRG1 and CLCN7 gene mutations in a patient with autosomal recessive osteopetrosis". Molecular Medicine Reports 9, no. 4 (2014): 1191-1196. https://doi.org/10.3892/mmr.2014.1955
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team