Low miR‑210 and CASP8AP2 expression is associated with a poor outcome in pediatric acute lymphoblastic leukemia

  • Authors:
    • Yanyan Mei
    • Zhigang Li
    • Yi Zhang
    • Weiling Zhang
    • Huimin Hu
    • Pinwei Zhang
    • Minyuan Wu
    • Dongsheng Huang
  • View Affiliations

  • Published online on: October 20, 2017     https://doi.org/10.3892/ol.2017.7229
  • Pages:8072-8077
Metrics: HTML 0 views | PDF 0 views     Cited By (CrossRef): 0 citations

Abstract

The prognostic significance of microRNA (miR)‑210 and the caspase 8‑associated protein 2 (CASP8AP2) gene in children with acute lymphoblastic leukemia (ALL) has been validated and CASP8AP2 has been demonstrated as a target of miR‑210. In the present study, the reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) was used to determine miR‑210 and CASP8AP2 expression in 91 children with ALL. Associations between gene expression levels and the prognostic value of combined detection of the two indicators were analyzed. Results from a receiver operating characteristic curve demonstrated that threshold values of miR‑210 and CASP8AP2 were 3.8243 and 0.4760, respectively. Although the expression of miR‑210 and CASP8AP2 were not associated at the mRNA level in pediatric ALL, combined detection of the two predicted ALL prognosis with an increased accuracy. Furthermore, an equation was devised including minimal residual disease at day 33 and expression of miR‑210 and CASP8AP2, which may enable bone marrow relapse to be predicted more precisely compared with the current risk stratification.

Introduction

Acute lymphoblastic leukemia (ALL) is the most common type of pediatric cancer, accounting for ~25% of all malignancies diagnosed in children <15 years (1). Although the outcome of childhood ALL has markedly improved with advancements in risk-adapted chemotherapy and supportive care (2), between 15 and 20% of patients eventually relapse (3) and recurrent ALL remains the primary obstacle in improving the cure rate and decreasing mortality (4).

Minimal residual disease (MRD) in the early stages of treatment has been widely recognized as one of the most powerful prognostic indicators. However, not all patients with positive MRD relapse and certain patients with negative MRD may relapse. To avoid inadequate therapy for high-risk patients and over-treatment for low-risk patients (5), novel prognostic indicators are urgently required for risk refinement.

An independent study has indicated that microRNA (miR)-210 is consistently and predominantly upregulated in hypoxic states (6). By acting on target genes, miR-210 is involved in a range of physiological and pathological processes (79). In our previous study (10), it was demonstrated that miR-210 is an independent prognostic factor for pediatric ALL and that low miR-210 expression (threshold value, 3.8243) is a good predictor for relapse and induction failure in childhood ALL.

Caspase 8-associated protein 2 (CASP8AP2), a component of Cajal bodies, is an essential factor in regulating histone gene transcription, apoptosis and S phase progress (1113). Flotho et al (14) demonstrated that decreased CASP8AP2 expression is markedly associated with increased rates of MRD and hematological relapse. Kim et al (15) demonstrated that CASP8AP2 is a target of miR-210 in bone marrow-derived mesenchymal stem cells. However, an association between expression levels in ALL cells was not identified.

In the present study, the clinical significance of CASP8AP2 and the association between CASP8AP2 and miR-210 was analyzed. In addition, the prognostic value of combined detection of miR-210 and CASP8AP2 expression was determined.

Materials and methods

Patients and treatment

Between March 2008 and July 2010, 203 children with newly diagnosed ALL were enrolled in the Chinese Children's Leukemia Group (CCLG)-ALL 2008 protocol at Beijing Children's Hospital. Criteria for patient inclusion were ≥70% leukemic cells in diagnostic bone marrow (BM) samples (16), treatment according to the CCLG-ALL 2008 protocol (17) and sufficient BM sample for total RNA/microRNA (miRNA) extraction. A total of 112 children with ALL were excluded from analysis.

On the basis of these criteria, 91 patients (median age, 5 years; range, 1.0–14 years) were included in the present study (57 boys and 34 girls), with 81 cases of B cell precursor ALL (BCP-ALL) and 10 cases of T cell ALL (T-ALL). The median follow-up time was 37.2 months (range, 1.0–50.0 months). A total of 11 patients suffered from BM relapse or induction failure and all succumbed between 3 and 11 months after relapse or induction failure. A further 2 patients succumbed due to severe infection and the remaining 78 patients were in continuous complete remission (CCR). BM samples obtained from 5 ALL patients in CCR for >5 years (control group) were used as calibrators (18).

The CCLG-ALL 2008 protocol was approved by the Beijing Children's Hospital Institutional Ethics Committee and written informed consent was obtained by the patients' guardians.

miRNA isolation, reverse transcription and determination of miR-210 expression

Total miRNA was extracted using the mirVana miRNA Isolation kit (Ambion; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol as in our previous study (10). Collected miRNA was stored at −80°C.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed to determine miR-210 expression. Laboratory procedures and experimental details were as described in a previous study (10).

RNA isolation and cDNA synthesis

Mononucleated BM cells were isolated by Ficoll-Hypaque density-gradient centrifugation (MD Pacific Biotechnology Co., Ltd., Tianjin, China) and stored at −80°C until use. Total RNA was extracted within 2 weeks using TRIzol reagent according to the manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc.). mRNAs were reverse-transcribed into cDNAs using random hexamers and Moloney murine leukemia virus reverse transcriptase (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocol.

Quantitative analysis of CASP8AP2 expression

CASP8AP2 expression was detected using RT-qPCR. The primers and TaqMan probes, which were designed using Primer Express (version 3.0; Applied Biosystems; Thermo Fisher Scientific, Inc.) are listed in Table I. A TaqMan probe of the Abelson (ABL) gene was used as an internal control and associated primer sequences are described previously (19).

Table I.

Sequences of primers and probe for CASP8AP2 and ABL.

Table I.

Sequences of primers and probe for CASP8AP2 and ABL.

GenesSequences of primers and probe (5′-3′)
CASP8AP2CACTTGCCACTTCTACAAGTC (sense)
TGGCGGCTAAATATGCAAATG (antisense)
FAM-TGTCAGAAAAGAGGGCCATCATTTAAA-TAMRA (probe)
ABLATCCAAGAAGGGGCTGTCC (sense)
CCAACGAGCGGCTTCAC (antisense)
FAM-CCTTCAGCGGCCAGTAGCATC-TGA-TAMRA (probe)

[i] CASP8AP2, caspase 8-associated protein 2; ABL, Abelson murine leukemia viral oncogene homolog 1; FAM, 6-carboxyfluorescein; TAMRA, tetramethylrhodamine.

The reaction mixture contained TaqMan Master ROX mix (6.25 µl), 10 pmol each primer, 2.5 pmol probe, cDNA template (1 µl) and deionized water to a total volume of 12.5 µl. The reaction was performed at 95°C for 10 min, followed by 50 cycles of 15 sec at 95°C and 1 min at 60°C on a 7500 Real Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). Each sample was detected in triplicate. CASP8AP2 expression levels were calculated using the 2−ΔΔCq method and are presented as fold change compared with the control group (20).

Detection of MRD

MRD monitoring was performed by qPCR at the end of induction therapy (day 33). Patient-specific immunoglobulin (Ig) and T cell receptor (TCR) gene rearrangements, including IgH, IgK, IgL, Kde, TCRB, TCRG and TCRD, were used as qPCR targets for quantitative assessment of MRD. Detection methods were as previously described (21).

Statistical analysis

A receiver operating characteristic (ROC) curve was used to assess the predictive value of CASP8AP2 expression for relapse. Relapse-free survival (RFS) was defined as the time from the diagnostic date through the date of relapse at any site. Event-free survival (EFS) was estimated from the date of diagnosis to the date of induction failure, relapse, second tumor or mortality. Overall survival (OS) was defined as the time between diagnosis and mortality or last contact with the patient in CCR. Kaplan-Meier estimator survival analysis was used to determine the differences in RFS, EFS and OS. Spearman's correlation was used to determine the association between CASP8AP2 and miR-210. A Cox's proportional hazards model was utilized to determine an equation for assessment of the risk of bone marrow relapse. All analyses were performed with SPSS (version 16.0; SPSS, Inc., Chicago, IL, USA) for Microsoft Windows. P<0.05 was considered to indicate a statistically significant difference.

Results

Clinical value of CASP8AP2 expression

No statistically significant differences were identified between the included and excluded patients regarding age (P=0.752), sex (P=0.313), immunophenotype (P=0.083), transcription factor ETV6-AML (P=0.143), breakpoint cluster region-ABL (P=0.725), transcription factor 3-PBX homeobox 1 (P=0.902), myeloid/lymphoid or mixed-lineage leukemia rearrangement (P=0.837) and central nervous system (CNS) involvement (P=0.110).

Median CASP8AP2 expression in the 91 children evaluated was 0.6591 (range, 0.21–2.05). According to ROC curve analysis, the optimal threshold value for CASP8AP2 expression was 0.4760 [area under the curve (AUC), 0.865; 95% confidence interval, 0.725–1.006; P<0.001] with a sensitivity and specificity of 0.850 and 0.818, respectively.

Using this threshold value, the 91 patients were divided into low (n=21) and high (n=70) expression groups. The relapse rate in the low-CASP8AP2 group (9/21; 42.8%) was significantly increased compared with that of the high-CASP8AP2 group (2/70; 2.9%; P<0.001). The low-CASP8AP2 group exhibited decreased RFS (log-rank: P<0.001), EFS (log-rank: P<0.001) and OS (log-rank: P=0.005) compared with the high-CASP8AP2 group (Fig. 1A-C). The results of the present study indicated that CASP8AP2 expression in patients with newly diagnosed ALL is a valuable marker for predicting relapse.

Association between miR-210 and CASP8AP2 expression

Using the threshold value (3.8243) determined in our previous study, the cohort of 91 patients was divided into low (n=41) and high (n=50) expression groups. No association was identified between CASP8AP2 and miR-210 expression in these groups, regardless of continuous or grouped values (P>0.05). Associations between CASP8AP2, miR-210 and clinical characteristics are presented in Table II.

Table II.

Association of miR-210 and CASP8AP2 expression with clinical characteristics.

Table II.

Association of miR-210 and CASP8AP2 expression with clinical characteristics.

miR-210 expression CASP8AP2 expression


CharacteristicPatients (n=91)LowHighP-valueLowHighP-value
Age, years 0.083 0.402
  1–9732548 1657
  >101810  80.02  513
Sex 0.184 0.434
  Male5727300.0561443
  Female34  826   727
WBC count, cells/l 0.128 0.582
  <50×109612140 1447
  ≥50×1093014160.5  723
MRD (at day 33) 0.001
  Positive6722450.624  958
  Negative241311 1212
Immunophenotype 0.274
  BCP-ALL8129520.1512061
  T-ALL10  6  4   1  9
Prednisone response 0.009 0.227
  Good873354 1968
  Poor  4  2  20.385  2  2
CNS involvement 0.41
  No893455 2069
  Yes  2  1  1   1  1
Fusion genes
BCR-ABL 0.002
  Positive  6  4  2   5  1
  Negative853154 1669
TEL-AML1 0.016
  Positive27  534   225
  Negative643022 1945
MLL-AF4 0.231
  Positive  1  1  0   1  0
  Negative903456 20700.079
E2A-PBX1 0.366
  Positive  8  4  4   4  4
  Negative833152 1766

[i] miR, microRNA; CASP8AP2, caspase 8-associated protein 2; WBC, white blood cell; MRD, minimal residual disease; BCP, B cell precursor; ALL, acute lymphoblastic leukemia; CNS, central nervous system; BCR-ABL, breakpoint cluster region-Abelson murine leukemia viral oncogene homolog 1 fusion gene; TEL-AML1, ETS variant 6-acute myeloid leukemia 1 fusion gene; MLL-AF4, myeloid/lymphoid or mixed-lineage leukemia-ALL 1 fused gene on chromosome 4 fusion gene; E2A-PBX1, transcription factor 3-PBX homeobox 1 fusion gene.

Prognostic relevance of miR-210 and CASP8AP2 expression

miR-210 and CASP8AP2 expression are known prognostic indicators in pediatric ALL which prompted the determination in the present study of the efficacy of combining miR-210 and CASP8AP2 expression to predict relapse. The 91 patients were stratified into four groups according to miR-210 and CASP8AP2 expression. Of the 40 cases in the double high-expression group (miR-210high/CASP8AP2high), none of the patients relapsed, with 3-year EFS and OS values of 93.1±9.9 and 95.7±0.3%, respectively. A total of 11 patients with double low-expression of the two genes (miR-210low/CASP8AP2low) exhibited the poorest outcomes with 3-year RFS, EFS and OS values of 27.3±13.4, 27.3±13.4 and 36.4±14.5%, respectively. No statistically significant difference was observed in prognosis between patients with single low-expression of the two genes (miR-210low/CASP8AP2high, n=30; miR-210high/CASP8AP2low, n=10) with 3-year RFS, EFS and OS values as follows: 91.7±5.6 vs. 88.9±10.5%; P=0.830; 91.7±5.6 vs. 80.0±12.6%; P=0.338; and 91.3±5.9 vs. 80.0±12.6%; P=0.351, respectively. The two subgroups were combined into a single group (n=40) and an intermediate prognosis was determined with 3-year RFS, EFS and OS values of 91.0±5.0, 88.0±5.6 and 83.3±6.9%, respectively (Fig. 2A-C). The results of the present study indicate that combined detection of miR-210 and CASP8AP2 expression may accurately predict ALL relapse.

Estimation of relapse risk based on clinical features, miR-210 and CASP8AP2 expression

In COX regression analysis, white blood cell counts, MRD at day 33, prednisone response, CNS involvement, BCR-ABL1, TEL-AML, E2A-PBX1, MLL rearrangement, and miR-210 and CASP8AP2 expression were considered covariates. Results of the present study indicated that MRD at day 33, miR-210 and CASP8AP2 expression are all independent prognostic indicators (Table III). On the basis of the final Cox's proportional hazards model for RFS, an equation, composed of the three factors, was devised to estimate the risk of relapse as follows: Risk index =3.393× MRD-3.549× miR-210-2.855× CASP8AP2

Table III.

Prognostic significance of miR-210 and CASP8AP2 expression levels and other common clinical features analyzed by Cox's proportional hazards model.

Table III.

Prognostic significance of miR-210 and CASP8AP2 expression levels and other common clinical features analyzed by Cox's proportional hazards model.

95% confidence intervals for HR

FeaturesHazard ratio (HR)P-valueLowerUpper
miR-2100.0290.0120.0020.461
CASP8AP20.0580.0150.0060.575
MRD (at day 33)29.7420.0261.498590.316
Prednisone response1.3520.7960.13813.259
CNS involvement4.2460.4500.100180.757
BCR-ABL0.4670.5340.0425.147
TEL-AML0.3100.4100.0195.043
E2A-PBX13.1510.4360.17656.447
MLL rearrangements1.9140.6580.10833.988

[i] miR, microRNA; CASP8AP2, caspase 8-associated protein 2; MRD, minimal residual disease; CNS, central nervous system; BCR-ABL, breakpoint cluster region-Abelson murine leukemia viral oncogene homolog 1 fusion gene; TEL-AML1, ETS variant 6-acute myeloid leukemia 1 fusion gene; E2A-PBX1, transcription factor 3-PBX homeobox 1 fusion gene; MLL, myeloid/lymphoid or mixed-lineage leukemia gene.

In the aforementioned equation, MRD represents MRD at day 33 (1 for MRD <10−4 and 2 for MRD ≥10−4), miR-210 represents miR-210 expression levels (1 for low-miR-210 and 2 for high-miR-210) and CASP8AP2 represents CASP8AP2 expression levels (1 for low-CASP8AP2 and 2 for high-CASP8AP2). The predictive value of this algorithm was tested using an ROC curve. The AUC was 0.965 (P<0.001), which was improved compared with miR-210 and CASP8AP2 expression or clinical risk stratification alone (0.789, 0.865 and 0.841, respectively; Fig. 3), indicating that combined assessment of miR-210 and CASP8AP2 expression may identify patients at increased risk of relapse.

Discussion

In the present study, the AUC of the ROC curve of the current clinical risk stratification was 0.841, suggesting that improvement is required. The prognostic value of miR-210 and CASP8AP2 has been demonstrated in previous studies, and CASP8AP2 has been demonstrated as a target of miR-210 in stem cells. The present study evaluated the association between miR-210 and CASP8AP2 in pediatric ALL at the mRNA level and explored the prognostic significance of joint detection. The results of the present study identified that decreased miR-210 or CASP8AP2 expression in newly diagnosed ALL patient BM samples was associated with increased MRD, increased BM relapse rate and poor RFS, EFS and OS. Multivariate analyses indicated that miR-210 and CASP8AP2 expression are independent prognostic factors following adjustment for other risk factors. Combined assessment of miR-210 and CASP8AP2 expression is considered an improved method, compared with a single assessment or the current clinical risk stratification, in identifying patients at increased risk of relapse. Furthermore, an equation was devised for estimating bone marrow relapse risk, based on MRD at day 33 and miR-210 and CASP8AP2 expression. As expected, the equation predicted treatment outcome more precisely than clinical risk stratification alone.

Functioning as a hypoxamir, miR-210 participates in regulation of a number of physiological and pathological processes including cell survival, proliferation, differentiation, apoptosis and development (79). A previous study has indicated that leukemic bone marrow is likely in a hypoxic microenvironment at the initial diagnosis, due to the increased proliferation and oxygen consumption of leukemic cells (22). This is consistent with the results of the present study indicating that increased miR-210 expression is prevalent in BM samples at initial diagnosis. In our previous study, the prognostic significance of decreased miR-210 expression in pediatric ALL was demonstrated (10). However, Zhang et al (23) identified that miR-210 expression in a high-risk group (HR) was significantly increased, compared with that in intermediate risk (IR) or standard risk (SR) groups, indicating that increased miR-210 expression is associated with an poorer outcome in pediatric ALL, which is in contrast with the results of the present study. The reasons for the conflicting results may be a substantial difference in the risk classification between the two groups. Zhang et al (23) conducted a study in which the proportion of HR patients was increased compared with that in the present study (36.7%, 18/49 vs. 17.5%, 16/91, respectively). In addition, Zhang et al (23) extracted total miRNAs using TRIzol reagent and detected miRNA levels using an miRNA chip, whereas the present study used mirVana miRNA Isolation kit, TaqMan MicroRNA Assay and RT-qPCR.

Kim et al (15) demonstrated that CASP8AP2 is the target of miR-210 in bone marrow-derived mesenchymal stem cells. However, the present study did not identify an association between these factors; this may be due to the fact that miRNAs regulate gene expression post-transcriptionally which failed to demonstrate a negative association at the mRNA level (24). The complex regulatory network, including miR-210 and its target genes, varies in distinct cell types and further studies are required to explore additional possible associations.

Target genes of miR-210 in pediatric ALL have not been studied and the underlying molecular mechanisms of decreased miR-210 expression associated with a poor prognosis remain unclear. Additional studies are required to elucidate the underlying molecular mechanisms of poor prognosis linked to decreased miR-210 and CASP8AP2 expression in pediatric ALL. Studies of the role that these indicators serve in drug resistance may provide insight into their prognostic value in treating pediatric ALL.

Acknowledgements

The present study was supported by the Priming Scientific Research Foundation for the Junior Researcher in Beijing Tongren Hospital, Capital Medical University (grant no. 2014-YJJ-ZZL-011), the Key Scientific Research Training Fund of Beijing Tongren Hospital, Capital Medical University (grant no. 2015-YJJ-GGL-009).

References

1 

Pui CH, Carroll WL, Meshinchi S and Arceci RJ: Biology, risk stratification, and therapy of pediatric acute leukemias: An update. J Clin Oncol. 29:551–565. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Hunger SP, Lu X, Devidas M, Camitta BM, Gaynon PS, Winick NJ, Reaman GH and Carroll WL: Improved survival for children and adolescents with acute lymphoblastic leukemia between 1990 and 2005: A report from the children's oncology group. J Clin Oncol. 30:1663–1669. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Locatelli F, Schrappe M, Bernardo ME and Rutella S: How I treat relapsed childhood acute lymphoblastic leukemia. Blood. 120:2807–2816. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Bhojwani D and Pui CH: Relapsed childhood acute lymphoblastic leukaemia. Lancet Oncol. 14:e205–e217. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Pui CH, Mullighan CG, Evans WE and Relling MV: Pediatric acute lymphoblastic leukemia: Where are we going and how do we get there? Blood. 120:1165–1174. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Huang X, Le QT and Giaccia AJ: MiR-210-micromanager of the hypoxia pathway. Trends Mol Med. 16:230–237. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Devlin C, Greco S, Martelli F and Ivan M: miR-210: More than a silent player in hypoxia. IUBMB Life. 63:94–100. 2011.PubMed/NCBI

8 

Crosby ME, Kulshreshtha R, Ivan M and Glazer PM: MicroRNA regulation of DNA repair gene expression in hypoxic stress. Cancer Res. 69:1221–1229. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Chan SY and Loscalzo J: MicroRNA-210: A unique and pleiotropic hypoxamir. Cell Cycle. 9:1072–1083. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Mei Y, Gao C, Wang K, Cui L, Li W, Zhao X, Liu F, Wu M, Deng G, Ding W, et al: Effect of microRNA-210 in prognosis and response to chemotherapeutic drugs in pediatric acute lymphoblastic leukemia. Cancer Sci. 105:463–472. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Barcaroli D, Dinsdale D, Neale MH, Bongiorno-Borbone L, Ranalli M, Munarriz E, Sayan AE, McWilliam JM, Smith TM, Fava E, et al: FLASH is an essential component of Cajal bodies. Proc Natl Acad Sci USA. 103:pp. 14802–14807. 2006, View Article : Google Scholar : PubMed/NCBI

12 

Barcaroli D, Bongiorno-Borbone L, Terrinoni A, Hofmann TG, Rossi M, Knight RA, Matera AG, Melino G and De Laurenzi V: FLASH is required for histone transcription and S-phase progression. Proc Natl Acad Sci USA. 103:pp. 14808–14812. 2006, View Article : Google Scholar : PubMed/NCBI

13 

Chen S, Evans HG and Evans DR: FLASH knockdown sensitizes cells to Fas-mediated apoptosis via down-regulation of the anti-apoptotic proteins, MCL-1 and Cflip short. PLoS One. 7:e329712012. View Article : Google Scholar : PubMed/NCBI

14 

Flotho C, Coustan-Smith E, Pei D, Iwamoto S, Song G, Cheng C, Pui CH, Downing JR and Campana D: Genes contributing to minimal residual disease in childhood acute lymphoblastic leukemia: Prognostic significance of CASP8AP2. Blood. 108:1050–1057. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Kim HW, Haider HK, Jiang S and Ashraf M: Ischemic preconditioning augments survival of stem cells via miR-210 expression by targeting caspase-8-associated protein 2. J Biol Chem. 284:33161–33168. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Carroll WL, Bhojwani D, Min DJ, Raetz E, Relling M, Davies S, Downing JR, Willman CL and Reed JC: Pediatric acute lymphoblastic leukemia. Hematology Am Soc Hematol Educ Program. 102–131. 2003.PubMed/NCBI

17 

Wang KL, Mei YY, Cui L, Zhao XX, Li WJ, Gao C, Liu SG, Jiao Y, Liu FF, Wu MY, et al: E2F3a gene expression has prognostic significance in childhood acute lymphoblastic leukemia. Eur J Haematol. 93:281–289. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Rieu I and Powers SJ: Real-time quantitative RT-PCR: Design, calculations, and statistics. Plant Cell. 21:1031–1033. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Pallisgaard N, Clausen N, Schroder H and Hokland P: Rapid and sensitive minimal residual disease detection in acute leukemia by quantitative real-time RT-PCR exemplified by t(12;21) TEL-AML1 fusion transcript. Genes Chromosomes Cancer. 26:355–365. 1999. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Gao C, Zhao XX, Li WJ, Cui L, Zhao W, Liu SG, Yue ZX, Jiao Y, Wu MY and Li ZG: Clinical features, early treatment responses, and outcomes of pediatric acute lymphoblastic leukemia in China with or without specific fusion transcripts: A single institutional study of 1,004 patients. Am J Hematol. 87:1022–1027. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Mortensen BT, Jensen PO, Helledie N, Iversen PO, Ralfkiaer E, Larsen JK and Madsen MT: Changing bone marrow micro-environment during development of acute myeloid leukaemia in rats. Br J Haematol. 102:458–464. 1998. View Article : Google Scholar : PubMed/NCBI

23 

Zhang H, Luo XQ, Zhang P, Huang LB, Zheng YS, Wu J, Zhou H, Qu LH, Xu L and Chen YQ: MicroRNA patterns associated with clinical prognostic parameters and CNS relapse prediction in pediatric acute leukemia. PLoS One. 4:e78262009. View Article : Google Scholar : PubMed/NCBI

24 

Qin Q, Furong W and Baosheng L: Multiple functions of hypoxia-regulated miR-210 in cancer. J Exp Clin Cancer Res. 33:502014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

December 2017
Volume 14 Issue 6

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Mei, Y., Li, Z., Zhang, Y., Zhang, W., Hu, H., Zhang, P. ... Huang, D. (2017). Low miR‑210 and CASP8AP2 expression is associated with a poor outcome in pediatric acute lymphoblastic leukemia. Oncology Letters, 14, 8072-8077. https://doi.org/10.3892/ol.2017.7229
MLA
Mei, Y., Li, Z., Zhang, Y., Zhang, W., Hu, H., Zhang, P., Wu, M., Huang, D."Low miR‑210 and CASP8AP2 expression is associated with a poor outcome in pediatric acute lymphoblastic leukemia". Oncology Letters 14.6 (2017): 8072-8077.
Chicago
Mei, Y., Li, Z., Zhang, Y., Zhang, W., Hu, H., Zhang, P., Wu, M., Huang, D."Low miR‑210 and CASP8AP2 expression is associated with a poor outcome in pediatric acute lymphoblastic leukemia". Oncology Letters 14, no. 6 (2017): 8072-8077. https://doi.org/10.3892/ol.2017.7229