Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
November-2017 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma

  • Authors:
    • Xue Chen
    • Yang Zhang
    • Fang Wang
    • Mangju Wang
    • Wen Teng
    • Yuehui Lin
    • Xiangping Han
    • Fangyuan Jin
    • Yuanli Xu
    • Panxiang Cao
    • Jiancheng Fang
    • Ping Zhu
    • Chunrong Tong
    • Hongxing Liu
  • View Affiliations / Copyright

    Affiliations: Department of Pathology and Laboratory Medicine Division, Hebei Yanda Lu Daopei Hospital, Sanhe, Hebei 065201, P.R. China, Department of Hematology, Peking University First Hospital, Beijing 100034, P.R. China
    Copyright: © Chen et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 5249-5256
    |
    Published online on: September 6, 2017
       https://doi.org/10.3892/ol.2017.6898
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Certain patients with lymphoma may harbor mutations in perforin 1 (PRF1), unc‑13 homolog D (UNC13D), syntaxin 11 (STX11), STXBP2 (syntaxin binding protein 2) or SH2 domain containing 1A (SH2D1A), which causes functional defects of cytotoxic lymphocytes. Data regarding the association between genetic defects and the development of lymphoma in Chinese patients are limited to date. In the present study, 90 patients with lymphoma were analyzed for UNC13D, PRF1, STXBP2, STX11, SH2D1A and X‑linked inhibitor of apoptosis. Mutations were observed in 24 (26.67%) patients; 16 patients exhibited mutations in UNC13D, 7 exhibited PRF1 mutations, and 1 exhibited monoallelic mutation in STX11. UNC13D c.2588G>A/p.G863D mutation was detected in 9 patients (10.00%) and in 4/210 controls (1.90%). This mutation was predicted to be pathogenic and it predominantly existed in the Chinese population. These findings suggest that impaired cytotoxic machinery may represent a predisposing factor for the development of lymphoma. Furthermore, these data describe a distinct mutation spectrum in Chinese patients with lymphoma, whereby UNC13D is the most frequently mutated gene. In addition, these findings suggest UNC13D c.2588G>A mutation is a founder mutation in Chinese patients.

Introduction

The perforin-dependent granule-mediated cytolysis of cytotoxic lymphocytes (CLs), including natural killer cells and cytotoxic T lymphocytes, is the key machinery in the clearance of viral, and intracellular bacterial infections, as well as in the prevention of tumor development (1,2). The proteins encoded by perforin 1 (PRF1), unc-13 homolog D (UNC13D), syntaxin 11 (STX11), and STXBP2 (syntaxin binding protein 2) serve an essential role in this pathway. Mutations in these genes lead to function defects of CLs and are causative of familial hemophagocytic lymphohistiocytosis type 2 (FHL2), FHL3, FHL4, and FHL5 (3–6). The clinical manifestation of X-linked lymphoproliferative disease (XLP), which is caused by mutations in SH2 domain containing 1A (SH2D1A) (7) or X-linked inhibitor of apoptosis (XIAP) (8) genes, resembles hemophagocytic lymphohistiocytosis. Furthermore, XLP2 due to XIAP deficiency has been suggested to be classified as X-linked FHL (9).

A proportion of patients with lymphoma have been reported to harbor mutations in PRF1, UNC13D, STX11, STXBP2 or SH2D1A genes (10–14), indicating that genetic defective function of CLs may increase susceptibility to lymphomagenesis. The aim of the present study was to investigate the association between mutations in genes involved in the cytotoxic function of CLs and the development of lymphoma in Chinese patients.

Patients and methods

Cases and controls

In the present study, 68 and 34 patients with lymphoma were admitted to Hebei Yanda Lu Daopei Hospital (Sanhe, China) and Peking University First Hospital (Beijing, China), respectively, between August 2013 and August 2015; 12/102 were excluded due to poor DNA quality. A total of 90 (61 from Hebei Yanda Lu Daopei Hospital and 29 from Peking University First Hospital) unrelated patients with lymphoma (48 males and 42 females; age range, 3–60 years) were recruited in the present study; 39 were diagnosed with Hodgkin lymphoma and 51 were diagnosed with non-Hodgkin lymphoma according to the World Health Organization classification (15). Healthy donors of Han nationality (n=210) at the Hebei Yanda Lu Daopei Hospital served as controls. The present study was approved by the Ethics Committees of Hebei Yanda Lu Daopei Hospital and Peking University First Hospital. Written informed consent was obtained from all patients and healthy donors or their parents in accordance with the 1964 Helsinki declaration, and its later amendments or comparable ethical standards.

Amplification and sequence analysis

Genomic DNA was isolated from peripheral blood and bone marrow using the TIANamp Blood DNA kit (item no. DP318; Tiangen Biotech Co., Ltd., Beijing, China) or from nails using the TIANamp FFPE DNA kit (item no. DP331; Tiangen Biotech Co., Ltd.) according to the manufacturer's protocol. Referenced coding sequences of the PRF1 (NM_005041.4), UNC13D (NM_199242.2), STXBP2 (NM_003764.3), STX11 (NM_006949.2), SH2D1A (NM_002351.3), and XIAP (NM_001167.2) were obtained from the National Center for Biotechnology Information Consensus CDS database (https://www.ncbi.nlm.nih.gov/projects/CCDS/CcdsBrowse.cgi). Primers were designed to amplify the coding exons and the flanking intron sequences by polymerase chain reaction (PCR). The sequences of primers are presented in Table I. The PCR system comprised of 1 µl genomic DNA (10 ng/µl), 1 ml forward primer (20 pmol/µl), 1 ml reverse primer (20 pmol/µl), 10 µl Phusion Flash High-Fidelity PCR Master mix (Thermo Fisher Scientific, Inc., Waltham, MA, USA), and 7 µl distilled water in a total volume of 20 µl. Reaction conditions were 10 sec at 98°C followed by 38 cycles of 10 sec at 98°C, 10 sec at 68°C, 15 sec at 72°C, and then 1 min at 72°C. The amplified PCR products were purified with ExoSAP-IT (USB Co., Cleveland, OH, USA) and followed by cycle sequencing PCR using a BigDye Terminator Sequencing Kit version 3.1 (Thermo Fisher Scientific, Inc.). Fluorescent labeled products were separated using an ABI 3500xL Genetic Analyzer (Thermo Fisher Scientific, Inc.). Variations were analyzed using Variant Reporter software (version 1.1; Thermo Fisher Scientific, Inc.). Genetic polymorphism information from the Single Nucleotide Polymorphism database (dbSNP; http://www.ncbi.nlm.nih.gov/snp/), 1000 Genomes Project (http://www.ncbi.nlm.nih.gov/variation/tools/1000genomes/) and the Exome Aggregation Consortium (ExAC; http://exac.broadinstitute.org/) were referenced to obtain the frequencies of variants in large populations. Variants with minor allele frequencies >1% in the 1000 Genomes Project and/or ExAC were regarded as SNPs rather than mutations.

Table I.

Primers used for amplification of the coding exons and the flanking intron sequences of perforin 1, unc-13 homolog D, syntaxin binding protein 2, syntaxin 11, SH2 domain containing 1A and X-linked inhibitor of apoptosis.

Table I.

Primers used for amplification of the coding exons and the flanking intron sequences of perforin 1, unc-13 homolog D, syntaxin binding protein 2, syntaxin 11, SH2 domain containing 1A and X-linked inhibitor of apoptosis.

Name of the primerSequence 5′ to 3′
UNC13D-1FS TGTAAAACGACGGCCAGTACTCGAGGAAGTGGGGTGAGA
UNC13D-1RS CAGGAAACAGCTATGACCGAGACCACAGTGCTCCCCAA
UNC13D-2FS TGTAAAACGACGGCCAGTCCTGTCCATCTGAGCCTGCTC
UNC13D-2RS CAGGAAACAGCTATGACCGGGACCCCACCCCATGCTCA
UNC13D-3FS TGTAAAACGACGGCCAGTGGTCAGGGAGCTTGAGGTAACC
UNC13D-3RS CAGGAAACAGCTATGACCAGACCCTGCTACCCAGGAAAG
UNC13D-4FS TGTAAAACGACGGCCAGTGCTCTGGGCTGTGGTCACTTAC
UNC13D-4RS CAGGAAACAGCTATGACCAGGCTCAGCTTTGTGAGGACAC
UNC13D-5FS TGTAAAACGACGGCCAGTCCTGGGGTCCACCTCCTGTC
UNC13D-5RS CAGGAAACAGCTATGACCGCTGGTGGCTCAGGGGTTC
UNC13D-6FS TGTAAAACGACGGCCAGTGGCAATTTCCTCCTCCCTGTC
UNC13D-6RS CAGGAAACAGCTATGACCCAGTGGTGCCAGTCTGTCGAC
UNC13D-7FS TGTAAAACGACGGCCAGTGCAGGGTCCTGGTACAGATGTG
UNC13D-7RS CAGGAAACAGCTATGACCGCCATGGAGAAGAGGTGGATC
UNC13D-8FS TGTAAAACGACGGCCAGTGGTGTATGCCACTGGGTGACA
UNC13D-8RS CAGGAAACAGCTATGACCAGGTCCAGGCAGAACCCAAG
UNC13D-9FS TGTAAAACGACGGCCAGTCTGGTGATGGTAGCTGCTCTATGA
UNC13D-9RS CAGGAAACAGCTATGACCCAGCTGGGACAGAGATGCAGA
UNC13D-10FS TGTAAAACGACGGCCAGTCCAGGCAGCCAACATGGTAA
UNC13D-10RS CAGGAAACAGCTATGACCAGAGAACATGCTTTGCCTGGTC
UNC13D-11FS TGTAAAACGACGGCCAGTCTACAAACTGCTCTCACAGAACGG
UNC13D-11RS CAGGAAACAGCTATGACCGGCTGCTACACCCCTCAGAAC
UNC13D-12FS TGTAAAACGACGGCCAGTGAGCGTCTTTGCTTCCTCCTC
UNC13D-12RS CAGGAAACAGCTATGACCGCTCACTGTCAAGGGTAACATGTC
UNC13D-13FS TGTAAAACGACGGCCAGTTCCCATGACCCAATACTTTCCA
UNC13D-13RS CAGGAAACAGCTATGACCGCACTGACCCCTCCTGGTAAC
UNC13D-14FS TGTAAAACGACGGCCAGTACTCATCCGGAAGTACTTCTGCA
UNC13D-14RS CAGGAAACAGCTATGACCCACATCCAGCTGCAAACTCTTG
UNC13D-15FS TGTAAAACGACGGCCAGTAGCTGGCTTTGCAGTCCAAA
UNC13D-15RS CAGGAAACAGCTATGACCTCAGACCGTTGCTGGTATCAAA
UNC13D-16FS TGTAAAACGACGGCCAGTGGAGAAGGGCCTGGATCTCA
UNC13D-16RS CAGGAAACAGCTATGACCCCTACAGGAAAGCCCTTGCA
STXBP2-1FS TGTAAAACGACGGCCAGTGACTCAACTTCCTGGGCCTG
STXBP2-1RS CAGGAAACAGCTATGACCGGAGCAGCTGAGGCCGGAACT
STXBP2-2FS TGTAAAACGACGGCCAGTTGGTGGGACCAGAGAACCAG
STXBP2-2RS CAGGAAACAGCTATGACCCACGCTCAGGTCCCATCTCA
STXBP2-3FS TGTAAAACGACGGCCAGTTGGTGGTCCCTAAGTGGGTTTC
STXBP2-3RS CAGGAAACAGCTATGACCGCATACACACACGCTCACTCATG
STXBP2-4FS TGTAAAACGACGGCCAGTCCATGTGGGTGCGACACTAGT
STXBP2-4RS CAGGAAACAGCTATGACCGCCCAGCCTCAGTGTCTGTTT
STXBP2-5FS TGTAAAACGACGGCCAGTCAACCCTGGTGCTTCTGTCC
STXBP2-5RS CAGGAAACAGCTATGACCGGAACCAGGTCAGTGGCAAG
STXBP2-6FS TGTAAAACGACGGCCAGTCTTGCCACTGACCTGGTTCC
STXBP2-6RS CAGGAAACAGCTATGACCGAACGCAGACAGAGCATGGG
STXBP2-7FS TGTAAAACGACGGCCAGTCCGCAGTACCAGAAGGAGCT
STXBP2-7RS CAGGAAACAGCTATGACCCCCTCCACCTCTCCACAAGC
STXBP2-8FS TGTAAAACGACGGCCAGTCCTTGAGAGACCTGGTGCTGAG
STXBP2-8RS CAGGAAACAGCTATGACCGTGGGAGACGCTGGCAAATG
STXBP2-9FS TGTAAAACGACGGCCAGTCCAGGTTTCCCACTCTTGCTC
STXBP2-9RS CAGGAAACAGCTATGACCGACCAGACCCGAAACACTGC
STXBP2-10FS TGTAAAACGACGGCCAGTTCTGTGACCAGCCTCCTTCC
STXBP2-10RS CAGGAAACAGCTATGACCCCTCAGCAGAGCAGATCGGT
STXBP2-11FS TGTAAAACGACGGCCAGTCAGAGGCAGGAGGTGGAGATG
STXBP2-11RS CAGGAAACAGCTATGACCTGTCCCTGTCCCTCAGCAAA
STXBP2-12FS TGTAAAACGACGGCCAGTAAGTGGGAGGTGCTCATTGG
STXBP2-12RS CAGGAAACAGCTATGACCAAGTCCAAGTTCTTAACCTCCATGA
STX11-1FS TGTAAAACGACGGCCAGTTTGCCCACACCGAGGAATAC
STX11-1RS CAGGAAACAGCTATGACCCTCGCTCAGCTCCTTCATGG
STX11-2FS TGTAAAACGACGGCCAGTGCGAGGTCATCCACTGCAAG
STX11-2RS CAGGAAACAGCTATGACCCTTTGGTGCGTCCTTCCCAG
PRF1-1FS TGTAAAACGACGGCCAGTCCTTCCATGTGCCCTGATAA
PRF1-1RS CAGGAAACAGCTATGACCGCCAGGATTGCAGTTTCTTC
PRF1-2FS TGTAAAACGACGGCCAGTCCCTGGGTTCCAGTCCTAGT
PRF1-2RS CAGGAAACAGCTATGACCGCCCTGTCCGTCAGGTACT
PRF1-3FS TGTAAAACGACGGCCAGTCTGCACGTGCTGCTGGACA
PRF1-3RS CAGGAAACAGCTATGACCCTGGTCCTTTCCAAGCTCAC
SH2D1A-1FS TGTAAAACGACGGCCAGTGCTCGATCGAACCAAGCTAC
SH2D1A-1RS CAGGAAACAGCTATGACCGGATTGAGGCGAAAGTGTGT
SH2D1A-2FS TGTAAAACGACGGCCAGTTCTCACTGGAAACTGTGGTTGG
SH2D1A-2RS CAGGAAACAGCTATGACCGCTAAACAGGACTGGGACCAAA
SH2D1A-3FS TGTAAAACGACGGCCAGTACTTCTCTTAGCATCCCTAGCAC
SH2D1A-3RS CAGGAAACAGCTATGACCCTGGCTACATCTACTTTCTCACTGC
SH2D1A-4FS TGTAAAACGACGGCCAGTAGGCTCAGGCATAAACTGAC
SH2D1A-4RS CAGGAAACAGCTATGACCGCATTTGTAGCTCACCGAACTGT
XIAP-1FS TGTAAAACGACGGCCAGTAGAATGTTTCTTAGCGGTCGTGTAG
XIAP-1RS CAGGAAACAGCTATGACCGTTCCTCGGGTATATGGTGTCTGATAT
XIAP-2FS TGTAAAACGACGGCCAGTTCTGGGAAGCAGAGATCATTTTG
XIAP-2RS CAGGAAACAGCTATGACCCCTGGCATACTTGGGAAGCT
XIAP-3FS TGTAAAACGACGGCCAGTAGTGTGTATTTCTTCCTCAAAGGATAA
XIAP-3RS CAGGAAACAGCTATGACCCTCCCACTGCATGCTATCCAA
XIAP-4FS TGTAAAACGACGGCCAGTCAGTGGGATAGGGAATTGGGTA
XIAP-4RS CAGGAAACAGCTATGACCCACTGCCCAGCTAGCTCTCAT
XIAP-5FS TGTAAAACGACGGCCAGTGGTGGCCAAGGCATCAGTAA
XIAP-5RS CAGGAAACAGCTATGACCGCGCATCACAAGATCAGGAGT
XIAP-6FS TGTAAAACGACGGCCAGTACCCGCTCTGCTACAGAAAC
XIAP-6RS CAGGAAACAGCTATGACCCACATCTGGCCCTTTCTTGCTTT
XIAP-7FSa TGTAAAACGACGGCCAGTCAGATGCCACGGGTGAGTCA
XIAP-7RSa CAGGAAACAGCTATGACCATTGCCAACTAAAACACTGCCAT

[i] The segment in bold font is a nonspecific tail named S1, which is added to the specific forward primers. The segment in italic font is a nonspecific tail named S2, which is added to the specific reverse primers. S1 and S2 are also used as sequencing primers.

Confirmation of germline derivation of mutations

For patients determined to harbor mutations, the same mutation was detected in the DNA isolated from peripheral blood of their parents. In the absence of one or both parents, the detection of the same mutation in DNA extracted from nails of the patients could be of value. This was performed in order to confirm that the mutations were germline-derived.

In silico analysis

Two bioinformatics tools were used to predict whether an amino acid substitution was benign or deleterious: Sorting Intolerant From Tolerant (SIFT; http://sift.jcvi.org/) predicts whether an amino acid substitution affects protein function based on the degree of conservation of amino acid residues in multiple sequence alignments derived from closely associated sequences (16); and Polymorphism Phenotyping version 2.0 (PolyPhen-2; http://genetics.bwh.harvard.edu/pph/) predicts the possible impact of an amino acid substitution on the structure and function of a human protein using straightforward physical and comparative analyses (17). Iterative Threading ASSEmbly Refinement (I-TASSER; http://zhanglab.ccmb.med.umich.edu/I-TASSER/) was also used to predict and simulate the influence of the variants in protein tertiary structures.

Statistical analysis

Comparisons of mutant frequencies as well as genotype distributions between patients with lymphoma and controls were performed using the Chi-square test with SPSS software (version 20.0; IBM Corp., Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Analysis of the gene mutations

A total of 18 different mutations were identified in 24 unrelated patients (26.67%) (Fig. 1). A total of 16 patients (17.78%) carried mutations in UNC13D, including 12 with monoallelic mutations, 1 with homozygous mutation and 3 with compound heterozygous mutations. Seven patients (7.78%) had PRF1 mutations, including 4 with monoallelic mutations, 1 with homozygous mutation and 2 with compound heterozygous mutations. One patient (1.11%) was detected to carry STX11 monoallelic mutation (Table II). All mutations were confirmed to be germline-derived.

Figure 1.

Sanger sequencing chromatogram of the genomic polymerase chain reaction product of the 24 patients with lymphoma. Red arrows indicate the mutations detected. UNC13D, unc-13 homolog D; PRF1, perforin; STX11, syntaxin 11; P, patient number.

Table II.

Gene mutations observed in 24 patients with lymphoma.

Table II.

Gene mutations observed in 24 patients with lymphoma.

Author, namePatientSexAge at diagnosis, yearsDiagnosisGeneMutationGenotype(Refs.)
P1M7HLUNC13D c.514C>A/p.R172SHet.Novel observation
Tong et al, 2011;P2M26HLUNC13D c.1232G>A/p.R411QHet.(12,20)
Zhang et al, 2014
Sieni et al, 2011P3M32HLUNC13D c.1241G>T/p.R414LHet.(21)
P4M17B-NHLUNC13D c.1894G>T/p.D632YHet.Novel observation
P5M3HLUNC13D c.2495C>T/p.A832VHet.Novel observation
Tong et al, 2011;P6F35B-NHLUNC13Dc.2553+5C>GHet.(12,22)
Zhang et al, 2011
Tong et al, 2011P7F54NK/T-NHLUNC13D c.2588G>A/p.G863DHet.(12)
Tong et al, 2011P8M46NHLUNC13D c.2588G>A/p.G863DHet.(12)
Tong et al, 2011P9F12NHLUNC13D c.2588G>A/p.G863DHet.(12)
Tong et al, 2011P10M40B-NHLUNC13D c.2588G>A/p.G863DHet.(12)
Tong et al, 2011P11F30NK/T-NHLUNC13D c.2588G>A/p.G863DHet.(12)
Tong et al, 2011P12M28NHLUNC13D c.2588G>A/p.G863DHet.(12)
Tong et al, 2011P13M9HLUNC13D c.2588G>A/p.G863DHom.(12)
Tong et al, 2011;P14M38HLUNC13D c.2240G>A/p.S747NHet.(12,22)
Zhang et al, 2011
Tong et al, 2011;P14M38HLUNC13Dc.2553+5C>GHet.(12,22)
Zhang et al, 2011
Tong et al, 2011P15M29HLUNC13D c.2588G>A/p.G863DHet.(12)
UNC13D c.3067C>T/p.R1023CHet.Novel observation
Tong et al, 2011P16M12HLUNC13D c.2588G>A/p.G863DHet.(12)
UNC13D c.518C>T/p.T173MHet.Novel observation
UNC13D c.977C>T/p.S326LHet.Novel observation
Zhang et al, 2011P17F36HLPRF1 c.10C>T/p.R4CHet.(22)
Zhang et al, 2011P18M10HLPRF1 c.98G>A/p.R33HHet.(22)
Lu et al, 2009P19F34NK/T-NHLPRF1 c.503G>A/p.S168NHom.(23)
Trizzino et al, 2008P20M29B-NHLPRF1 c.1066C>T/p.R356WHet.(24)
Trizzino et al, 2008P21F19HLPRF1 c.1349C>T/p.T450MHet.(24)
Zhang et al, 2011P22M24NK/T-NHLPRF1 c.10C>T/p.R4CHet.(22)
Zhang et al, 2011P22M24NK/T-NHLPRF1 c.98G>A/p.R33HHet.(22)
Tong et al, 2011P23M56NK/T-NHLPRF1 c.65delC/p.P22Rfs*29Het.(12)
Lu et al, 2009P23M56NK/T-NHLPRF1 c.503G>A/p.S168NHet.(23)
Tong et al, 2011P24M15HLSTX11 c.842T>G/p.F281CHet.(12)

[i] Het., heterozygous; Hom., homozygous; UNC13D, unc-13 homolog D; PRF1, perforin; STX11, syntaxin 11; HL, Hodgkin lymphoma; NHL, non-Hodgkin lymphoma; NK/T, natural killer/T-cell; B, B-cell; M, male; F, female.

Sixty unrelated healthy donors were sequenced for these 6 genes with the same methods and 5 of them (8.33%) were detected to harbor mutations. All 5 individuals were heterozygous for UNC13D mutations (c.680G>A/p.R227H; c.3134C>T/p.T1045M; c.3229_3235del/p.Arg1077SerfsTer48; c.2553+5C>G; c.602A>G/p.H201R).

The Chi-square test revealed that the difference between mutant frequencies of patients with lymphoma and healthy donors was of statistical significance (P=0.005). Individuals carrying mutations of these genes were more likely to develop lymphoma compared with those without mutations [odds ratio (OR), 4.000; 95% confidence interval (CI), 1.431–11.180].

Statistical analysis of UNC13D c.2588G>A mutation

UNC13D c.2588G>A/p.G863D was the most frequent mutation identified in the current study, which was identified in 9 patients (10.00%), including 1 homozygous and 8 heterozygous. This genetic variation was annotated as rs140184929 in dbSNP without frequency data. Data in the 1000 Genomes Project demonstrated that the c.2588A allele existed predominantly in the Chinese (0.83%), and rarely in the Japanese (0.48%) and Bengali (0.58%) populations. Other populations did not carry this variant (Table III). Data in ExAC also demonstrated that the allelic frequency of c.2588A was increased in East Asian populations (37/8,638; 0.43%) compared with that in South Asian populations (5/16,504; 0.03%). Only one individual out of 32,962 Europeans was heterozygous for c.2588G>A variant. This variation was not observed among 14,554 individuals analyzed from other populations. Considering the high allele frequency of this mutation in the present patient cohort and the distinctly different allele frequencies among diverse populations, genotyping of the c.2588 allele was performed in 210 unrelated healthy donors of Chinese Han nationality (Table III). Heterozygous c.2588G>A was observed in 4 of them. Combined with data in the 1000 Genomes Project (a total of 301 Chinese), a control cohort of 511 individuals, 9 of whom harbored c.2588A allele in a heterozygous state was obtained. The Chi-square test revealed that the allele frequency of c.2588A in patients was significantly increased compared with that in the control group (P<0.001; OR, 6.621; 95% CI, 2.652–16.532), suggesting an association between the c.2588G>A mutation, and the risk of developing lymphoma.

Table III.

Allele frequencies of PRF1 c.272T and UNC13D c.2588A among different populations.

Table III.

Allele frequencies of PRF1 c.272T and UNC13D c.2588A among different populations.

Allele frequencies

Populations/samplesPRF1 c.272TUNC13D c.2588A
1000G-all populations0.0132 (66/5008)0.0014 (7/5008)
1000G-CHB0 (0/206)0.0097 (2/206)
1000G-CHS0.0048 (1/210)0.0048 (1/210)
1000G-CDX0 (0/186)0.0108 (2/186)
1000G-JPT0 (0/208)0.0048 (1/208)
1000G-BEB0 (0/172)0.0058 (1/172)
1000G-FIN0.0253 (5/198)0 (0/198)
1000G-GBR0.0385 (7/182)0 (0/182)
1000G-TSI0.0561 (12/214)0 (0/214)
Patients in the present study0 (0/180)0.0556 (10/180)
Controls in the present study0 (0/120)0.0095 (4/420)

[i] CHB, Han Chinese in Beijing China; CHS, Southern Han Chinese; CDX, Chinese Dai in Xishuangbanna, China; JPT, Japanese in Tokyo Japanese; BEB, Bengali from Bangladesh; FIN, Finnish in Finland; GBR, British in England and Scotland; TSI, Toscani in Italia; UNC13D, unc-13 homolog D; PRF1, perforin; 1000G, 1000 Genomes Project.

In silico analysis of UNC13D c.2588G>A mutation

The UNC13D c.2588G>A/p.G863D mutation resulted in a substitution of the nonpolar and hydrophobic glycine (often involved in the formation of the turn structure) in the Munc13 homology domain 2 of protein UNC13D by the polar, and neutral aspartic acid (often involved in the formation of the coil structure). Multiple sequence alignment demonstrated that the amino acid at this position was highly conserved in available vertebrate species (Fig. 2A) and the alteration is predicted to be possibly damaging using PolyPhen-2 (Fig. 2B), and deleterious with SIFT in silico analysis. I-TASSER also demonstrated significant differences in the 3D structures of the wild-type and mutant-type proteins (Fig. 2).

Figure 2.

In silico analysis of UNC13D c.2588G>A mutation. (A) Multiple sequence alignment demonstrated that the amino acid at this position was highly conserved in available vertebrate species (Uniprot ID, species). (B) Polymorphism Phenotyping version 2.0 predicted that this mutation is possibly damaging with a score of 0.994. (C) The 3D structure of the wild-type UNC13-4 MHD2. The molecular in yellow is the 863th amino acid of the UNC13-4 protein. (D) 3D structure of the mutant-type UNC13-4 MHD2. The molecular in yellow is the 863th amino acid of the UNC13-4 protein. MHD2, Munc13 homology domain 2; UNC13D, unc-13 homolog D.

Discussion

In 2005, Clementi et al (10) first reported that 8/29 (27.6%) unrelated Italian patients with lymphoma carried PRF1 mutations and 5 of them carried PRF1 c.272C>T/p.A91V heterozygous mutation. In 2014, Ciambotti et al (11) observed mutations in 23/84 (27.4%) Italian patients with anaplastic large cell lymphoma following genotype analysis of PRF1, UNC13D and SH2D1A. Twenty-one patients (25%) carried PRF1 mutations and the other 2 patients had mutations of UNC13D. PRF1 c.272C>T/p.A91V mutation was also the most common mutant genotype (11/84).

In the present study 6 genes, which are all involved in cytotoxic function of natural killer cells and cytotoxic T lymphocytes, were identified in 90 Chinese patients with lymphoma. The results demonstrated the association of germline defective mutations and development of lymphoma. The majority of mutations detected in the current study were heterozygous missense mutations, which were consistent with previous reports (10,11). This may explain why these patients developed lymphoma later in life rather than outbreak fatal FHL during infancy. Such monoallelic mutations may contribute to the pathogenesis of the disease, but are not sufficient to initiate the disease phenotype alone. Additional unidentified genetic defects, or possibly even environmental factors, may contribute to the development of lymphoma (10). What was different from reports in Europe was that the most common mutant gene in the present study was UNC13D while PRF1 was less frequently involved, indicating a distinct mutation spectrum in Chinese patients with lymphoma.

Notably, no hot spot region or predominant pathogenic mutation in UNC13D had been previously identified (18). In the current study; however, 9/16 UNC13D mutation carriers exhibited c.2588G>A/p.G863D mutation, including 1 homozygous and 8 heterozygous. This single amino acid substitution occurred in an evolutionary conserved position and was predicted to be pathogenic using PolyPhen-2, SIFT, and I-TASSER. Furthermore, statistical analysis revealed that this mutation was significantly associated with the risk of developing lymphoma. In addition, none of our patient harbored the PRF1 c.272C>T/p.A91V mutation, which was most frequently reported in European populations (10,11). In the present consecutive cohort of >500 patients with diagnosed or suspected FHL, the PRF1 c.272C>T mutation was not identified (data not shown).

Data in the 1000 Genomes Project demonstrated that the allele frequency of PRF1 c272T was significantly higher in European population compared with that in Chinese and Japanese, supporting the concept of a Mediterranean origin of the mutation (11). However, the UNC13D c.2588A allele existed predominantly in Chinese, less in Japanese and Bengali, and was not identified in any other populations listed in this database (Table III). In regards to Korea, where UNC13D is the predominant causative gene in Korean patients with FHL, c.2588G>A was not reported (19). Collectively, the data obtained from the present study and the databases suggest that UNC13D c.2588G>A/p.G863D is a founder mutation of Chinese patients.

In conclusion, the current study provides a relatively comprehensive mutation spectrum of defective cytotoxicity associated genes in Chinese patients with lymphoma. Monoallelic germline mutations were identified to be most frequent in the present cohort, suggesting that partially impaired cytotoxic machinery may represent a predisposing factor for the development of lymphoma. In addition, UNC13D was identified as the predominant causative gene, while PRF1 was less frequently involved. Furthermore, UNC13D c.2588G>A/p.G863D, which is not reported in other populations, is a founder mutation in Chinese patients.

References

1 

Vesely MD, Kershaw MH, Schreiber RD and Smyth MJ: Natural innate and adaptive immunity to cancer. Annu Rev Immunol. 29:235–271. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Tang YM and Xu XJ: Advances in hemophagocytic lymphohistiocytosis: Pathogenesis, early diagnosis/differential diagnosis and treatment. ScientificWorldJournal. 11:697–708. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Stepp SE, Dufourcq-Lagelouse R, Le Deist F, Bhawan S, Certain S, Mathew PA, Henter JI, Bennett M, Fischer A, de Saint Basile G and Kumar V: Perforin gene defects in familial hemophagocytic lymphohistiocytosis. Science. 286:1957–1959. 1999. View Article : Google Scholar : PubMed/NCBI

4 

Feldmann J, Callebaut I, Raposo G, Certain S, Bacq D, Dumont C, Lambert N, Ouachée-Chardin M, Chedeville G, Tamary H, et al: Munc13-4 is essential for cytolytic granules fusion and is mutated in a form of familial hemophagocytic lymphohistiocytosis (FHL3). Cell. 115:461–473. 2003. View Article : Google Scholar : PubMed/NCBI

5 

zur Stadt U, Schmidt S, Kasper B, Beutel K, Diler AS, Henter JI, Kabisch H, Schneppenheim R, Nürnberg P, Janka G and Hennies HC: Linkage of familial hemophagocytic lymphohistiocytosis (FHL) type-4 to chromosome 6q24 and identification of mutations in syntaxin 11. Hum Mol Genet. 14:827–834. 2005. View Article : Google Scholar : PubMed/NCBI

6 

zur Stadt U, Rohr J, Seifert W, Koch F, Grieve S, Pagel J, Strauss J, Kasper B, Nürnberg G, Becker C, et al: Familial hemophagocytic lymphohistiocytosis type 5 (FHL-5) is caused by mutations in Munc18-2 and impaired binding to syntaxin 11. Am J Hum Genet. 85:482–492. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Nichols KE, Harkin DP, Levitz S, Krainer M, Kolquist KA, Genovese C, Bernard A, Ferguson M, Zuo L, Snyder E, et al: Inactivating mutations in an SH2 domain-encoding gene in X-linked lymphoproliferative syndrome. Proc Natl Acad Sci USA. 95:13765–13770. 1998. View Article : Google Scholar : PubMed/NCBI

8 

Rigaud S, Fondanèche MC, Lambert N, Pasquier B, Mateo V, Soulas P, Galicier L, Le Deist F, Rieux-Laucat F, Revy P, et al: XIAP deficiency in humans causes an X-linked lymphoproliferative syndrome. Nature. 444:110–114. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Marsh RA, Madden L, Kitchen BJ, Mody R, McClimon B, Jordan MB, Bleesing JJ, Zhang K and Filipovich AH: XIAP deficiency: A unique primary immunodeficiency best classified as X-linked familial hemophagocytic lymphohistiocytosis and not as X-linked lymphoproliferative disease. Blood. 116:1079–1082. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Clementi R, Locatelli F, Dupré L, Garaventa A, Emmi L, Bregni M, Cefalo G, Moretta A, Danesino C, Comis M, et al: A proportion of patients with lymphoma may harbor mutations of the perforin gene. Blood. 105:4424–4428. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Ciambotti B, Mussolin L, d'Amore ES, Pillon M, Sieni E, Coniglio ML, Ros MD, Cetica V, Aricò M and Rosolen A: Monoallelic mutations of the perforin gene may represent a predisposing factor to childhood anaplastic large cell lymphoma. J Pediatr Hematol Oncol. 36:e359–e365. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Tong CR, Liu HX, Xie JJ, Wang F, Cai P, Wang H, Zhu J, Teng W, Zhang X, Yang JF, et al: The study of gene mutations in unknown refractory viral infection and primary hemophagocytic lymphohistiocytosis. Zhonghua Nei Ke Za Zhi. 50:280–283. 2011.(In Chinese). PubMed/NCBI

13 

Machaczka M, Klimkowska M, Chiang SC, Meeths M, Müller ML, Gustafsson B, Henter JI and Bryceson YT: Development of classical Hodgkin's lymphoma in an adult with biallelic STXBP2 mutations. Haematologica. 98:760–764. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Sandlund JT, Shurtleff SA, Onciu M, Horwitz E, Leung W, Howard V, Rencher R and Conley ME: Frequent mutations in SH2D1A (XLP) in males presenting with high-grade mature B-cell neoplasms. Pediatr Blood Cancer. 60:E85–E87. 2013. View Article : Google Scholar : PubMed/NCBI

15 

World Health Organization (WHO): WHO classification of tumours of haematopoietic and lymphoid tissues. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J and Vardiman JW: 2. 4th. International Agency for Research on cancer (IARC) Press; Lyon: 2008

16 

Ng PC and Henikoff S: SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res. 31:3812–3814. 2003. View Article : Google Scholar : PubMed/NCBI

17 

Ramensky V, Bork P and Sunyaev S: Human non-synonymous SNPs: Server and survey. Nucleic Acids Res. 30:3894–3900. 2002. View Article : Google Scholar : PubMed/NCBI

18 

Zur SU, Beutel K, Kolberg S, Schneppenheim R, Kabisch H, Janka G and Hennies HC: Mutation spectrum in children with primary hemophagocytic lymphohistiocytosis: Molecular and functional analyses of PRF1, UNC13D, STX11, and RAB27A. Hum Mutat. 27:62–68. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Yoon HS, Kim HJ, Yoo KH, Sung KW, Koo HH, Kang HJ, Shin HY, Ahn HS, Kim JY, Lim YT, et al: UNC13D is the predominant causative gene with recurrent splicing mutations in Korean patients with familial hemophagocytic lymphohistiocytosis. Haematologica. 95:622–626. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Zhang K, Chandrakasan S, Chapman H, Valencia CA, Husami A, Kissell D, Johnson JA and Filipovich AH: Synergistic defects of different molecules in the cytotoxic pathway lead to clinical familial hemophagocytic lymphohistiocytosis. Blood. 124:1331–1334. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Sieni E, Cetica V, Santoro A, Beutel K, Mastrodicasa E, Meeths M, Ciambotti B, Brugnolo F, zur Stadt U, Pende D, et al: Genotype-phenotype study of familial haemophagocytic lymphohistiocytosis type 3. J Med Genet. 48:343–352. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Zhang K, Jordan MB, Marsh RA, Johnson JA, Kissell D, Meller J, Villanueva J, Risma KA, Wei Q, Klein PS and Filipovich AH: Hypomorphic mutations in PRF1, MUNC13-4, and STXBP2 are associated with adult-onset familial HLH. Blood. 118:5794–5798. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Lu G, Xie ZD, Shen KL, Ye LJ, Wu RH, Liu CY, Jin YK and Yang S: Mutations in the perforin gene in children with hemophagocytic lymphohistiocytosis. Chin Med J (Engl). 122:2851–2855. 2009.PubMed/NCBI

24 

Trizzino A, zur Stadt U, Ueda I, Risma K, Janka G, Ishii E, Beutel K, Sumegi J, Cannella S, Pende D, et al: Genotype-phenotype study of familial haemophagocytic lymphohistiocytosis due to perforin mutations. J Med Genet. 45:15–21. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen X, Zhang Y, Wang F, Wang M, Teng W, Lin Y, Han X, Jin F, Xu Y, Cao P, Cao P, et al: Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma. Oncol Lett 14: 5249-5256, 2017.
APA
Chen, X., Zhang, Y., Wang, F., Wang, M., Teng, W., Lin, Y. ... Liu, H. (2017). Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma. Oncology Letters, 14, 5249-5256. https://doi.org/10.3892/ol.2017.6898
MLA
Chen, X., Zhang, Y., Wang, F., Wang, M., Teng, W., Lin, Y., Han, X., Jin, F., Xu, Y., Cao, P., Fang, J., Zhu, P., Tong, C., Liu, H."Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma". Oncology Letters 14.5 (2017): 5249-5256.
Chicago
Chen, X., Zhang, Y., Wang, F., Wang, M., Teng, W., Lin, Y., Han, X., Jin, F., Xu, Y., Cao, P., Fang, J., Zhu, P., Tong, C., Liu, H."Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma". Oncology Letters 14, no. 5 (2017): 5249-5256. https://doi.org/10.3892/ol.2017.6898
Copy and paste a formatted citation
x
Spandidos Publications style
Chen X, Zhang Y, Wang F, Wang M, Teng W, Lin Y, Han X, Jin F, Xu Y, Cao P, Cao P, et al: Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma. Oncol Lett 14: 5249-5256, 2017.
APA
Chen, X., Zhang, Y., Wang, F., Wang, M., Teng, W., Lin, Y. ... Liu, H. (2017). Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma. Oncology Letters, 14, 5249-5256. https://doi.org/10.3892/ol.2017.6898
MLA
Chen, X., Zhang, Y., Wang, F., Wang, M., Teng, W., Lin, Y., Han, X., Jin, F., Xu, Y., Cao, P., Fang, J., Zhu, P., Tong, C., Liu, H."Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma". Oncology Letters 14.5 (2017): 5249-5256.
Chicago
Chen, X., Zhang, Y., Wang, F., Wang, M., Teng, W., Lin, Y., Han, X., Jin, F., Xu, Y., Cao, P., Fang, J., Zhu, P., Tong, C., Liu, H."Germline cytotoxic lymphocytes defective mutations in Chinese patients with lymphoma". Oncology Letters 14, no. 5 (2017): 5249-5256. https://doi.org/10.3892/ol.2017.6898
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team